Universidade de Lisboa
Faculdade de Medicina de Lisboa
“Dissecting the Biophysical
Mechanisms Underlying Regeneration
of Complex Organs in Vertebrates”
Joana Freire de Castiço Monteiro
Doutoramento em Ciências Biomédicas
Especialidade em Ciências Morfológicas
2014
Universidade de Lisboa
Faculdade de Medicina de Lisboa
“Dissecting the Biophysical Mechanisms
Underlying Regeneration of Complex
Organs in Vertebrates”
Joana Freire de Castiço Monteiro
Tese orientada pelo Professor Doutor António Alfredo Coelho Jacinto
Tese co-orientada pelo Professor Doutor Joaquín Rodríguez-Léon e pelo
Professor Doutor Domingos Manuel Pinto Henrique
Doutoramento em Ciências Biomédicas
Especialidade em Ciências Morfológicas
As opiniões expressas nesta publicação são da exclusiva responsabilidade do seu autor.
A impressão desta dissertação foi aprovada pelo Conselho Científico
da Faculdade de Medicina de Lisboa em reunião de 23 de Julho de
2014.
Acknowledgements/ Agradecimentos
First of all I want to thank to Ana Catarina Certal, who made this project possible.
Thank you for all the teaching, trust and encouragement.
Joaquin Rodríguez-Léon, thank you for the prompt help, patience and encouragement.
Your mentoring during the thesis writing was fundamental. You’ll always be the
BOSS!
António Jacinto, Leonor Saúde, Rita Fior, thank you for the data discussion and
support. Moisés Mallo, you were always available to help and let me borrow your
“crew” for so many times: thanks for making me feel part of the group. Alan Shipley,
thanks for the prompt SIET technical support, and thanks for caring.
To the “Organogenics” and to the “lab next door”, thank you for providing a great
working environment, for listening to my frustrations and applauding my
achievements: Rita Aires, Rita Félix, Teresa Gomes, Raquel Tomás, Fernando Ferreira,
Diana Chapela, Rui Castanhinha, Isabel Guerreiro, Sofia Pereira, Ana Nóvoa, Arnón
Juberg, Ana Casaca, Ana Cristina, Aibüke: what a great team!!! Rita Aires, thank you
for your help regarding the molecular biology techniques and for all the support.
“Nandinho”, thank you for your collaboration regarding the chloride-specific flux
measurements. Teresa Gomes, my SIET-mate, thanks for the SIET-help, and thanks
for listening to me so patiently!
It was a great pleasure to be part of the IGC/IMM community, that provided an
outstanding working environment and cooperation between all people. Particularly, I
would like to leave my appreciation to Lara Carvalho, Maysa Franco and Liliana Vale,
who took so great care of “my babies”; to Alessandro Ramos, for all the expertise
during SIET optimization; and to Mariana Simões, for the availability to discuss data
and protocols. Also, to Ana Homem, to the ladies from the cleaning room and the guys
from the maintenance, especially Monteiro and Sr. Sousa, all of you made my life
Page | i
much easier for so many times. Also, this project was not possible without the FCT
financial support.
E agora em bom português, uma palavra especial aos meus pais, Gabi e Tó: obrigada
pela educação que me proporcionaram e que me trouxe até aqui! Esta tese também é
vossa. Tenho muito orgulho em ser vossa filha!
Às minhas irmãs, Sofia, Filipa e Inês, porque é tão bom ter irmãs com quem partilhar a
vida!! Ao Pedro e à Leonor, que fazem de mim uma tia babadíssima. Ao Ricardo, por
nunca duvidar de que eu seria capaz. À avó Lili, pelo exemplo de aceitação e sentido
de humor para com a vida. Ao avô Castiço, pelo orgulho nas netas que lhe salta pelos
olhos e pelo esforço para entender o que eu faço. Ao avô Mário, por ter respondido a
tantos “e se…?” sobre números e afins. À avó Julieta, agradeço os abraços sempre
prontos, e a ajuda nestes últimos anos.
A todos os meus amigos, e em especial a Susana C, a Marta, a Raquel, o Ricardo S, o
Ricardo L, o Mário, o Miguel, a Joana, a Paula, a Susana Z, o André, o Flacho, a Maria
João, obrigada por escutarem os meus entusiamos e frustrações ao longo deste
projeto, mesmo quando não percebiam nada do que é que eu estava para ali a dizer! E
pela amizade que não tem preço.
Page| ii
Table of contents
Acknowledgments/ Agradecimentos ................................................................................................... i
Table of contents ........................................................................................................................................ iii
List of figures ............................................................................................................................................ viii
List of tables ............................................................................................................................................... xii
List of abbreviations .............................................................................................................................. xiii
Resumo ......................................................................................................................................................... xv
Summary ................................................................................................................................................. xviii
Chapter I- Introduction .......................................................................... 1
1. Animal Regeneration .......................................................................................................
1.1. Historical overview .......................................................................................................................
1.2. Types of regeneration ..................................................................................................................
1.2.1. Cellular reprogramming .....................................................................................................
1.3. Regeneration among Metazoa: distribution and evolution .........................................
3
3
4
5
6
2. Zebrafish regeneration ................................................................................................ 10
2.1. Structure of the caudal fin ............................................................................................................ 11
2.2. Stages of epimorphic regeneration in the zebrafish caudal fin .................................... 13
2.2.1. Wound healing ......................................................................................................................... 14
2.2.2. Blastema formation ................................................................................................................ 16
2.2.2.1. Cellular origin of the blastema ............................................................................... 18
2.2.3. Regenerative outgrowth ...................................................................................................... 19
2.2.4. Positional memory ................................................................................................................. 23
3. Endogenous electrical signals of biological significance .................................... 25
3.1. Origin of endogenous electric currents and electric fields ............................................ 25
3.2. Endogenous electrical signals as morphogenetic signals ............................................... 28
3.2.1. Endogenous electric currents and electric fields during development ......... 28
3.2.2. Endogenous electric currents and electric fields during wound healing and
regeneration ........................................................................................................................... 29
3.3. Bioelectrical signals control cell behaviour .......................................................................... 32
3.3.1. Bioelectrical control of cell behaviour during wound healing ............................ 32
3.3.2. Bioelectrical signals control cell behaviour required for regeneration ......... 34
3.3.2.1. Cell proliferation .......................................................................................................... 34
3.3.2.2. Cell differentiation/ de-differentiation .............................................................. 35
3.3.2.3. Apoptosis ........................................................................................................................ 37
3.3.2.4. Tissue patterning ......................................................................................................... 37
Page | iii
3.4. Chemical signals mediated by ion translocators affect cell behaviour ..................... 38
3.5. How do cells sense and transduce bioelectrical signals into cell behaviour .......... 39
4. Protons: chemical and electrical functions ............................................................... 43
4.1. Proton transport across membranes ....................................................................................... 44
4.2. V-ATPase: main proton (H+) pump in animal cells ............................................................ 46
4.2.1. Structure and subunit function ......................................................................................... 46
4.2.2. Mechanism of activity ........................................................................................................... 49
4.2.3. Regulation of activity ............................................................................................................. 50
4.2.4. V-ATPase functions ................................................................................................................ 51
5. Tools for dissecting bioelectrical signals ................................................................... 54
5.1 Scanning Ion-selective Electrode Technique (SIET) .......................................................... 55
6. AIMS OF THE THESIS .................................................................................................... 57
Chapter II – Materials and Methods .................................................. 59
1. Animal model ..................................................................................................................... 61
1.1. Zebrafish strains and husbandry ............................................................................................... 61
1.2. General procedures in adult zebrafish .................................................................................... 61
1.2.1. Anaesthesia and euthanasia ................................................................................................ 61
1.2.2. Caudal fin amputation and tissue collection ................................................................ 62
1.3. General procedures in zebrafish embryos and larvae ..................................................... 63
1.3.1. Embryo and larvae anaesthesia and euthanasia ........................................................ 63
1.3.2. Fin fold amputation ................................................................................................................. 63
1.3.3. Embryo and larvae collection, fixation and initial processing .............................. 63
2. Scanning Ion-selective Electrode Technique (SIET) .............................................. 65
2.1. Construction of ion-selective electrodes (ISE) .................................................................... 65
2.1.1. Pulling conditions .................................................................................................................... 65
2.1.2. Silanization .................................................................................................................................. 65
2.1.3. Electrode filling ......................................................................................................................... 66
2.2. Completing the SIET system ........................................................................................................ 66
2.3. Calibration of the ISE ...................................................................................................................... 67
2.4. Recording solution and anaesthesia optimization ............................................................ 68
2.5. Recording chamber optimization .............................................................................................. 68
2.6. Artificial Source ................................................................................................................................. 68
2.7. Data acquisition and analysis ...................................................................................................... 69
3. Microarray ........................................................................................................................... 71
4. Quantitative real-time PCR (qRT-PCR) ....................................................................... 72
5. Whole mount in situ hybridization .............................................................................. 73
5.1. Cloning of gene- specific DNA sequences .............................................................................. 73
Page| iv
5.1.1. Isolation and recombination of DNA sequences for the genes of interest ...... 73
5.1.2. Transformation and clone selection ................................................................................ 75
5.2. Recombinant DNA amplification ............................................................................................... 75
5.3. Plasmid linearization and in vitro RNA probe transcription ......................................... 76
5.4. In situ hybridization protocols for caudal fin and whole embryos ............................. 77
6. Whole mount immunohistochemistry ........................................................................ 78
6.1. Cell proliferation assay .................................................................................................................. 78
7. Histological techniques .................................................................................................... 80
7.1. Cryopreservation and sectioning .............................................................................................. 80
7.2. Hematoxylin-Eosin staining ........................................................................................................ 80
8. In vivo manipulation techniques .................................................................................. 81
8.1. Microinjection .................................................................................................................................... 81
8.2. Electroporation ................................................................................................................................. 81
8.3. Dose-response curves for ion transporter inhibitors ...................................................... 81
8.4. Pharmacological inhibition of V-ATPase activity in regenerating caudal fins ....... 82
8.5. Morpholino-mediated knockdown of V-ATPase subunit in the caudal fin ............. 83
8.6. Fin fold regeneration ...................................................................................................................... 84
9. Microscopy techniques ................................................................................................... 85
9.1 Scanning electron microscopy ..................................................................................................... 85
9.2. Microscopy and image analysis .................................................................................................. 85
Chapter III – Results ……………………….......…………….……………….. 87
Part 1. Optimization of the Scanning Ion-selective Electrode Technique …
……………………………………………………………………………………………………………... 91
1.1. Ion-selective electrode ................................................................................................................... 93
1.2. Recording media ............................................................................................................................... 93
1.3. Recording chamber ......................................................................................................................... 96
1.4. Artificial sources ............................................................................................................................... 97
Discussion .................................................................................................................................................... 98
Part 2. Ion-specific fluxes during adult zebrafish caudal fin regeneration ..
…..................................................................................................................................... 101
2.1. Spatial ion-specific flux profile ................................................................................................ 101
2.2. Temporal ion-specific flux profile ......................................................................................... 101
2.3. Ion-specific composition of electric currents during regeneration ......................... 104
Discussion ................................................................................................................................................. 105
Part 3. Molecular source of proton efflux during regeneration of the
adult zebrafish caudal fin …………….…...……………………………………………….. 111
3.1. V-ATPase is up-regulated during adult zebrafish caudal fin regeneration .......... 111
Page | v
3.1.1. Transcriptomic analysis of the regenerating caudal fin ………………………..… 111
3.1.2. Analysis of V-ATPase expression in the regenerating caudal fin ……………… 117
3.1.2.1. qRT-PCR analysis of atp6v1e1b relative expression during regeneration
........................................................................................................................................... 117
3.1.2.2. Expression pattern of atp6v1e1b and atp6v1a during zebrafish embryonic development .................................................................................................. 118
3.1.2.3. Expression pattern of atp6v1e1b and atp6v1a during regeneration of the
caudal fin ………………..………………..….………………………………………….... 120
3.1.2.4. Immunolocalization of Atp6v1a during caudal fin regenerating ….. 121
3.1.3. Analysis of Nhe7 expression in the regenerating caudal fin ............................... 124
3.2. V-ATPase inhibition affects adult caudal fin regeneration .......................................... 125
3.2.1. Effect of atp6v1e1b knockout in larval fin fold regeneration ............................. 125
3.2.2. Pharmacological inhibition of the V-ATPase activity in the regenerating caudal
fin …...…………………………………………......................………………………………………… 127
3.2.3. Morpholino-mediated knockdown of atp6v1e1b in the regenerating caudal fin
....................................................................................................................................................... 131
Discussion ................................................................................................................................................. 135
Part 4. Roles of V-ATPase and H+ efflux in the regenerative process ..... 145
4.1. V-ATPase expression correlates with position-dependent regeneration rate and
affects H+ efflux ...................................................................................................................................... 145
4.1.1. atp6v1e1b expression pattern during regeneration after proximal-distal (PD)
amputation ............................................................................................................................. 146
4.1.2. Immunolocalization of Atp6v1a during regeneration after PD amputation .. 147
4.1.3. H+ flux pattern after PD amputation ........................................................................... 150
4.1.3.1. H+ flux pattern using sedation methods alternative to Tricaine .......... 151
4.1.4. H+ flux pattern after fin amputation at the caudal peduncle ............................ 153
4.1.5. H+ efflux is affected by V-ATPase subunit atp6v1e1b knockdown ................ 156
4.2. Histological comparison of the regenerating caudal fin after proximal and distal
amputation …………………………………………………………………………………………….… 157
4.2.1. Hematoxylin-Eosin staining of regenerating fins after PD amputation …… 158
4.2.2. Scanning electron microscopy analysis of the wound healing stage during
caudal fin regeneration after proximal and distal amputation ........................ 160
4.3. V-ATPase is required during regeneration in an amputation plane- dependent
manner ........................................................................................................................................................ 165
4.4. V-ATPase affects molecular and cellular events during regeneration ................... 169
4.4.1. Blastema cell proliferation is reduced upon atp6v1e1b knockdown ............ 169
4.4.2. V-ATPase subunit knockdown affects fin innervation ........................................ 174
4.4.3. Comparison of regeneration markers expression in proximal and distal
stumps .................................................................................................................................... 177
Page| vi
4.4.4. V-ATPase is required for normal expression of aldh1a2 and mkp3 .............. 181
Discussion .................................................................................................................................................. 184
Chapter IV – General Discussion ……………….……………………….. 189
Chapter V – References ….…………………….…………………………….. 205
Chapter VI - Appendixes ……………………….……………………………. 247
Page | vii
List of figures
Page
Figure I.1 – Phylogenetic distribution of epimorphic regeneration among the Metazoa ..8
Figure I.2 – Zebrafish structures with regenerative ability .................................................. 10
Figure I.3 – Structure of the zebrafish caudal fin ...................................................................... 13
Figure I.4 – Stages of epimorphic regeneration ......................................................................... 14
Figure I.5 – Fin ray morphology and signalling during epimorphic regeneration ..... 22
Figure I.6 – Origin of endogenous electric signals .................................................................... 26
Figure I.7 – Membrane potential (V mem ) affects developments ..........................................
29
Figure I.8 – Electric field (EF) affects wound healing rate in rat cornea ......................... 30
Figure I.9 – Bioelectrical signals correlate with regenerative ability in amphibians ...... 32
Figure I.10 – Electric fields (EF) affect cell division and nerve sprouting during
wound healing in rat cornea ............................................................................................................... 33
Figure I.11 – Membrane voltage (V mem ) correlates with proliferative potential and
differentiation state of cells .................................................................................................................. 36
Figure I.12 – Membrane potential (V mem ) mediated by the H+,K+-ATPase regulates
patterning during planarian regeneration .................................................................................... 38
Figure I.13 – Transduction of bioelectrical signals into cell behaviour .......................... 41
Figure I.14 – Structure of the V-ATPase ........................................................................................ 48
Figure I.15 – Scanning Ion-selective Electrode Technique (SIET) ..................................... 56
Figure II.1 – Planes of caudal fin amputation ............................................................................. 62
Figure II.2 – Plane of caudal peduncle amputation .................................................................. 63
Figure III.1 – Optimized ion-selective electrodes (ISE) .......................................................... 91
Figure III.2 – Caudal fin regeneration rate under different fish bathing solutions .... 92
Figure III.3 – Recording set-up for SIET application to adult zebrafish caudal fin .... 94
Figure III.4 – Artificial source for potassium (K+), sodium (Na+), protons (H+),
calcium (Ca2+) and chloride (Cl-) ........................................................................................................ 95
Figure III.5 – Pattern of potassium (K+), sodium (Na+), calcium (Ca2+), chloride
(Cl-) and proton (H+)-specific fluxes during the main regeneration stages of the adult
zebrafish caudal fin ............................................................................................................................... 101
Figure III.6 – Contribution of individual ion-species to the total ionic flux during
the first 6hpa, when wound healing is taking place ………………………….…………..….. 102
Figure III.7 – qRT-PCR for fgf20a at 24 hpa .............................................................................. 110
Page| viii
Figure III.8 – Dynamic expression of ion transport- related transcripts during
regeneration ............................................................................................................................................. 114
Figure III.9 – qRT-PCR for atp6v1e1b during main stages of caudal fin regeneration . 116
Figure III.10 – atp6v1e1b is not expressed in the median fin fold of zebrafish embryos
................................................................................................................................................................................. 117
Figure III.11 – Expression of V-ATPase subunits atp6v1e1b and atp6v1a during
zebrafish embryonic development ................................................................................................. 117
Figure III.12 – atp6v1e1b expression in zebrafish embryos: whole body view ........ 118
Figure III.13 – Expression of V-ATPase subunits atp6v1e1b and atp6v1a during
caudal fin regeneration ....................................................................................................................... 119
Figure III.14 – Atp6v1a localizes specifically to the H+-ATPase rich cells in zebrafish
embryos ...................................................................................................................................................... 120
Figure III.15 – Immunolocalization of Atp6v1a in the regenerating caudal fin ........ 121
Figure III.16 – Atp6v1a localizes to the blastema .................................................................. 121
Figure III.17 – Detailed view of Atp6v1a localization in the regenerating fin tissue ... 122
Figure III.18 – In situ hybridization for nhe7 during caudal fin regeneration ........... 123
Figure III.19 – Phenotypic characterization of V-ATPase- mutant zebrafish
embryos and larvae ............................................................................................................................... 124
Figure III.20 – Larval fin fold regeneration in wild type and V-ATPase mutant
zebrafish embryos/larvae .................................................................................................................. 125
Figure III.21 – Effects of Concanamycin A (concA) in the embryonic development of
AB wild type zebrafish ......................................................................................................................... 127
Figure III.22 – DMSO and Concanamycin A (concA) dose-response curves for larval
zebrafish mortality, survival and abnormal phenotype, at 72 hours post fertilization . 128
Figure III.23 – Inhibition of V-ATPase activity in the regenerating caudal fin using
concA ........................................................................................................................................................... 128
Figure III.24 – Analysis of the specificity and toxicity of atp6v1e1b-specific
fluorescein- tagged morpholinos (fluo-MO), in zebrafish embryos ................................. 131
Figure III.25 – atp6v1e1b knockdown during fin regeneration, using fluorescein –
tagged morpholino (fluo-MO) .......................................................................................................... 132
Figure III.26 – Regeneration of zebrafish caudal fin after proximal-distal (PD)
amputation ................................................................................................................................................ 143
Figure III.27 – atp6v1e1b is differently up-regulated during regeneration of caudal
fin after PD amputation ....................................................................................................................... 144
Figure III.28 – Comparison of Atp6v1a domain in proximal versus distal regenerates
......................................................................................................................................................................... 146
Figure III.29 – Detailed view of Atp6v1a blastemal domain in proximal stumps
and distal stumps at 24 hpa .............................................................................................................. 147
Page | ix
Figure III.30 – Detailed view of Atp6v1a blastemal domain in proximal stumps
and distal stumps at 48 hpa ............................................................................................................... 148
Figure III.31 – H+ flux pattern during caudal fin regeneration after PD amputation
......................................................................................................................................................................... 149
Figure III.32 – Tricaine does not affect the detection of extracellular H+ efflux during
regenenation of the caudal fin .......................................................................................................... 151
Figure III.33 – Analysis of caudal fin regeneration after amputation at the caudal
peduncle .................................................................................................................................................... 153
Figure III.34 – atp6v1e1b knockdown using vivo- MO affects H+ efflux during
caudal fin regeneration ...................................................................................................................... 155
Figure III.35 – Hematoxylin-Eosin (H-E) staining of regenerating caudal fins 6 and
24 hours after proximal and distal amputation ........................................................................ 157
Figure III.36 – Hematoxylin-Eosin (H-E) staining of regenerating caudal fins, 48
hours after proximal and distal amputation ................................................................... 157/ 158
Figure III.37 – Scanning electron microscopy imaging of the caudal fin
immediately upon amputation at proximal and distal planes .......................................... 160
Figure III.38 – Scanning electron microscopy imaging of the caudal fin during the
wound healing stage after amputation at proximal or distal planes ............................... 161
Figure III.39 – Scanning electron microscopy imaging of the caudal fin during the
wound healing stage after amputation at proximal or distal planes – high
magnification detail of images in Fig. III.38 ............................................................................. 162
Figure III.40 – Injection of control vivo-MO (cvivo-MO) did not affect fin regeneration 164
Figure III.41 – atp6v1e1b knockdown after proximal and distal fin amputation,
using vivo-MO .......................................................................................................................................... 165
Figure III.42 – atp6v1e1b knockdown after proximal and distal fin amputation in
atp6v1e1b hi577aTg/+ zebrafish, using vivo-MO ............................................................................ 166
Figure III.43 – Immunodetection of apoptotic cells in regenerating fins after
atp6v1e1b knockdown ......................................................................................................................... 168
Figure III.44 –Quantification of proliferating cells in the blastema upon V-ATPase
knockdown ............................................................................................................................................... 169
Figure III.45 – Cell proliferation in atp6v1e1b knocked down fins, 24h after proximal
or distal amputation ............................................................................................................................. 170
Figure III.46 – Cell proliferation in atp6v1e1b knocked down fins, 48h after proximal
or distal amputation ............................................................................................................................. 171
Figure III.47 – Caudal fin innervation 24 h after proximal or distal amputation and
atp6v1e1b knockdown ......................................................................................................................... 173
Figure III.48 – Caudal fin innervation 48 h after proximal or distal amputation and
atp6v1e1b knockdown ......................................................................................................................... 174
Page| x
Figure III.49 – Expression of aldh1a2 in the regenerating caudal fin after PD
amputation ................................................................................................................................................ 177
Figure III.50 – Expression of wnt10a and wnt5b in the regenerating caudal fin after
PD amputation ......................................................................................................................................... 177
Figure III.51 – Expression of msxb and mkp3 in the regenerating caudal fin after PD
amputation ................................................................................................................................................ 178
Figure III.52 – Expression of osx and shh during caudal fin regeneration after PD
amputation ................................................................................................................................................ 179
Figure III.53 – atp6v1e1b knockdown affects the expression of specific genes
during regeneration .............................................................................................................................. 181
Figure IV.1 – V-ATPase H+ pumping activity is required during adult zebrafish caudal
fin regeneration: Working model ………….……………………..………………………..….………. 200
Page | xi
List of tables
Table II.1 – Ion-specific electrode filling solutions ................................................................... 66
Table II.2 – Ion-specific calibration solutions ............................................................................. 67
Table II.3 – Ion-specific artificial source solutions ................................................................... 69
Table II.4 – Sequence-specific primers for quantitative real-time PCR .......................... 72
Table II.5 – Sequence-specific primers for amplification of the genes of interest ...... 74
Table II.6 – Enzymes used to produce in vitro RNA probes from recombinant DNA .76
Table II.7 – Primary antibodies ......................................................................................................... 79
Table II.8 – Sequences of the morpholinos used ....................................................................... 84
Table III.1 – Optimization of ion-selective electrodes for H+, Na+, Ca2+ and Cl- - specific
flux recordings using SIET .................................................................................................................... 90
Table III.2 – Optimization of K+-selective electrodes for flux recordings using SIET
............................................................................................................................................................................ 90
Table III.3 – Characteristics of the optimized ion-selective electrodes
for SIET
application to adult zebrafish caudal fin ........................................................................................ 91
Table III.4 – Response of fish to different Tricaine concentrations (mM) ..................... 92
Table III.5 – Optimized recording medium for each ion species investigated with
SIET ................................................................................................................................................................. 93
Table III.6 – Validation of the microarray ....................................................................... 110/111
Table III.7 – Differentially expressed transcripts during regeneration ........................ 111
Table III.8 – Differentially expressed ion transport- related transcripts during
regeneration ............................................................................................................................................ 114
Table III.9 – V-ATPase subunits differentially expressed in the microarray ... 114/115
Table III.10 – Response of fish to different BTS concentrations (mM) ......................... 151
Page| xii
List of abbreviations
µV - microvolt
Ab – antibody
AEC – apical epidermal cap
AER– apical ectodermal ridge
ASET - Automated Scanning Electrode Technique software
ATP – adenosine triphosphate
BEL – basal epithelial layer
BTS – N-benzyl-p-toluenesulfonamide
Ca2+ – calcium
cfluo-MO – control fluorescein- tagged morpholino
Cl- – chloride
ConcA – concanamycin A
Cu2+ – copper
DB – distal blastema
DC – direct electric current
DMSO – Dimethyl sulfoxide
DNA – Deoxyribonucleic acid
Dpa – days post-amputation
EC – electric current
EF – electric field
Fluo-MO – fluorescein- tagged morpholino
FMUL – Faculdade de Medicina da Universidade de Lisboa
H+ – proton
H 3 O+ – hydronium
H3P – Phospho-Histone-3
Hpa – hours post-amputation
IGC – Instituto Gulbenkian de Ciência
ISE – ion-selective electrode
K+ – potassium
MCS – multiple cloning site
Page | xiii
MO – morpholino
mV – miliVolts
Na+ – sodium
O/N – overnight
PB – proximal blastema
PBS – phosphate buffered saline
PBT – PBS with 0.1% Tween-20
PCR – polymerase chain reaction
PD – proximal-distal
PFA – paraformaldehyde
pHi – intracellular pH
PZ – patterning zone
RNA – ribonucleic acid
RT – room temperature
RT-PCR – real time polymerase chain reaction
SIET – Scanning Ion-selective Electrode Tecnique
T°C – temperature Celsius
V – electric potential difference, voltage
V mem – membrane potential
WE – wound epidermis
WPI – World Precision Instruments
WT – Wild type
ZIRC – Zebrafish International Resource Center
Zn2+ – zinc
Page| xiv
Resumo
O corpo humano não consegue regenerar após a perda ou dano severo de um órgão
ou secção do corpo. Pelo contrário, outros metazoários têm essa capacidade,
alimentando a esperança de que mecanismos de regeneração similares possam ser
induzidos no Homem se formos capazes de fornecer os sinais apropriados. Nesse
sentido, ao longo de vários séculos, cientistas de todo o mundo têm-se dedicado ao
estudo dos mecanismos de regeneração em diferentes organismos. Atualmente
encontra-se disponível uma vasta biblioteca de informação relevante, mas ainda há
muitos aspetos da regeneração que precisam de ser explicados.
O teleósteo Danio rerio (peixe-zebra) é capaz de regenerar vários órgãos internos e
também as barbatanas. Estas últimas possuem uma estrutura simples, de fácil acesso
e exercem uma função não vital, constituindo por isso um excelente modelo para o
estudo da regeneração em vertebrados adultos. Após a amputação, uma nova
barbatana é formada no espaço de aproximadamente duas semanas, através de um
processo chamado regeneração epimórfica, que inclui três fases principais: fecho de
ferida (0-12 horas pós-amputação - hpa), formação do blastema (12-48 hpa), e
crescimento regenerativo (48 hpa até cerca de 2 semanas). O blastema é a estrutura
fundamental para a regeneração epimórfica, contendo a informação morfogenética
necessária para formar e modelar os tecidos perdidos. A regeneração é regulada pela
ação concertada de diversas vias moleculares de sinalização, incluindo Wnt (canónico
e não-canónico), Fgf, Shh, Bmp, Activin-βA, Notch e Ácido Retinoico.
Paralelamente às tradicionais vias moleculares de sinalização, a importância de um
outro grupo, o dos canais e transportadores iónicos, é cada vez mais evidente. A sua
ação coordenada resulta na acumulação de iões, e por isso carga elétrica, através da
membrana celular. As propriedades elétricas das células e organismos, incluindo o
potencial de membrana, correntes e campos elétricos endógenos, têm origem nessa
segregação de cargas. Entre os anos 60 e 80 (séc. XX), estes fenómenos bioelétricos
foram alvo de intensa investigação, e foi demonstrado que eles não só têm um papel
ativo na regeneração, como também são capazes de aumentar a capacidade
regenerativa de espécies que normalmente não regeneram. Já nos anos mais recentes,
têm sido desenvolvidas novas ferramentas para estudos de biologia celular e
Page | xv
molecular bem como novas tecnologias de imagiologia, que permitem novas
abordagens para investigar a natureza iónica dos sinais elétricos e identificar os seus
mediadores moleculares.
Assim, esta tese pretende contribuir para a compreensão das bases fisiológica e
molecular das correntes iónicas endógenas presentes durante o mecanismo de
regeneração epimórfica em animais vertebrados adultos. Além disso, esta tese visa
também o estudo da interação dos sinais bioelétricos com as tradicionais vias de
sinalização molecular envolvidas na regeneração.
A fim de identificar a composição iónica das correntes elétricas endógenas durante a
regeneração da barbatana caudal do peixe-zebra, recorremos a uma técnica
designada “Scanning Ion-selective Electrode Technique” (SIET), que permite medir
isoladamente os fluxos de cada espécie iónica de interesse. Após a otimização e
adaptação da técnica ao nosso modelo animal, confirmámos a existência de um perfil
dinâmico de fluxos iónicos durante a regeneração. Fluxos de sódio, potássio, cloreto e
cálcio parecem contribuir para o potencial de ferida, que é uma corrente elétrica com
carater universal, que se estabelece sempre após o ferimento de qualquer tecido e
dura até à ferida fechar. Por outro lado, detetámos o estabelecimento de um efluxo de
protões (H+) em fases posteriores ao fecho de ferida, o que sugere uma função
específica durante a regeneração.
Para identificar a fonte molecular do efluxo de H+ detetado, combinámos a abordagem
biofísica com técnicas de biologia molecular. Dessa forma, conseguimos demonstrar
que a V-ATPase, que é a principal bomba de protões em células animais, contribui
para o efluxo de H+. Descobrimos que tanto a expressão da V-ATPase como o efluxo
de H+ variam de intensidade de acordo com o plano de amputação ao longo do eixo
proximal-distal da barbatana, e estabelecemos uma correlação entre este fenómeno e
a cinética de regeneração, que também depende do plano de amputação. Mais,
demonstrámos que a inibição da atividade da V-ATPase diminui significativamente a
regeneração e que os tecidos do toco dependem mais da atividade da V-ATPase
quando a amputação é proximal do que após uma amputação distal. Estes resultados
sugerem um papel para a V-ATPase na regeneração associado à posição de
amputação.
Page| xvi
Foram também investigados os mecanismos através dos quais a atividade desta
bomba de H+ se articula com as tradicionais vias moleculares de sinalização, de forma
a comandar o comportamento celular e dar origem aos tecidos perdidos.
Demonstrámos que a V-ATPase é necessária para a expressão de pelo menos dois
importantes genes, aldh1a2 e mkp3, para a proliferação celular no blastema e para a
inervação normal da barbatana.
Tanto quanto conseguimos apurar, esta é o primeiro trabalho relativo ao papel da V-
ATPase durante a regeneração em vertebrados adultos.
Page | xvii
Summary
Humans are unable to regenerate after severe organ loss or amputation of body parts.
Notwithstanding, other metazoans have such a capacity, giving grounds for hope that
similar regeneration mechanisms can be induced in humans if the correct signals are
provided. This has driven scientists to investigate regeneration for centuries.
Nowadays, even though a great amount of data is available, there are still many
aspects of regeneration that still need eliciting.
The teleost Danio rerio (zebrafish) is able to regenerate several internal organs and
the fins. The latter constitutes a great model to study adult vertebrate regeneration
due to its simple structure, easy access and non-vital function. Upon amputation, a
new fin is produced roughly within two weeks through a process called epimorphic
regeneration, including three main stages: wound healing (0-12 hours post
amputation - hpa), blastema formation (12-48 hpa), and regenerative outgrowth (48
hpa to 2 weeks). Importantly, the blastema is the crucial structure for epimorphic
regeneration, containing the morphogenetic information required to give rise and repattern all the missing tissues. Regeneration is regulated by the orchestrated action of
several signalling pathways activated after injury, including Wnt (canonical and noncanonical), Fgf, Shh, Bmp, Activin-βA, Notch and Retinoic acid.
Alongside classical signalling pathways, the relevance of ion channels and
transporters for regeneration is becoming increasingly evident. Their coordinated
activity results in the differential accumulation of ions, thus electric charge, across
cells membranes. The electrical properties of cells and organisms, including
membrane potential, endogenous electric currents and electric fields, arise from this
charge segregation. In the 1960’s-1980’s, these bioelectrical phenomena were
extensively investigated, and it was demonstrated that they are crucial for wound
healing and regeneration. It was demonstrated that electrical cues not only have an
active role governing regeneration, but they can also augment regenerative ability in
species that normally do not regenerate. In the recent years, as new tools become
available regarding cellular and molecular biology and imaging technology, scientists
are beginning to unveil the ionic nature of electrical signals and the molecular players
that generate them. In that regard, this thesis intended to be a contribution to the
Page| xviii
understanding of the physiological and molecular basis of endogenous ionic currents
during adult vertebrate regeneration, and their interaction with canonical molecular
pathways involved in the regeneration.
We used the scanning ion-selective electrode technique (SIET) to identify the ion
nature of electric currents during regeneration in an adult vertebrate model, the
caudal fin of zebrafish (Danio rerio). After extensive optimization and adaptation of
the technique to the working model, we were able to show that there is a dynamic
profile of ion-specific fluxes during regeneration. Sodium, potassium, chloride and
calcium-specific fluxes seem to contribute to the injury potential, an electrical current
that establishes upon wounding of any tissue and lasts until the wound is closed. On
the other hand, we found that a proton (H+) outward current (efflux) is specifically set
during caudal fin regeneration in stages later that the wound healing, arguing in
favour of a regeneration-specific function.
To identify the molecular source of the regeneration-associated H+ efflux, we
combined biophysical and molecular approaches. This way, we were able to
demonstrate that the V-ATPase, which is the main H+ pump in animal cells,
contributes to the relevant H+ efflux. Interestingly, we found that the onset and
intensity of both V-ATPase expression and H+ efflux vary with the amputation plane
along the PD axis in a way that correlates with the regeneration kinetics. Specifically,
we could demonstrate that inhibition of V-ATPase activity impairs regeneration and
that proximal stumps have a stronger dependence on V-ATPase activity compared to
distally amputated fins. These findings suggest a role for V-ATPase in position-
dependent regeneration.
Another important question addressed regards how the activity of V-ATPase H+ pump
articulates with molecular signalling pathways to affect cell behaviour and give rise to
the missing tissues. We show that V-ATPase is required for aldh1a2 and mkp3
expression, blastema cell proliferation and normal fin innervation.
Overall, our findings show that V-ATPase contributes to a regeneration-specific
proton efflux, and is required for position-dependent regeneration by interfering with
the expression of genes and cell behaviours crucial for regeneration success.
To the best of our knowledge, this is the first report on the role of V-ATPase during
adult vertebrate regeneration.
Page | xix
Page| xx
Chapter I - Introduction
Chapter I
Introduction
Page | 1
Chapter I - Introduction
Page | 2
Chapter I - Introduction
1. Animal Regeneration
1.1. Historical overview
The ability to replace lost body parts has always been part of the human imaginary.
Ancient records go back to the Greek mythology, which described powerful creatures
like the Hydra, a multi-headed monster that regrew two heads every time one was cut
off, and the snake or dragon Uroborus that ate its own tail as it continuously
regenerated (Goss 1991).
The first reference to regeneration in a known organism belongs to Aristotle (384-
322 BC), who mentioned lizard tail regeneration, but it wasn’t until the 18th century
that regeneration became a field of scientific interest. Following the description of
limb regeneration in crayfish by René de Réaumur (1712) and the finding that hydra
regenerates after being cut into two or more pieces by Abraham Trembley (1740),
many other authors investigated the regenerative potential of both invertebrate (for
example annelids by Charles Bonnet in 1745, planarians by P.S. Pallas in 1770s and
Charles Darwin in 1839, among others) and vertebrate species (for example
amphibians by Spallanzani in 1769, and Todd in 1823, fish by Broussonet in 1786). In
1901, Thomas H. Morgan critically revised the findings done on the field of
regeneration until then, instituting a standard scientific terminology and data that
continues to inform regeneration studies today (Sunderland 2010). Later, with the
significant improvement of histological techniques in the beginning of the 20th
century, and the advent of genetic and molecular tools in the late 20th and early 21th
centuries, regeneration research progressed from gross observations to detailed
histological descriptions, to molecular studies identifying the cellular and molecular
networks that underlie regeneration in a variety of model systems (Dinsmore et al
1991, Carlson 2007, Tanaka and Galliot 2008). Although the understanding of the
regenerative machinery is still far from complete, the available data already allowed
the development of several stem cell based therapies that are now on clinical trial and
aim the improvement of different human health conditions, such as visual disorders,
Page | 3
Chapter I - Introduction
cardiac disfuncion and diabetes (Chhabra et al 2013, Koudstaal et al 2013, Ramsden
et al 2013).
1.2. Types of regeneration
The term “regeneration” has been used for centuries to refer to “the natural
restoration of the lost parts of an organism” (Morgan 1901). It is generally accepted
to distinguish two main types of regeneration based on the presence or absence of
injury or disease as the triggering factor:
• “Physiological regeneration”, defined as the regular replacement of worn-out or
short-lived structures in order to maintain the integrity of the multicelular body.
Some examples are the replacement of the skin, hair, bone, gut epithelium and
blood cells, and the shedding of crustaceous exoskeleton and snakes skin.
• “Reparative regeneration”, defined as the replacement of cells, tissues or body
sections upon injury or disease. This process is not common to all organisms, and
though it may represent survival upon trauma, it is not essential for life under
normal circumstances.
(Morgan 1901, Carlson 2007, Stoick-Cooper et al 2007a, Kawakami 2010, Poss 2010)
Reparative regeneration has been particularly subjected to investigation and
discussion due to its relevance for regenerative medicine. The diversity of
mechanisms that ensure the re-establishment of the shape and/or function of the lost
part is huge, and placing them into defined categories has not been easy or
consensual (Morgan 1901, Sánchez Alvarado 2000, Reddien and Sánchez Alvarado
2004, Agata et al 2007, Stoick-Cooper et al 2007a). Nevertheless, it is possible to
distinguish different types of reparative regeneration.
“Morphallaxis” is the reconstitution of the lost structure, in both shape and function,
by remodelling of the pre-existing tissues without need for cell proliferation. The
resulting organism is smaller than the original. Then, cell proliferation may occur to
bring the structures to the original size (Morgan, 1901, Galliot and Chera 2010). A
typical example of this process is apical head regeneration in the cnidarian Hydra
(Park et al 1970, Holstein et al 1991, Chera et al 2009).
Page | 4
Chapter I - Introduction
Oppositte to morphallaxis, the term “epimorphosis” was originally used by Morgan
(1901) to refer to the reparative regeneration strategies that rely on cell
proliferation. However, as regeneration research progressed, it became clear that
there are distinct modes of regeneration that depend on cell proliferation. Nowadays,
epimorphosis or “epimorphic regeneration” refers only to regeneration via formation
of a blastema, which is a population of undifferentiated progenitor cells that contains
intrinsic morphogenetic information required to re-pattern the regenerating
structure to its original tridimensional polarity, form and function (Mescher 1996,
Stoick-Cooper et al 2007a, Tanaka and Reddien 2011). Classical examples of this
mechanism are the regeneration of transected planarians and appendages in
amphibians and fish (tail and limb, and fins, respectively), but the process occurs in
many other organisms (Sánchez Alvarado and Tsonis 2006). Epimorphosis is many
times seen as the bona fide or perfect regeneration process, because new structures
are formed de novo and are very similar to the lost parts in both shape and function.
Consequently, this type of regeneration has been the most studied.
Other proliferation-dependent but blastema-independent types of regeneration are:
“hypertrophy” or “compensatory growth”, defined as the increase in mass of the
remainder part of an organ such as the mammalian liver and kidneys to compensate
the lost or non-functional portion (Carlson 2007, Stoick-Cooper et al 2007a); and
“tissue regeneration”, characterized by the repair of local and limited damage to an
organ predominantly via restoration of only one cell type (for example skeletal
muscle, bone).
1.2.1. Cellular reprogramming
The advances made so far in understanding natural regeneration processes have
allowed the development of artificial or induced regeneration strategies that improve
regeneration in humans. Two main differences are often invoked to justify the lack of
adult human regenerative ability compared to regenerating species: the shortage of
natural stem cells from normal tissues, and the inability of differentiated somatic cells
to proliferate and/or switch identity into the missing cell types. To overcome this,
scientists have found ways in which a somatic cell can be stably transformed into a
Page | 5
Chapter I - Introduction
distinct cell type by forced expression of lineage-determining factors, a process
generally called cellular reprogramming (Vierbuchen and Wernig 2012). This can be
achieved by several experimental approaches, from which two stand out for their
remarkable clinical value. The first is nuclear transfer from a differentiated somatic
cell into an enucleated oocyte (Gurdon 1962), that results in the production of viable
blastocysts that can be grown to adulthood or induced to differentiate into specific
somatic cell lines of medical interest (Gurdon and Simonsson 2003). The second is the
over-expression of a small number of specific transciption factors, namely Oct4, Sox2,
Klf4, c-Myc, Nanog and Lin28. Different combinations of at least 3 of these genes
(Oct4, Sox2 and KLF4) are sufficient to convert a somatic cell type directly into
another (Weintraub et al 1989, Gurdon and Melton 2008, Zhou et al 2008, Yamanaka
and Blau 2010) and to reprogram somatic cells such as fibroblasts, hepatocytes and
gastric epithelial cells into induced pluripotent stem cells (iPS cells) (Takahashi and
Yamanaka 2006, Takahashi et al 2007, Aoi et al 2008, Chakraborty et al 2014).
Cellular reprogramming will eventually be used to generate cells for tissue repair or
replacement while avoiding the ethical issues inherent in the use of human ES cells
and the need for immunosuppression since the cells would be derived from each
pacient. Furthermore, it enables the culture of defective cells, allowing disease
modelling and the screening for therapeutic drugs (Takahashi and Yamanaka 2006,
Gurdon and Melton 2008). But for now much remains to be learned about the
molecular basis of both transcriptional and epigenetic machinery involved in cellular
reprogramming in different contexts (normal and disease) before it is fully
understood and its potential can be safely harnessed (Yamanaka and Blau 2010). A
major contribute in that regard will be the deep understanding epimorphic
regeneration, since it is a natural mechanism in which some cells naturally switch
lineage identity and proliferate in a controlled and limited manner.
1.3. Regeneration among Metazoa: distribution and evolution
In Metazoa, the ability to undergo reparative regeneration is widespread among
phyla with great evolutionary distances (Fig. I.1). Among invertebrates, sponges,
hydra, star fish, annelid worms and planarians can all rebuild a complete organism
Page | 6
Chapter I - Introduction
from a fragment of the original one (Bely 2006, Hernroth et al 2010, Wulff 2010, Galliot
2012, Elliot and Sánchez Alvarado 2013). Decapode crustaceans and nymphs of
hemimetabolous insects such as cockroaches and crickets regenerate entire limbs
(Nakamura et al 2008, Das and Durica 2013). Among Mollusca, examples of
regeneration include the rebuilt of excised mantle in bivalves (Gustaf et al 2009) and
the central nervous system in gastropods (Matsu and Ito 2011), regeneration of the
cornea in octopus (Dingerkus and Santoro 1981) and the tentacular arms in squid
(Aldrich and Aldrich 1968).
Some basal Chordata, like the colonial ascidians can regenerate functional adults from
minute vasculature fragments (Rinkevich et al 2007), and adult amphioxus rebuild
anterior and posterior structures, including neural tube, notochord, fin, muscle,
intestine and tail (Somorjai et al 2011).
Among higher vertebrates, there are also species with impressive regeneration after
trauma. Urodele amphibians such as newts and axolotls can replace lost appendages
(Tweedell 2010), lens, retina (Barbosa-Sabanero et al 2012), several internal organs
such as the heart (Cano-Martínez et al 2010) and the liver (Michalopoulos and
DeFrances 1997), and the central nervous system (Zukor et al 2011), throughout
their life cycle. Teleost fish have also great regenerative ability (chapter I: section 2).
However, in the majority of higher vertebrates, regeneration is very limited. Anuran
amphibians (frogs and toads) can regenerate the tail and limbs, but only during larval
stages; reptiles can only regrow the tail (McLean and Vickaryous 2011); and birds
appear to be nearly or entirely unable to regenerate any structure (Bely 2012). As for
mammals, including humans, they can repair damage to skeletal muscle (Chargé and
Rudnicki 2004) and peripheral nervous system (Bosse 2012) and can recover from
damage to internal organs such as the liver (Michalopoulos and DeFrances 1997),
kidney (Angelotti et al 2012), pancreas (Shu et al 2012) and intestine (Tsonis 2000).
Newborn mice, monkeys and even human children can regenerate the distal tip of the
digits (Illingworth 1974, Singer et al 1987, Han et al 2008). Nevertheless, humans
cannot recover from serious damage or loss of organs or body sections.
Page | 7
Chapter I - Introduction
Almost all metazoan phyla include species with regenerative ability (Fig. I.1), but the
ability to regenerate and the type of regeneration employed vary a lot, even between
closely related species. For example, urodele and anuran amphibians have opposite
regenerative capacity during adulthood. Given this ambiguous phylogenetic
distribution, it is difficult to understand how regeneration originated and evolved to
the present days (Sánchez Alvarado 2000, Carlson 2007).
Figure I.1 – Phylogenetic distribution of epimorphic regeneration among the Metazoa.
Modified from Galliot and Chera 2010.
One hypothesis is that regeneration is a homologous trait, an attribute of the common
ancestral of all metazoans that was lost in some groups as a neutral or negative trait,
in a variety of contexts. The other main view is that regeneration is an analogous trait
that arose independently in each group, and then converged in animals sharing the
same evolutionary context (Sánchez Alvarado 2000, Brockes and Kumar 2008). Even
though the former theory is generally more accepted, there are phylogenetic and
molecular data pointing in either direction, and therefore a consensus is still far from
reaching (Goss 1969, Bely and Sikes 2010, Somorjai et al 2011, Bely 2012 against
Anderson et al 2008, Khalturin et al 2009, Garza-Garcia et al 2010). Adding to this
Page | 8
Chapter I - Introduction
evolutionary puzzle, regeneration is often seen as the counterpart of development,
which is highly conserved within metazoans, in agreement with a common early
ancestral (Wolpert 1994, Sánchez Alvarado 2000, Brockes et al 2001, Khalturin et al
2009, Shubin et al 2009). Indeed, both processes share many cellular and molecular
mechanisms and their end result is almost indistinguishable, as extensively
highlighted for vertebrate limb development and regeneration (Imokawa and
Yoshizato 1997, Simon et al 1997, Sánchez Alvarado 2000). Notwithstanding,
regeneration involves some mechanisms that are not employed in the deeply
conserved embryonic development, such as the dependence on the injury signal and
on nerve supply (Brockes and Kumar 2008).
Taken all the above, it is difficult to predict which animals hold regenerative
mechanisms closer to humans. Consequently, it is unclear which species should be
further investigated in order to find new strategies to improve human health
conditions resulting from injury, aging and disease. Nevertheless, understanding the
mechanisms that are involved in regeneration in diverse model systems is potentially
advantageous for biomedicine. For instance, understanding why particular
regenerative processes take place in some animals but not in human tissues could
provide new pathways to stimulating human regeneration, especially if endogenous
human pathways are unavailable (Sánchez Alvarado and Tsonis 2006).
The most common regeneration model organisms are hydra, planarians, urodeles
(salamanders, newts and axolots), Xenopus and zebrafish. They represent some of the
first organisms in which regeneration was described and they all have extreme
regenerative ability, including epimorphosis (Morgan 1901, Slack 2003).
Page | 9
Chapter I - Introduction
2. Zebrafish regeneration
The ability of zebrafish to regenerate its fins was first scientifically described in 1786
by Broussonet. Over the years, it was showed that besides the appendages, zebrafish
can undergo epimorphic regeneration of the heart muscle (Poss et al 2002), maxillary
barbels (LeClair and Topczewski 2010) and retina (Cameron 2000). They can also
regenerate the optic nerve (Bernhardt et al 1996), liver (Sadler et al 2007), pancreas
(Moss et al 2009), spinal cord (Becker et al 1997), sensory hair cells (Lopez-Schier
and Hudspeth 2006) and scales (Sire et al 2000) (Fig. I.2). Many other teleosts can
also regenerate some external and internal organs (Shao et al 2009, Watanabe et al
2009, Sîrbulescu and Zupanc 2011), but this is not a property common to all teleosts
(Geraudie and Singer 1977).
Figure I.2 – Zebrafish structures with regenerative ability.
In the last two decades the zebrafish has emerged as a standard model for
regeneration studies, much because it combines a remarkable regenerative ability
with several practical advantages, including: simple and low cost husbandry and
maintenance requirements; small size and good social behaviour that allows raising
and maintaining large numbers of fish in restricted space; high fecundity; short
generation time; and rapid organism development. Besides, zebrafish and humans
share several functional organs and orthologous genes (Brittijin et al 2009).
Moreover, the zebrafish has long been a standard model organism to study animal
Page | 10
Chapter I - Introduction
development (Eisen 1996), and more recently it also became a model of excellence
for immunology and behaviour studies (Oliveira et al 2011, Renshaw and Trede 2012,
Medina and Royo 2013). As a consequence, the amount of available tools and
protocols for molecular and genetic manipulation and characterization is much
greater compared to other fish and also compared to the regeneration models
previously used, such as amphibians (Slack 2003). Those include complete genome
sequence (Ensembl project, Zv9 2014), mutagenesis screens (Jonhson and Weston
1995, Amsterdam et al 1999, Poss et al 2002, Mathew et al 2007), gene knockdown
and transgenesis techniques (Ivics et al 1993, Tawk et al 2002, Bayliss et al 2006,
Thummel et al 2006, Moens et al 2008, Ishida et al 2010, Hans et al 2011, Dahlem et al
2012), microarrays (Ton et al 2002, Schesbesta et al 2006), antibodies, expressed
sequence tag (EST) (Baxendale et al 2009).
Among the zebrafish structures with regenerative ability, the caudal fin is a
particularly attractive model to study epimorphic regeneration in adult vertebrates
due to the easier access and non-vital function relative to other epimorphic
regenerating structures, like the heart. Also, it has a simple anatomical structure and
limited cell types compared, for example, to the classically studied urodele limb
(Stoick-Cooper et al 2007a).
2.1. Structure of the caudal fin
In gross mode, the caudal fin is a fan-like frame of dermal exoskeletal elements called
fin rays, which are arranged longitudinally and separated by inter-ray connective
tissue. The whole structure forms two symmetrical lobes, dorsal and ventral, and is
covered with a scaleless epithelium (Fig. I.3A).
Detailed structure of the caudal fin is represented on Fig. I.3B. Each bone ray, or
lepidotrichium, is comprised of two concave and symmetrical segmented hemirays
which, in cross section, appear like a parenthesis (Becerra et al 1983). The hemirays
are made of acellular bone that mineralizes directly from a collagenous matrix
secreted by scleroblasts - skeletogenic cells equivalent to mammalian osteoblasts
(Santamaria et al. 1992, Hall 2005) that surround each hemiray as a monolayer
Page | 11
Chapter I - Introduction
(Nechiporuk and Keating 2002). The fin grows distally from its base by sequential
addition of pairs of hemiray segments connected end-to-end by segment joints of
dense fibrous connective tissue (Haas et al 1962, Becerra et al 1983). Once formed,
the segments can become increasingly thicker but cannot elongate (Géraudie et al
1995, Azevedo et al 2011). At some point the rays bifurcate by splitting along the
proximal-distal axis, with exception of the more dorsal and ventral ones (Becerra et al
1983, Géraudie et al 1995). Both the length of the segments and the local of
bifurcation are carefully instructed by genetic signals (Murciano et al 2002, Murciano
et al 2007). The rays encircle the intra-ray mesenchyme and also blood vessels,
nerves, and pigment cells, which are also present in the inter-ray mesenchyme that
connects the lepidotrichia (Poss et al 2003). All of these structures are covered by a
thin but multilayered epithelium, the skin, which has a characteristic basal cell layer
at its bottom.
The fin exoskeleton meets the rest of the body at the fin base, in the proximal end of
the lepidotrichia. This region is covered with scales and contains striated muscle that
connects the lepidotrichia exoskeleton to the hypural bones of the fish endoskeleton
(cartilaginous origin) (Géraudie et al 1995, Poss et al 2003). At the opposite, distal tip
of the fin, each ray ends in a double palisade of small, rigid and fusiform spicules
called actinotrichia. They are composed of hyperpolymerised elastoidin (collagen-like
protein) and have been reported to play skeletal and morphogenetic roles
(Santamaria and Becerra 1991, Böckelmann and Bechara 2009).
Two main axes are present in the fin: the proximal-distal axis, which separates the
regions closer to the fin base (proximal) from those nearer the fin tip (distal); and the
dorsal-ventral axis, which divides the fin into an upper, dorsal half and a similar
bottom, ventral half (Fig. I.3A).
Page | 12
Chapter I - Introduction
Figure I.3 – Structure of the zebrafish caudal fin. (A) Overview of caudal fin and main fin
axes: dorsal-ventral and proximal-distal. (B) Detail of the fin exoskeleton. The fin exoskeleton
is mainly composed of bone rays or lepidotrichia separated by inter-ray connective tissue.
Each bone ray is made of pairs of hemiray segments connected end-to-end by segment joints
of connective tissue. Most rays bifurcate at least once. Schematic view in B (bottom) modified
from Akimenko et al 2003.
2.2. Stages of epimorphic regeneration in the zebrafish caudal fin
Regardless the amount of times the caudal fin exoskeleton is amputated, a new fin is
always produced (Azevedo et al 2011) as a result of epimorphic regeneration. The
new structure is not a perfect copy of the original fin but it is very similar in both
shape and function (Azevedo et al 2012). Interestingly, the rate of regeneration is
temperature sensitive; at 33° C a new fin is rebuilt in about 2 weeks, but the process
will take longer under lower water temperature (Jonhson and Weston 1995).
Epimorphic regeneration includes always three main and partially overlapping stages
that will be further described in the following subsections: wound healing, blastema
formation and maturation, and regenerative outgrowth (Fig. I.4). These stages are
common to all epimorphic regeneration events.
Page | 13
Chapter I - Introduction
Figure I.4 – Stages of epimorphic regeneration. (A) After caudal fin amputation, epithelial
cells migrate towards the damaged site to cover the wound. (B) Once the wound epidermis
(WE) is formed, around 12-18 hours post amputation (hpa), mesenchymal tissue close to the
amputation plane disorganizes and cells migrate distally to form the blastema below the WE.
This mass of undifferentiated cells proliferates as it matures into a functional blastema. (C)
From 48 hpa on, some blastema cells continue to proliferate while the remaining differentiate
into the missing tissues, restoring the fin. hpa: hours post-amputation. Modified from StoickCooper et al 2007a.
2.2.1. Wound healing
The healing of the wound starts immediately after injury and consists of a sequence of
partially overlapping events that leads to the restoration of epithelial continuity:
haemostasis, inflammation and re-epithelialisation. Haemostasis takes place in the
first minutes that follow tissue disruption, through the contraction of the blood
vessels and formation of a clot of platelets and other blood cells embedded in a fibrin
matrix. This clot stops the bleeding and serves as a surface for the initial epithelial
cells migration (Carlson 2007, Murawala et al 2012). Once the bleeding is stopped,
inflammatory cells (mainly neutrophils in a first stage and macrophages later) are
recruited to the wound and clear it from invading pathogens, dead cells and debris
from the disrupted tissues (Li et al 2012). Parallel to this, re-epithelialization takes
place: in the lateral edges of the wound, epithelial tissue loosens and epithelial cells
up to some hundreds of microns away from the amputation plane migrate to seal the
wound (Poleo et al 2001). As a result, a thin epithelial layer is formed by 6 hours post
amputation (hpa) (at 33°C) (Fig. I.4A, Fig. I.5A). Over the next 12 to 18 h, epithelial
Page | 14
Chapter I - Introduction
cells continue to accumulate by further cell migration, producing a multilayer wound
epidermis (WE) that is distinct from the surrounding epidermis by its increased
thickness and unpacked morphology. This process occurs in the absence of cell
proliferation and blood supply. Between 18 and 24 hpa a basal epidermal layer (BEL)
forms, consisting of a layer of packed, cubical or columnar cells in direct contact with
the underlying mesenchyme (Becerra et al 1996, Poleo et al 2001, Nechiporuk and
Keating 2002, Santos-Ruiz et al 2002, Bayliss et al 2006).
During the whole regenerative process, the thickened WE, also called apical
epidermal cap (AEC), maintains a communication with the underlying mesenchyme,
through a robust secretory activity that is particularly intense at the BEL.
Importantly, the AEC is believed to play a role equivalent to that of the apical
ectodermal ridge (AER), a thickening of epithelial cells that forms at the tip of the
limb/fin bud and directs the outgrowth and patterning of the underlying
mesenchyme during the appendage development (Saunders 1948, Géraudie, 1980,
Ferretti and Géraudie 1995, Galis et al 2003, Wolpert et al 2006). In fact, during
regeneration, epithelial-mesenchymal interactions are crucial for blastema formation
and proliferation and affect patterning during the regenerative outgrowth, as will be
outlined in the following sections of the present introduction (Lee et al 2009,
Murawala et al 2012).
Several genes are known to participate in the establishment of the WE (Fig. I.5A): β-
catenin is present at the distal-most layers of the regeneration epidermis during all
stages of regeneration; activin-βA (actβA), a gene encoding a TGFβ- related ligand, is
strongly induced within 6 hpa in the mesenchymal cells at the wound margin of the
inter-ray. Both genes are necessary for epithelial cell migration during wound
healing. Additionally, β-catenin is presumed to function in maintaining the integrity of
the fin epidermis (Poss et al 2000a, Jazwinska et al 2007).
Other signals are known to be involved in the formation of the apical epithelial cap
(AEC) after the initial wound closure. Quantitative RT-PCR assays have showed that
fgf20a, wnt10a, aldh1a2 and igf2b (members of Fgf, canonical Wnt, Retinoic acid (RA)
and Igf signalling, respectively) are up-regulated within the first 6-8 hpa (Whitehead
Page | 15
Chapter I - Introduction
et al 2005, Stoick-Cooper et al 2007b, Chablais and Jazwinska 2010). In situ
hybridization experiments have localized fgf20a, aldh1a2 and igf2b expression to the
mesenchyme underneath the WE; and wnt10a is present at the WE, where lef1
(transcription factor downstream of canonical Wnt) and wnt5b (member of non-
canonical Wnt signalling) are also expressed from 12 hpa (Poss et al 2000a).
Importantly, loss-of-function studies that inhibited Fgf, canonical Wnt, Retinoic acid
(RA) and Igf signalling showed that, although cells migrate to cover the wound in all
cases, an abnormal AEC forms lacking a characteristic BEL, and regeneration is
impaired (Poss et al 2000a, Whitehead et al 2005, Kawakami et al 2006, StoickCooper et al 2007, Chablais and Jazwinska 2010, Blum and Begemann 2012). These
studies confirmed that signals from both the epithelial and mesenchymal
compartments are required for AEC formation, which in turn is crucial for
regeneration.
Several other genes have been described as being specifically expressed in the caudal
fin during regeneration, but their functional significance is yet to be determined. For
example, apoE, krt8 and msxa/d are detected in the wound epidermis during most of
the regenerative process (Akimenko et al 1995, Monnot et al 1999, Martorana et al
2001).
2.2.2. Blastema formation
Around 12 hpa, intra-ray mesenchyme up to 2 ray-segments away from the
amputation plane starts to disorganize and once the BEL is formed, around 18 hpa,
fibroblast-like cells and scleroblasts proliferate and migrate distally. By 24 hpa, these
cells accumulate in the region immediately above the amputation plane and below
the wound epidermis, where they continue to proliferate to form the blastema, a mass
of undifferentiated cells that will give rise to all non-epithelial missing tissues (Fig.
I.4B, Fig. I.5B1) (Poss et al 2000b, Poleo et al 2001, Nechiporuk and Keating 2002,
Santos Ruiz et al 2002, Knopf et al 2011, Sousa et al 2011).
The main signals required for AEC formation are to a great extent the same that
orchestrate mesenchyme disorganization and blastema formation. aldh1a2 is
expressed in the disorganizing mesenchyme; fgf20a and igf2b transcripts localize to
Page | 16
Chapter I - Introduction
the forming blastema; and wnt10a and lef1 are found in the WE, especially at the BEL
(Fig. I.5B1). The signalling pathways in which these molecules are involved, RA, Igf,
Fgf and Wnt/β-catenin respectively, constitute parts of a signalling network through
epithelial-mesenchymal communication via secreted factors. This way, they interact
in a feedback loop to activate each other in a reciprocal manner (Blum and Begemann
2012). This has been clearly demonstrated by several loss of function experiments
coupled to gene expression analysis showing that inhibiting one of the pathways
blocks expression of the remaining (Poss et al 2000a, Whitehead et al 2005, Stoick-
Cooper et al 2007, Mathew et al 2009, Chablais and Jazwinska 2010, Blum and
Begemann 2012).
ActβA, which expression domain at 24 hpa includes the mesenchymal region below
the WE at both ray and inter-ray regions, is also required for mesenchymal
disorganization and proliferation during blastema formation (Jazwinska et al 2007).
Aside from the genes already expressed during AEC and BEL formation, other genes
began to be expressed during blastema formation (Poss et al 2000b). That is the case
for mps1 (a cell cycle regulator kinase), fgfr1 (an Fgf receptor) and msxb and msxc
(homeobox transcriptional repressors downstream of Fgf signalling). All of these
genes are first detected during early blastema formation (18-24 hpa) in mesenchymal
cells just proximal and distal to the amputation plane (Fig. I.5B1) (Akimenko et al
1995, Poss et al 2000b, Poss et al 2002). Expression of fgfr1 is required for blastema
formation and expression of msxb, which is thought to be inducing mesenchymal cells
dedifferentiation and maintaining blastemal cells undifferentiated (Poss et al 2000b).
On the other hand, mps1 expression is related to actively cycling cells (Poss et al
2002).
From 24 to 48 hpa, the number of cycling cells in the blastema increases and the
blastema expands along the proximal-distal axis. By the end of this stage, blastemal
cells segregate into morphologically identical but functionally distinct subpopulations
that differently express msxb/c and mps1 and have opposite proliferative potential
(Fig. I.5B2).
Page | 17
Chapter I - Introduction
One of them is the distal blastema (DB), a small domain located immediately beneath
the AEC that consists of very slow- or non- proliferating cells expressing msxb/c but
not mps1. It is generally accepted that the DB functions to specify the direction of
proliferation and regenerative outgrowth. Maintenance of cells in an undifferentiated
state seems crucial for such function and is ensured at least by msxb expression. In
turn, msxb is sustained by Fgf signalling, likely through factors such as fgf20a and
fgf24. In fact, fgf20a expression overlaps that of msxb/c throughout regeneration, and
msxb is not expressed in the absence of fgf20a, suggesting a close dependence
(Akimenko et al 1995, Poss et al 2000b, Nechiporuk and Keating 2002, Poss et al
2002, Whitehead et al 2005).
The other blastemal region is the proximal blastema (PB), which occupies a larger
area between the amputation plane and the DB and is composed of highly
proliferative cells expressing mps1 but not msxb/c. Indeed, the mutant zebrafish
“nightcap-ncp” encodes mps1 and is unable to regenerate due to proliferative failure
after blastema formation, demonstrating that mps1 expression in the PB is crucial for
regeneration (Poss et al 2002). PB cells are the ones that will give rise to the missing
tissues, reason for which PB is considered to be the main driver of regeneration. This
blastemal region is separated from the DB by a 50-fold gradient of proliferation over
50 µm (Akimenko et al 1995, Nechiporuk and Keating 2002, Poss et al 2002).
2.2.2.1. Cellular origin of the blastema
Despite extensive study on vertebrate appendage regeneration, the origin of the
appendage blastema cells is still not clear. The most widely accepted hypothesis is
that the blastema forms from terminally differentiated cells near the wound site that
revert back to a less differentiated stage from within its own lineage – a process
called dedifferentiation. By doing so, cells can proliferate again before redifferentiating to replace the lost tissues (Jopling et al 2011). Several studies on
amphibian and zebrafish appendage regeneration support this view (Lo et al 1993,
Kumar et al 2000, Echeverri et al 2001, Poleo et al 2001, Nechiporuk and Keating
2002). Importantly, cell fate tracing assays based on genetically labelled fluorescent
cell lineages have showed, both in the axolotl limb (Kragl et al 2009) and the
zebrafish caudal fin (Tu and Johnson 2011), that the major appendage tissues, not a
Page | 18
Chapter I - Introduction
single cell type, contribute to the blastema and that most cell types remain lineage
restricted during regeneration. Furthermore, in the zebrafish caudal fin, osteoblasts
(bone forming cells) were shown to proliferate and migrate into the blastema, where
they down-regulate expression of mature osteoblast markers and start expressing
early markers of bone progenitors (Knopf et al 2011, Sousa et al 2011),
demonstrating that dedifferentiation of bone-forming cells is present during
regeneration.
Even though dedifferentiation clearly contributes to blastema formation in
appendage regeneration, in other structures the new tissues arise from different
cellular sources. For example, planarians regeneration depends on a stem cell system
generally called neoblasts, that include pluripotent adult somatic stem cells (Wagner
et al 2011). Upon injury, neoblasts proliferate and migrate towards the wound to
form the blastema, from where they differentiate into all the missing tissues
(Wenemoser and Reddien 2010, Reddien 2013). On the other hand, newt lens
regenerate by transdifferentiation, a process that takes dedifferentiation a step
further and sees cells regressing to a point where they can switch lineages, allowing
them to differentiate into another cell type (Jopling et al 2011). This way, upon newt
lens removal, terminally differentiated pigmented epithelial cells in the dorsal iris
(PECs) undergo dedifferentiation into a stem-cell like state, proliferate, and then
differentiate into lens cells (Maki et al 2010). Although neither stem cells pools nor
transdifferentiation have been showed in a convincing manner in vertebrate
appendages, some studies suggest their presence (Rawls and Johnson 2000, Rawls
and Johnson 2001, Lheureux 1983, Gargioli and Slack et al 2004, Chen et al 2006,
Morrison et al 2006) and others were unable to rule them out (Kragl et al 2009, Tu
and Johnson 2011). Therefore, it is possible that during appendage regeneration,
blastema is formed by via dedifferentiation combined with stem cells and/or
transdifferentiation, therefore constituting a heterogeneous mix of cells from
different origins rather than a homogeneous population.
2.2.3. Regenerative outgrowth
From 48 hpa until the regenerative process is complete (around 2 weeks at 33°C), the
DB remains non-proliferative but the cells in the PB proliferate intensely. As more
Page | 19
Chapter I - Introduction
cells are produced, the more proximal ones exit the cell cycle and integrate another
region that develops between the amputation plane and the PB. This domain is called
patterning zone (PZ) and is characterized by intense cell differentiation, although
moderate cell proliferation is detected near the boundary with the PB (Fig. I.4C, Fig.
I.5C) (Nechiporuk and Keating 2002, Poss et al 2002, Tal et al 2010). Here, cell
differentiation and patterning occurs from distal to proximal regions; in other words,
the closer to the amputation plane, the more differentiated and organized the cells
are, culminating in the restoration of the lost tissues (Santamaria et al 1996, Johnson
and Bennett 1999, Brown et al 2009). Tissue differentiation continues in this way
until the pre-amputation fin length is reached. At that point, the cells somehow know
they should stop proliferating and the transient regenerative structures (wound
epidermis, DB, PB, patterning zone) disappear, but the mechanisms involved in the
termination of regeneration are still unclear (Iovine 2007).
The differentiation program leading to bone regeneration has received most attention
at the histological and cytological levels. The process begins with the formation of two
lateral domains in the PZ through the alignment of blastemal cells, including
dedifferentiated scleroblasts, in the region just distal to the amputation plane. The
cells in the lateral domains are in contact with the epidermal layer and in frame with
the pre-existing lepidotrichia, and they differentiate into new scleroblasts, which
synthesize and release the lepidotrichial matrix in the subepidermal space
(Santamaría et al 1992, Becerra et al 1996, Mari- Beffa et al 1996, Brown et al 2009,
Yoshinari et al 2009, Sousa et al 2011). These lateral bone-forming compartments are
only established at 48 hpa. Thus, it is only by the end of blastema formation that the
rebuilt of bone rays becomes obvious (Brown et al 2009, Smith et al 2006, Smith et al
2008). Nevertheless, a careful gene expression analysis at earlier regeneration stages
revealed that at least two early skeletogenesis markers are up- regulated much
earlier: sox9a is expressed in the intra-ray mesenchyme from 12 hpa and osx is
detected in the blastema from 24 hpa, demonstrating that skeletogenesis starts along
with blastema development (Sousa et al 2011). Then, from 48 hpa, the expression of
several skeletogenesis markers is strongly detected in the lateral, scleroblastsaligning compartments, including sox9a and osx, which are early osteogenic markers,
col1a2 and col10a1 that encode two bone matrix collagens, and osteonectin and
Page | 20
Chapter I - Introduction
osteocalcin, which encode bone matrix proteins with the same designation (Fig. I.5C)
(Avaron et al 2006, Johnson and Weston 1995, Sousa et al 2011). Interestingly,
expression of other molecules, namely runx1a/b and osx, spp-1, and ZNS5, which are
early, intermediate and late skeletogenesis markers respectively, is detected in
partially overlapping domains that go from distal to proximal regions (Brown et al
2009). This reveals different stages of osteoblasts maturation in a pattern consistent
with the increasing level of cell differentiation and bone matrix maturity detected
from distal to proximal regions of the fin along the proximal-distal axis (Santamaria et
al 1992; Mari-Beffa et al 1996).
Two crucial signalling pathways during regenerative outgrowth are Hedgehog (hh)
and BMP (Fig. I.5C). Expression of sonic hh (shh), pct1 (Hh membrane-receptor) and
bmp2b (a TGF-β family gene induced in response to Shh) is found in the region of new
bone production, particularly in a subset of cells in the BEL close to the newly formed
scleroblasts. Additionally, ptc1 and bmp2b are also found in the adjacent scleroblasts
lining the blastema beneath the BEL. Other genes from the BMP family are expressed
during regeneration: bmp4 transcripts are detected in the distal blastema and bmp6 is
expressed in the newly formed scleroblasts, BEL and PB. Based on several gain- and
loss- of function analysis, it is now clear that Shh (via Ptc1) acts upstream of Bmp
signalling (via Bmp2b, likely together with Bmp6), to stimulate differentiation and
function of new scleroblasts and consequently bone formation. Once Bmp2b/ Bmp6
is activated by Shh signalling, it stimulates Runx2a/b, which in turn induces
downstream targets involved in bone development, including col10a1 (Laforest et al
1998, Quint et al 2002, Smith et al 2006). Parallel to this, inhibition of BMP signalling
(likely Bmp4 and/or Bmp6) also slows down the regenerate outgrowth by decreasing
blastema cell proliferation and down-regulating msxb and msxc expression (Smith et
al 2006). Another function of Shh and Bmp signalling is to provide patterning cues by
defining the location of bifurcations and possibly segment joints. This is accomplished
by transient changes in their expression. Particularly, the single expression domain of
shh and bmp2b across the whole width of the forming lepidotrichia splits into two
lateral, discrete domains before a bifurcation can be morphologically detected, and if
Shh signalling is inhibited, no bifurcations form. Regarding segment joints formation,
Page | 21
Chapter I - Introduction
Figure I.5 – Fin ray morphology and signalling during epimorphic regeneration.
Schemes representing a longitudinal section of a regenerating bone ray. As regeneration
proceeds (A to C), different epithelial and mesenchymal cellular domains are formed (black
arrows indicate the new structures). Each of those regions expresses specific genes that
ultimately define cell behaviour and regeneration success (genes are listed in at the bottom of
panel A, B1, B2 and C). The molecular communication between the different tissues is
essential for regeneration. WE: wound epidermis. Mesench: “old” intra-ray mesenchyme. DB:
distal blastema. PB: proximal blastema. PZ: patterning zone. hpa: hours post-amputation.
it has been suggested that they are predicted by the cyclic suppression of bmp2 and
ptc1 expression (Laforest et al 1998, Quint et al 2002). Other genes have also been
implicated in the fin outgrowth and patterning (Fig. I.5C). One of them is indian hh
(ihh), which colocalizes with the ptc1 mesenchymal domain in the scleroblasts
adjacent to shh-expressing cells. Similar to shh, ihh expression domain in each
hemiray splits into two before a bifurcation is formed, suggesting an interaction
between both genes at the epithelial-mesenchymal interface during bone
differentiation and patterning (Avaron et al 2006). Another important gene is
connexin43 (cx43), which is expressed in the PB and in cells flanking the joints
Page | 22
Chapter I - Introduction
between recently separated segments. This gene codes for a gap junction subunit
with the same designation (Cx43); direct cell–cell communication via Cx43 gap
junctions regulates the level of cell proliferation and defines bone segments length by
determining joints location (Hoptak-Solga et al 2007, Hoptak-Solga et al 2008, Sims et
al 2009). Finally, RA is another key patterning molecule. Its role in patterning of the
regenerating caudal fin is still not clear. Nevertheless, it has been hypothesized that
RA may have a function similar to the described for amphibian limb regeneration,
where it is crucial for the correct patterning of the skeletal elements along the
anterior-posterior (AP, thumb to little finger) and proximal-distal (PD, shoulder to
digit) axes (McEwan et al 2011). In fact, RA treatment seems to induce a narrowing of
the fin along the dorsal-ventral axis due to a decreased distance between rays, with
partial or total fusion of some rays (Géraudie et al 1995).
2.2.4. Positional memory
During regenerative outgrowth the blastema cells give rise only to the missing
structures; a property usually referred to as positional memory (Lee et al 2005). This
property is already present in very early stages of blastema formation, since
transplantation of early amphibian limb blastemas into new environments does not
change their identity: a wrist blastema always regenerates a hand, whereas a
shoulder blastema results always in an entire arm (Stocum et al 1984, Echeverri and
Tanaka 2005, Kumar et al 2007). In fact, cell labelling assays also in amphibian
models suggest that cells within the blastema are already distributed along the
proximal-distal axis according to the position of the limb elements they will restore.
For instance, the distal part of the blastema gives rise to hand elements (distal
structures), whereas cells in more proximal regions of the blastema can give rise to
the upper and lower arm (Echeverri and Tanaka 2005). Another study indicates that
the blastema is formed by cells from different tissues and that only some of those cell
types retain positional identity, suggesting that the tissue origin of the blastema cells
must be considered when studying positional identity (Kragl et al 2009).
Even though it is still not clear how cells acquire positional information along the
limb PD axis during limb regeneration (Brockes 1997), the most accepted view is that
PD identity of blastema cells is encoded in the graded expression level of several
Page | 23
Chapter I - Introduction
morphogens along the PD axis (Wang et al 2011). The first molecular evidence in this
regard came from the treatment of regenerating amphibian limbs with RA, which
proximalized the positional identity of blastema cells in a dose-dependent manner. As
a result, regeneration restored not only the missing structures but also limb regions
proximal to the amputation plane, thus generating duplication of skeletal elements
(Niazi and Saxena 1978, Maden 1982, Maden 1983, Maden and Hind 2003). More
recently, it was found that RA acts by regulating the expression level of Prod1, a cell
surface molecule which is the newt ortholog of the mammalian CD59, and Meis1/2,
two closely related homeobox genes. During limb regeneration, all three molecules
are expressed in higher levels in proximal regions than in the distal limb. Treatment
of regenerating limbs with RA up-regulates Prod1 and Meis1/2 and drives the respecification of distal blastemal cells to more proximal positional identities,
suggesting that both Prod1 and Meis1/2 are determinants of P–D cell identity (da
Silva et al 2002, Echeverri and Tanaka 2005, Mercader et al 2005, Kumar et al 2007).
Among regeneration models, adult axolotl and newt limbs have been the most used to
study positional memory and PD patterning, due to the easy distinction between the
different skeletal elements present along the PD axis, that provide an easy pattern
readout. Nevertheless, positional memory instructs not only the pattern but also the
rate of regeneration, so that the process is completed always in the same time period,
regardless the level of amputation along the PD axis. In this regard, the zebrafish
caudal fin has provided some relevant findings. Particularly it was showed that Fgf
signalling is stronger in proximal blastemas compared to distally amputated fins and
that, in such way, it defines the index of blastema cells proliferation and the overall
regenerative rate in a position-dependent manner (Lee et al 2005).
Page | 24
Chapter I - Introduction
3. Endogenous electrical signals of biological significance
Electric charge is a fundamental property of matter, and it is carried by the subatomic
particles that cause matter to experience a force (repulsive or attractive) when near
other electrically charged matter. Thus, although one cannot see a charge, one can see
how the charge manifests (Robinson et al 2008). Whenever electrically charged
particles flow orderly, an electric current (EC) is established. In living beings, ECs are
generated by the flow of ions such as Na+, K+, H+, Ca2+ and Cl- and charged molecules
including several proteins, across membranes and in conductive solutions such as the
extracellular medium. By convention, the flow of biological EC is from a region of
relative positivity (anode) to one of relative negativity (cathode), which corresponds
to the direction of migration of positively charged particles.
The scientific discovery of “animal electricity” dates back to the work of Luigi Galvani
in the 18th century (1737-1798). Using frogs’ nerve-muscle preparations, he observed
frog’s leg contraction when the cut end of the sciatic nerve touched the leg muscle or
when an artificial electric discharge was applied directly to the nerve. More, when the
surface of a sectioned sciatic nerve of one leg touched the intact surface of the sciatic
nerve of the other leg, both legs contracted. This demonstrated for the first time that
muscle contraction depends on electrical conduction (“animal electricity”) and that
the tissues themselves can generate electricity (Geddes and Hoff 1971).
3.1. Origin of endogenous electric currents and electric fields
The electrical properties of a cell derive mainly from the electrical properties of its
plasma membrane: 1) the lipid bilayer behaves as an insulator, a physical barrier to
the passage of most charged particles between the extracellular medium and the
cytoplasm; 2) on the other hand, the ion channels, transporters and pumps are
distributed asymmetrically and behave as conductors through which ions and some
charged molecules cross the plasma membrane. The consequent differential
Page | 25
Chapter I - Introduction
accumulation of charged particles across the two sides of the membrane generates a
chemical gradient as well as an electric potential difference or voltage (V) designated
by Membrane Potential (V mem ) (Fig. I.6A). In animal cells, V mem varies between -30
and -90 miliVolts (mV) relative to the extracellular environment, and in plant cells,
V mem can reach up to -150 or -200 mV. This voltage is used for a variety of signalling
and transport functions (Axon Instruments, 1993, Levin 2007, Nuccitelli 2003,
Hedrich 2012).
Figure I.6 – Origin of endogenous electric signals. (A) Cells maintain an electrical potential
difference (membrane potential, V mem ) across the plasma membrane, inside negative. (B)
Epithelia maintain a transepithelial electric potential difference (TEP) across itself, positive at
the basal side relative to the apical side. (C) In individual cells, breakage of the plasma
membrane continuity causes a net inward ionic leakage electric current (EC) and the
consequent V mem collapse. (D) Breakage of an epithelial sheet creates a leakage EC at the
breakage site and consequently the local collapse of TEP. Active ion transportation and TEP
continue distally, in the intact epithelium, generating an endogenous electric field (EF, yellow
arrows) parallel to the epithelium. Ion translocators: green, blue. Tight junctions: purple.
Black arrows: ion movement trajectory. Black cross “+” represent cations. Red symbols +, –
and ±: relative electric potential of a biological compartment, positive, negative or neutral,
respectively.
Animal electricity depends on the coordinated activity of individual cells. In fact, most
organs and whole animals are surrounded by a layer of epithelial cells with
characteristic electrical properties. Particularly, these epithelial sheets are
Page | 26
Chapter I - Introduction
functionally polarized so that different ion channels, transporters and pumps get
accumulated in the apical and basolateral regions. Like in single cells, this leads to the
selective and directional segregation of ions, and hence electric charges, across the
epithelium. The movement of ions back to their compartment of origin is prevented
by the tight and adherent junctions that physically connect the cells and provide a
high-resistance electrical seal to the epithelial sheet. This way, the voltage across the
intact epithelium is maintained and is called Transepithelial Potential (TEP) (Fig.
I.6B). Usually, the TEP corresponds to the accumulation of positive charges inside the
epithelial barrier relative to the outside (Nuccitelli 2003, McCaig et al 2005).
The V mem and the TEP are the driving forces for other important endogenous ECs in
embryos and adults, generally referred to as leakage currents. Briefly, when the
plasma membrane is disrupted, ions will move freely between the extra and
intracellular media down their electrochemical gradient. As a result, electrical
potential becomes alike across the two sides of the membrane, thus V mem becomes
depolarized (Fig. I.6C). Similarly, in regions of major tissue movements during
embryonic development or upon wounding, the structural integrity of the ionsegregating epithelium is compromised and the TEP collapses due to the break of the
tight junctional seal. As a consequence, the ions that usually accumulate inside the
epithelial barrier leak at the wound or cell movement site according to their
electrochemical gradient, generating a leakage EC (Fig. I.6D). In the case of injured
tissues, this leakage EC is called injury potential. In the nearby intact regions the TEP
is maintained, thus a gradient of electric potential is also generated, towards the site
of epithelial disruption. Inevitably, an EF (voltage between two points a known
distance apart) is established as well, and is stronger at the injury site (Robinson and
Messerli 1996, Nuccitelli 2003, McCaig et al 2005, Zhao 2009); in fact, the phenomena
of current flow and the presence of an EF are two sides of the same coin; you cannot
have one without the other (Stewart et al 2007).
Taken the above, it is clear that all cells – not just electrically excitable neurons and
muscle – generate bioelectrical signals (Levin 2009a). In fact, two main types of
electric signals can be defined:
Page | 27
Chapter I - Introduction
• action potentials, which are very fast (milliseconds) and high intensity (12V/mm) signals confined to the immediate vicinity of the cell membrane.
• endogenous low intensity ECs , which are stable, long lasting (minutes to weeks)
and low intensity (EFs of 1-100mV/mm) signals that can be present across
hundreds of microns and play physiological roles (Nuccitelli 1992, McCaig et al
2005, Levin 2007, Stewart el al 2007).
3.2. Endogenous electrical signals as morphogenetic signals
An extensive body of literature has demonstrated over the past 150 years that
endogenous electrical signals are not just a physiological consequence of
housekeeping functions, but rather constitute important signals that affect normal
and disease processes including development, regeneration and cancer (Levin 2007).
3.2.1. Endogenous electric currents and electric fields during development
Endogenous ECs and EFs are present during organisms’ development and are
correlated to morphogenetic events in growth and patterning across the plant and
animal kingdoms (Levin 2003, Nuccitelli 2003). Examples include a variety of
electrical signals that correlate with growth in plants roots, seeds and pollen tubes
(Burr 1942, Burr and Nelson, 1946, Stump et al 1980, Messerli and Robinson 1997,
Messerli and Robinson 1998, Messerli et al 1999, Feijó et al 2001), the endogenous
electrical cues required for the directional transport of maternal components in the
insect oocyte (Levin 2003), and the dependence of left–right organ asymmetry
establishment on both functioning gap junctions and a voltage difference between the
future left and right halves of the embryo (Levin and Mercola 1998, Levin and
Mercola 1999, Albrieux and Villaz 2000, Levin et al 2002, Pennekamp et al 2002). ECs
and EFs are also present during avian and amphibian embryonic development at the
whole organism level (trans-embryonic EC) as well as across specific structures such
as the neural tube (trans- neural tube potential) and the limb bud (limb-field EC) (Fig.
I.7). Perturbing each of these electrical signals results in striking general
developmental abnormalities, or localized deficiencies at central nervous system and
limb development level, respectively, which demonstrates the dependence of
Page | 28
Chapter I - Introduction
development on electrical signals (Stern 1982, Borgens et al 1983, Robinson 1983,
Borgens et al 1987, Hotary and Robinson 1990, Hotary and Robinson 1991, Hotary
and Robinson 1992, Hotary and Robinson 1994, Metcalf et al 1994a, Metcalf et al
1994b, Shi and Borgens 1994, Borgens and Shi 1995, Keefe et al 1995, Robinson and
Messerli 1996, Altizer et al 2001).
Figure I.7 – Membrane potential (V mem ) affects developments. V mem gradients are present
during chicken (A, B) and Xenopus (C) embryonic development, and vary in time (compare A
with B) and space (A, B, C). These signals are required for correct development. Whole
embryos were imaged using voltage-sensitive fluorescent dyes. Modified from Levin et al
2002 (A, B), Levin and Stevenson 2012 (C).
3.2.2. Endogenous electric currents and electric fields during wound healing
and regeneration
During wound healing and regeneration events, bioelectrical cues also have a
fundamental role. Immediately upon wounding or amputation, the injury potential
and the associated EF establish, regardless the regenerative ability of the animal or
the affected tissues. In fact, injury potentials and the associated EFs have been
measured in several wounded organisms and tissues, such as lamprey spinal cord
(Borgens et al 1980), rat cornea (Reid et al 2005), the skin of newts, guinea pig and
humans (Du Bois-Reymond 1843, Barker et al 1982, Foulds and Barker 1983, Sta
Iglesia et al 1996), amputated newt limb, human fingertip (Borgens et al 1977,
Illingworth and Barker 1980), among others. This electrical signal is both immediate
and persistent until the wound healing is complete, which makes it an excellent
candidate to be one of the signals that stimulate and govern the wound healing
process (Nuccitelli 2005). Indeed, several studies have demonstrated that injuryPage | 29
Chapter I - Introduction
induced electrical signals are necessary for wound healing (Nuccitelli 2003, Nuccitelli
2005, Talebi et al 2008, Messerli and Graham 2011). More, the effect of the wound-
induced EF seems to superimpose to any other factors that may be guiding the
process. Particularly, studies in the mammalian cornea, a well established model for
investigating the role of bioelectrical signals in wound healing, have demonstrated
that the rate of wound healing is directly related to the intensity and direction of the
injury potential and the associated EF: an increase in the magnitude of the EF
accelerates the healing rate, whereas decreasing it has the opposite effect (Fig. I.8)
(Zhao et al 1996, Sta Iglesia and Vanable 1998, Song et al 2002, Song et al 2004, Reid
et al 2005); and the total inversion of the EF direction results in the wound opening
up instead of closing (Zhao et al 2006).
Figure I.8 – Electric field (EF) affects
wound healing rate in rat cornea. Increasing
or decreasing the EF relative to the natural EF
(control) modifies wound healing rate accordingly
Black dots delimit the wound area. Modified from
Song et al 2004.
Although the initial response to injury is similar in animals with and without
regenerative ability, important differences soon become evident. In fact, the
difference between regenerating and non-regenerating systems has been suggested
to depend upon the bioelectrical properties of the tissue (Borgens et al 1979a, Levin
2003). This is clearly illustrated by the different electrical signals generated upon
limb amputation in anuran and urodele amphibians, which have opposite
regenerative ability. In both cases, amputation triggers the injury potential, which has
a positive polarity (current flows outside at the wound site) and disappears upon
complete wound healing. Nevertheless, in frogs (anurans) the current intensity is
weaker than in the newt and salamander (urodeles). Besides, no additional ECs are
Page | 30
Chapter I - Introduction
detected in frogs once the wound is healed, whereas in newts and salamanders a
stable and intense EC (10-100 μA/cm2) persists for several days, accompanying limb
regeneration (Levin 2007). This EC has reversed polarity compared to the injury
potential – it’s an inward EC (Levin 2007) – and it is crucial for regeneration, as
demonstrated by two lines of evidence: (1) its inhibition impairs regeneration
(Borgens et al 1979d, Jenkins et al 1996); and (2) the artificial induction of a similar
EC is sufficient to induce some regeneration in otherwise non-regenerating animals,
such as anuran amphibians, avians and even mammals (Smith 1967, Becker 1972,
Smith 1974, Borgens et al 1979b, Borgens et al 1979c, Sisken and Fowler 1981, Smith
1981, Sharma and Niai 1990).
Another study was able to correlate distinct EC patterns with the opposing
regenerative states of a single structure: the Xenopus laevis tadpole tail (Fig. I.9). This
appendage can regenerate after amputation (Fig. I.9B), but transiently loses this
ability around stage 45 of larval development (Fig. I.9C). In tails amputated during
this refractory period, the EC pattern resembles that of non-regenerating organisms
such as frogs. On the contrary, during regeneration permissive periods the electrical
profile is similar to the detected during urodele regeneration, including the reversal
of EC direction upon wound healing and its maintenance until complete regeneration
(Fig. I.9A); like in urodeles, this EC is necessary for regeneration, as its inhibition
decreases regeneration percentage and rate, while not affecting wound healing (Reid
et al 2009).
The previous studies illustrate what seems to be an electrical signature for
regeneration ability. In fact, the need for a regeneration-specific EC has been showed
in less conventional models, including the green algae Acetabularia mediterranea
(Noval and Sirnoval 1975), the earthworm Eisenia foetida (Moment 1949, Kurtz and
Schrank, 1955) and even the human children fingertip (Illingworth and Barker,
1980).
Page | 31
Chapter I - Introduction
Figure I.9 – Bioelectrical signals correlate with regenerative ability in amphibians (in
this example, Xenopus tadpole). After the wound healing (>6-12 hpa), regeneration is
accompanied by an inward electric current (A, white bars) and depolarization of the
regenerating tissue, mediated by the activity of ion translocators (such as sodium channels)
(B). On the contrary, non-regenerative species or developmental stages lack those
bioelectrical signals and regeneration does not occur (A, black bars, and C). hpa: hours post
amputation. * statistically significant differences in electric current. Modified from Adams et
al 2007, Reid et al 2009.
3.3. Bioelectrical signals control cell behaviour
ECs and EFs are vectors, with a magnitude and direction – a positive pole (anode) and
a negative pole (cathode) - which gives them the capacity to act as spatial organizers
at the intracellular, cellular and tissue levels. In fact, all cell behaviours within 500 µm
of a wound edge inevitably take place within a standing gradient of voltage.
Therefore, it is likely that distinct cell behaviours are affected by electrical signals
(McCaig et al 2005).
3.3.1. Bioelectrical control of cell behaviour during wound healing
Many different cells have the ability to detect external EFs and to migrate along field
lines according to their polarity, a phenomenon known as galvanotaxis or electrotaxis
(Nuccitelli 2005). During wound healing, the migration of the epithelial cells that will
cover the wound is directly dependent on the imposed injury EF (Fig. I.8) (Stump and
Page | 32
Chapter I - Introduction
Robinson 1986, Chiang et al 1991, Sta Iglesia et al 1996, Sta Iglesia and Vanable
1998). In fact, in an experiment using bovine cornea wounds, the reversion of the EF
direction switched the direction of cell migration, resulting in the wound opening up
instead of closing (Zhao et al 2006). Additional experiments on mammalian cornea
wounds have showed that, besides cell migration, endogenous gradients of EC control
other cell behaviours required for wound healing. Particularly, they stimulate
epithelial cell proliferation near the wound site, regulate the axis of epithelial cell
division so that the mitotic spindle aligns parallel to the EF vector (Fig. I.10A), and
govern the number and orientation of nerves sprouts growth towards the wound,
having a stimulatory effect over all behaviours (Fig. I.10B) (Zhao et al 1999, Song et al
2002, Song et al 2004). It is thus imperative that the intensity of endogenous ECs and
EFs is tightly controlled in vivo, to ensure that the normal EC and EF strength
produces the maximal wound response (Sta Iglesia et al 1996).
Figure I.10 – Electric fields (EF) affect cell division (A) and nerve sprouting (B) during
wound healing in rat cornea. Whole mount preparations, 12 h post lesion. Woundgenerated EFs (control) dictates the rate and axis of cell division towards the wound (A), and
also stimulates and directs nerve sprouting (B). Increasing the EF magnifies its effects on cell
division and nerve sprouting, whereas decreasing it has the opposite effect (A and B, middle
and right panes). Mitotic spindles (green), rhodamine-phalloidin (red), EF vector (yellow
arrow), nerves (yellow). Modified from Song et al 2002 (A), Song et al 2004 (B).
Page | 33
Chapter I - Introduction
3.3.2. Bioelectrical signals control cell behaviours required for regeneration
Endogenous ECs and EFs accompany not only the wound healing but the whole
regenerative process as well. Thus, during regeneration-specific stages, cell
migration, proliferation and innervation of the new tissues are likely to be affected by
EFs in a manner similar to the described during the wound healing (chapter I: section
3.3.1.). Additionally, other electrical signals control cell behaviour required for
regeneration, as described next.
3.3.2.1. Cell proliferation
Control of proliferation may be attained through regulation of the membrane
potential (V mem ). Cells with a very high membrane potential (a hyperpolarized V mem )
such as muscle cells and neurons show little if any mitotic activity, whereas
developing cells and cancerous cells, which are highly proliferative, tend to have a
smaller degree of polarization (a depolarized V mem ) (Fig. I.11). In fact, V mem varies
through the cell cycle in a way directly related to progression through G1/S and G2/M
transitions: hyperpolarization is required for G1/S (DNA synthesis) progression and
then a prolonged period of depolarization is necessary for the G2/M transition
(mitosis) (Sundelacruz et al 2009, Blackiston et al 2009). Importantly, several
evidences demonstrate these relationships are causal. For instance, artificial
modulation of V mem can induce changes in somatic cell proliferation and even mature
neurons can re-enter the cell cycle by long-term depolarization (Cone and Tongier
1971, Stillwell et al 1973, Cone and Cone 1976). Furthermore, in mammalian
macrophages and endothelial cells, V mem regulates the expression of several
molecules that regulate the cell cycle, including cyclins and cyclin- related molecules
(Kong et al 1991, Wang et al 2003). Interestingly, the opposite is also true: several ion
channels which activity is necessary for cell cycle progression are activated
downstream of mitogen (EGF, IGF-1, insulin) stimulation, demonstrating that
bioelectrical signals are not only signals upstream of molecular signalling pathways
but also important intermediate components of the molecular pathways themselves
(Kunzelmann 2005). Accordingly, a number of ion translocators show variation in
expression or activity across stages of the cell cycle, including mediators of protons
(H+, Perona and Serrano 1988), sodium (Na+, Fraser et al 2005), chloride (Cl-, Block
Page | 34
Chapter I - Introduction
and Moody 1990, Habela et al 2008) and especially potassium fluxes (K+, Day et al
1993, Klimatcheva and Wonderlin 1999, MacFarlan and Sontheimer 2000) which are
considered protagonists of proliferation and cell cycle progression, by their V mem
depolarizing action that favours proliferation (Sundelacruz et al 2009). Importantly,
the first direct evidence linking V mem to proliferation during regeneration was already
described: modulation of the Vmem by the vacuolar, ATP-dependent proton (H+)
pump (V-ATPase) is essential for regeneration of Xenopus larval tail, by promoting
cell proliferation and neural patterning (Adams et al 2007).
3.3.2.2. Cell differentiation/ de-differentiation
Other cell behaviours necessary for regeneration success are cell de-differentiation
during blastema formation and cell differentiation into all the missing lineages during
the regenerative outgrowth. Again, bioelectrical cues have a leading role in both cell
behaviours.
The profile of ion channels and ionic currents varies with the differentiation state of
the cell (Arcangeli et al 1997, Flanagan et al 2008), as observed for example during
differentiation of mouse embryonic stem cells into cardiomyocytes (Van Kempen et al
2003), in muscle satellite cell-derived human myoblasts (Hamann et al 1994, Bijlenga
et al 2000, Fischer-Lougheed et al 2001), or during neural differentiation of neural
stem-like cells from human umbilical cord blood (Sun et al 2005). These changes in
the cells’ bioelectrical profile play functional and instructive roles in their
differentiation and maturation. In fact, neural cells (Messenger and Warner 1979)
and human hematopoietic progenitor cells (Shirihai et al 1998) require activation of
distinct and specific ion channels and/or pumps in order to differentiate. More,
endogenous V mem hyperpolarization is necessary for differentiation of human
myoblast (Konig et al 2004) as well as for differentiation of human mesenchymal
stem cells into osteogenic and adipogenic lineages (Fig. I.11) (Sundelacruz et al
2008).
On the contrary, V mem depolarization seems to promote cell de-differentiation or
maintenance of undifferentiation (Fig. I.11). Particularly, depolarization induces
Page | 35
Chapter I - Introduction
mature and completely differentiated cells to regain morphological and functional
characteristics of undifferentiated or less differentiated states, including the ability to
proliferate (Cone and Tongier 1971, Harrington and Becker 1973, Stillwell et al 1973,
Chiabrera et al 1979, Echeverri and Tanaka 2002, Odelberg 2002).
Figure I.11 – Membrane voltage (V mem ) intensity correlates with proliferative potential
and differentiation state of cells. Differentiated cells are typically hyperpolarized, whereas
undifferentiated and proliferative cells are usually depolarized. Modified from Levin 2012.
In short, V mem hyperpolarization stimulates both cell cycle exit and differentiation,
whereas V mem depolarization is associated to cell proliferation and maintenance in a
less or undifferentiated state (Fig. I.11). This relationship between regulation of
differentiation and that of proliferation and cell cycle progression is not surprising,
since cells must coordinate their exit from the cell cycle with the initiation of their
differentiation programs. Nevertheless, it is important to keep in mind that the
Page | 36
Chapter I - Introduction
bioelectrical cues controlling both processes are not overlapping, and at least some
different ion translocators are involved in each mechanism (Miller et al 2007,
Sundelacruz et al 2009, Levin 2012).
3.3.2.3. Apoptosis
Removal of specific cells through programmed cell death is part of the tissue
sculpting in a variety of systems utilizing stem cells, tissue renewal and
transdifferentiation (Levin and Stevenson 2012). In fact, it was already demonstrated
that apoptosis is necessary for regeneration in both vertebrate and invertebrate
models (Tseng et al 2007, Chera et al 2009). A major hallmark of apoptosis is
progressive cell shrinkage, which is induced by specific ion channel function that
results in V mem depolarization and efflux of K+ and Cl- together with osmotically
obliged water (Okada and Maeno 2001, Lang et al 2005). On the contrary, protective
mechanisms against cell death involve V mem hyperpolarization (Wang et al 1999),
also via the regulation of the activity of different ion channels, including Cl-, Ca2+ and
K+ channels (Lang et al 2005). In fact, modulation of K+ flux has a direct effect on
apoptosis: inhibition of K+ channels prevents K+ efflux, promoting V mem
depolarization and apoptosis, whereas activation of K+ channels have the opposite
effect (Miki et al 2001, Lauritzen et al 2003).
3.3.2.4. Tissue patterning
During regenerative outgrowth cells must coordinate their differentiation with
appropriate positioning in the regenerating structure in order to generate the correct
3D pattern. Again, V mem modulation, through the activity of specific ion transporters,
seems to be an important component of the regulatory signals that coordinate such
morphogenetic process (Levin and Stevenson 2012). This is best illustrated during
planarians regeneration, where the ion pump H+,K+-ATPase induces a controlled level
of V mem depolarization that specifies anterior polarity in the new regenerating tissues,
via regulation of anterior gene expression and specification of head patterning (Fig.
I.12) (Beane et al 2011). H+,K+-ATPase is also required for morphallactic remodelling
of the pre-existing tissues via apoptosis, which is necessary for a correct head size
and organ proportionality by the end of the regenerate process (Beane et al 2013).
Page | 37
Chapter I - Introduction
Bioelectrical signals can also mediate global patterning cues by mediating long-range
transport of morphogens. A great example is the V mem - dependent electrophoretic
transport of serotonin via gap junctions during left-right asymmetry patterning
(Fukumoto et al 2005, Esser et al 2006, Aw and Levin 2009).
Figure I.12 – Membrane potential (V mem ) mediated by the H+,K+-ATPase regulates
patterning during planarian regeneration. (A) Diagram of amputations. Regenerating
middle fragments (pink) were subjected to different treatments to affect V mem (B). (B1–B3)
Regenerates assayed at 24 hpa (hours post amputation) using V mem fluorescent dye. (B4–B6)
Phenotypes scored at 14 dpa (days post amputation). (B2, B5) Under control conditions,
localized H+,K+-ATPase activity depolarizes the anterior blastema V mem ; the posterior
blastema remains hyperpolarized relative to the anterior part. Changes to this V mem anteriorposterior profile affect the regenerate patterning: hyperpolarization favours posterior
structures (B1, B4); depolarization specifies anterior patterning (B3, B6). Arrowheads:
depolarized blastemas. Anterior is up. Scale bars=500μm. Modified from Beane et al 2011
3.4. Chemical signals mediated by ion translocators affect cell behaviour
Because ions are chemical species, their movement inevitably generates
concentration gradients. The chemical and electrical signals generated by the activity
of ion translocators are often impossible to dissociate, but there are cases in which
the chemical component, not the electrical one, was proven to be the critical factor
instructing specific cell behaviours (Sundelacruz et al 2009). For example, the
Page | 38
Chapter I - Introduction
increase in intracellular Na+ mediated by the voltage-gated Na+ channel NaV1.2 is
required for cell proliferation and tissue innervation during Xenopus tadpole tail
regeneration. Remarkably, induction of a transient Na+ current using monensin (an
ionophore that selectively transports sodium ions into cells without changing the
V mem ) restores regeneration even after the formation of a non-regenerative wound
epithelium, confirming that the main role of NaV1.2 during regeneration is the
regulation of sodium transport, not the V mem (Tseng et al 2010). In another study, a
detailed analysis of the zebrafish eye development and maintenance in V-ATPase
mutant animals revealed that this H+ pump is essential for eye growth by controlling,
in a first stage, the cell cycle exit of retinoblast in the embryonic retina, and later the
proliferation of retina stem cells at the ciliary marginal zone (CMZ) to allow retinal
growth. V-ATPase function was also necessary for the survival of retinal neurons, for
photoreceptor morphogenesis and for pigmentation of the retinal pigmented
epithelium. These effects of V-ATPase activity on cell behaviour possibly result from
the acidification promoted by H+ accumulation (Nuckels et al 2009).
3.5. How do cells sense and transduce bioelectrical signals into cell
behaviour
Bioelectrical cues must combine with molecular signalling pathways in order to affect
cell behaviour (Fig. I.13). The mechanisms that transduce electrical signals into
second-messenger cascades are still largely unclear, but some data is already
available, especially regarding the effect of EFs on cell migration. One view is based
on the fact that EFs exert force on every charged molecules, including cell surface
receptors and intracellular second messengers and cytoskeletal molecules. Such force
moves the charged molecules either directly by electrophoresis (movement of
charged molecules in an EF due to its charge and molecular weight) or indirectly via
electroosmosis (movement of molecules due to the movement of the water of
hydration that surrounds all charges). Consequently, both intracellular and cell
membrane components get asymmetrically distributed, inducing asymmetric
signalling cascades that culminate with polarized actin polymerization and thus
directional cell migration (Jaffe 1977, Poo and Robinson 1977, McLaughlin and Poo,
Page | 39
Chapter I - Introduction
1981, McCaig et al 2005, Nuccitelli 2005, Messerli and Graham 2011, Ozkucur et al
2011).
The molecular basis for electrotaxis has already started to be unveiled. In cornea, lens
and skin epithelial cells, EFs induce polarized distribution and activation of EGF
signalling to the cathodal side, including the downstream activation of ERK1/2 and
polarized actin filament, which are necessary for electrotaxis (Fang et al 1999, Zhao
et al 1999, Zhao et al 2002, Wang et al 2003a). During wound healing in rat cornea,
the wound-induced EF triggers polarized activation of PI3K/PTEN in the direction of
cell migration as part of the molecular machinery that transduces the electrical signal
into direct cell migration towards the wound site (Zhao et al 2006). In fact, PI3K and
PTEN are essential molecules controlling electrotaxis. Additionally, PTEN can also
regulate cell migration independently of PI3K/Akt through its protein phosphatase
activity, as described for chick embryo (Leslie et al 2007). Several other signalling
pathways have been showed to regulate EF- directed cell migration, including
integrins/Rac, cAMP, Rho small GTPases (Zhao 2009).
EFs also induce localized changes in V mem , especially in regions facing the two poles of
the field. This can cause asymmetric activation of plasma membrane voltage sensors,
including voltage-gated ion channels and voltage-sensitive small molecule
transporters such as the serotonin transporter, which converts V mem into the influx of
specific chemical signals (Levin et al 2006, Levin 2007, Messerli and Graham 2011).
Localized changes in V mem can also bias the force driving ions through any open
channels. Thus, membrane potential can be converted into polarized influx of specific
chemical signals that direct changes to cell morphology and control cellular response
(Fig. I.13) (McCaig et al 2005). That is the case for the Na+ influx mediated by the
voltage-sensitive Na+ channel NaV1.2: intracellular Na+ increase is sensed by salt-
inducible kinases that modulate downstream signalling pathways such as insulin
signaling in adipocytes and likely Notch and Msx1 during regeneration (Okamoto et al
2004, Tseng et al 2010). Also, modulation of intracellular K+ and other cations levels
can affect DNA structure and gene expression directly (Levin and Stevenson 2012).
Furthermore, changes in V mem can increase intracellular free-Ca2+, which is necessary
for major cell responses including galvanotaxis, proliferation, differentiation and
Page | 40
Chapter I - Introduction
patterning. Activation of Ca2+ influx can be direct, via activation of voltage-gated Ca2+
channels, or indirect, via activation of other ion channels or membrane receptors
such as acetylcholine receptor which is leaky to Ca2+ (McCaig et al 2005, Nuccitelli
2005, Sundelacruz et al 2009).
Importantly, it was recently found the first example of a non-channel protein that
directly converts electric cues into intracellular molecular signalling: the Ciona
intestinalis
voltage
sensor-containing
phosphatase
(Ci-VSP).
This
is
a
phosphoinositide phosphatase consisting of an ion channel-like transmembrane
domain followed by a phosphatase domain which shares sequence identity to
Figure I.13 – Transduction of bioelectrical signals into cell behaviour. Schematic
diagram shows the sequential phases that go from the generation of endogenous electric
signals to their integration into biochemical and genetic signalling pathways to finally affect
cell behaviour. Orange colour indicates bioelectrical events; Blue colour stands for chemical
and genetic events Modified from Levin 2009a.
Page | 41
Chapter I - Introduction
mammalian PTEN. The voltage-sensor domain of Ci-VSP activates the phosphatase
domain upon V mem depolarization, resulting in dephosphorylation of both PI(3,4,5)P3
and PI(4,5)P2. This, way, Ci-VSP activates PI3K signalling, transducing electric signals
into cell behaviours such as proliferation, differentiation and migration (Murata et al
2005, Murata and Okamura 2007, Iwasaki et al 2008).
There is also growing evidence that ion translocators coordinate with classical
molecular signalling cascades to affect cell behaviour. For example, V-ATPase is
essential for activation of Wnt, JNK and Notch signalling, by regulating endosomal pH
(Cruciat et al 2010, Vaccari et al 2010, Petzoldt et al 2013); and NHE1 is necessary for
IGF-II-induced proliferation of human gastric myofibroblasts and contributes to both
IGF-II- and carbachol-stimulated migration by controlling intracellular pH (Czepán et
al 2012).
Page | 42
Chapter I - Introduction
4. Protons: chemical and electrical functions
Despite the need for electrical cues during regeneration (chapter I: section 3), the
ionic nature of the ECs that accompany regeneration and the molecular players that
originate them are only starting to be unveiled.
K+, Na+, Ca2+, and Cl- are important components of the intra and extracellular media,
and thus constitute the most obvious players generating electrical signals. For
instance, the injury potential is driven by the TEP, which in most epithelia builds-up
mainly on Na+ active transport to, and accumulation in, the internal side of the
epithelia (Jenkins et al 1996). This Na+ transport is typically accompanied by
transport (passive or active) of anions in the same direction and/or movement of
other cations in the opposite direction, to minimize the build-up of electric potentials
(Randall et al 1997). In fact, Na+ and Cl- constitute the major components of ECs in rat
and human corneal wounds, likely together with smaller fluxes of Ca2+ and K+ (Reid et
al 2005, Reid et al 2011a, Reid et al 2011b).
Another important ion species is many times underappreciated: protons (H+).
Protons are generated when the hydrogen atom loses its only electron, and all that
remains is a bare nucleus, consisting of one proton and no neutrons. Free protons in
the form of single H+ have extremely low concentration in physiological solutions due
to its extremely high reactivity with any available molecule. Nevertheless, they are
present in higher amounts (~40nM) in the hydrated form as hydronium ions (H 3 O+)
that result from the spontaneous and constant ionization of water. The concentration
of protons in solution is measured in a logarithmic scale designated as pH: the higher
the concentration of protons, the lower the pH. Pure water has a pH around 7.0 which
is considered neutral pH; lower pH (0-7) correspond to acidic solutions whereas pH
7-14 indicates an alkaline environment.
Protons are potent modulators of virtually all biological processes. Their
concentration determines the protonation state of amino acids and hence the
Page | 43
Chapter I - Introduction
structure and function of proteins, and even nucleic acids conformation is modulated
by pH. In this way, protons are key regulators of gene expression and signaling
pathways. Besides, protonation–deprotonation events dictate the charge of biological
surfaces and are an integral part of many metabolic reactions, including those
involved in cellular respiration (Casey et al 2010, Boedtkjer and Aalkjaer 2012). Due
to such crucial functions, a tight control of intracellular pH (pHi) is fundamental, and
is ensured by the transport of H+ or their chemical equivalents (such as HCO 3 ions)
across membranes (Boron 2004), together with active and passive buffering (Felle
2001). These mechanisms of pH control act not only at the cytosol level but also at
intracellular compartments. In fact, each intracellular compartment (eg. nucleus,
endoplasmic reticulum, Golgi, vesicles, mitochondria) has a distinct pH that is
fundamental for proper organelle function (Casey et al 2010). pH modulation is also
required at the tissue and organism level. For example, moderate acidification of the
local environment accompanies skeletal muscle contractions and blood is maintained
around pH 7.4 through regulation of respiration and acid extrusion in the kidneys.
More, systemic disturbances in pH are frequently associated with metabolic, renal,
gastrointestinal and pulmonary disorders (Boedtkjer and Aalkjaer 2012).
4.1. Proton transport across membranes
Proton transport across biological membranes results in a dynamic, finely tuned
balance between proton-extrusion and proton-intake that underlies a major
component of pH homeostasis. Proton entry in cells is mainly driven through proton
channels and co-transporters (symporters and antiporters) that allow the passive
movement of protons into the cytosol down their electrochemical gradient (the
transmembrane electrical potential is typically negative inside cells, promoting the
uptake of positively charged molecules and ions). The list of molecules with proton
conduction properties is vast and not consensual, but some proton channels have
been extensively studied, including gramicidin, M 2 viral proton channel and voltagegated proton channels (Decoursey 2003).
Another class of proton translocators known as proton pumps use the chemical
energy from phosphate release (from ATP or another phosphate source) to drive
Page | 44
Chapter I - Introduction
proton extrusion from the cytosol, against their concentration and electrical
gradients. The activity of proton pumps builds up transmembrane electrochemical
proton gradients that provide an important energy source immediately available to
the cells. This energy can be used to drive either secondary active transport of ions
and a variety of uncharged molecules uphill, or passive transport downhill. Proton
extrusion is also used to maintain pH homeostasis and to acidify specific intracellular
and extracellular compartments. Additionally, it can generate electrical potential and
concentration differences across membranes that convey or carry information, thus
acting either as a signal or a messenger, respectively (Randall et al 1997, Felle 2001).
In eukaryotic cells there are three major classes of proton pumps: P-ATPases, FATPases and V-ATPases. P-ATPases are a large group of cation pumps found in
bacteria, archaea and eukaryotes (plants, fungi and protists), that actively transport
cations like H+, Na+, K+, Ca2+, Zn2+, and Cu2+ across biological membranes using ATP
hydrolysis as the energy source. A vast array of ion pumps belongs to the P-ATPase
family, including the Na+/K+-ATPase, the H+/K+-ATPase, Ca2+-ATPase and H+-ATPase.
Despite such diversity, all P-ATPases share a similar basic structure and mechanism
of activity (Yatime et al 2009). F-ATPases, also called F-ATP synthases, are located
mainly in the thylakoid membrane of chloroplasts and in the inner membrane of
mitochondria, where they use the energy from the passive flux of protons down their
electrochemical gradient to synthesize ATP from ADP and inorganic phosphate. F-
ATPases are also present in the plasma membrane of eubacteria, where they can
function in reverse, this is, using energy from ATP hydrolysis to pump protons against
their thermodynamic gradient (Wieczorek et al 1999, Saroussi and Nelson 2009).
Last, V-ATPases are proton pumps with a similar structure and mechanism of action
to the F-ATPase, and both have probably evolved from a common ancestor (Nelson
1992). Nevertheless, V-ATPases only operates as ATP hydrolases to drive proton
translocation. V-ATPase is the most widespread proton pump in animal cells; its
structure, activity, regulation and function will be described in detail in the next
sections.
Page | 45
Chapter I - Introduction
4.2. V-ATPase: main H+ pump in animal cells
V-ATPases are highly conserved, membrane-bound multimeric enzyme complexes
that translocate protons across membranes using the free energy of ATP hydrolysis
(Boesch et al 2003). They are present in virtually all eukaryotic cells, playing both
housekeeping and tissue specific functions (Ma et al 2011).
4.2.1. Structure and subunit function
V-ATPases contain at least 14 different subunits (Fig. I.14) (some of which are
present in multiple copies) which are organized into two functional domains: the
peripheral V1 domain, which is located on the cytoplasm and is responsible for ATP
binding and hydrolysis, and the integral, membrane-embedded V0 domain that
accounts for H+ translocation across the membrane. The two domains are functionally
and structurally connected by two types of stalks that couple the catalytic events
taking place on the V1 to the H+ translocation in V0 (Cipriano et al 2008, Ma et al
2011).
The integral V0 domain contains 5 transmembrane subunits – a, e, c, c´ and c’’ – and
one peripheral subunit – d (Fig. I.14). The typical stoichiometry is a 1 d 1 e n c 4 – 5 c′ 1 c″ 1
(Powell et a 2000, Arai et al 1988, Sambade and Kane 2004) but the number of
proteolipid subunits (c, c’, and c’’) in higher eukaryotes is not firmly established
(Zhang et al 2008). These proteolipid subunits are highly hydrophobic proteins that
arrange in a well-defined manner to form a ring structure (c-ring) (Wang et al 2007).
Each proteolipid subunit contains a single buried glutamic acid (Glu) residue in one of
the transmembrane α-helixes, which is essential for H+ translocation (Toei et al 2010,
Ma et al 2011). Also crucial for H+ transport is subunit a; this integral protein is in
close contact with the c-ring and contains a transmembrane α-helix- buried arginine
(Arg) residue that is absolutely required for H+ transport, by interacting with the Glu
residues of the proteolipid subunits (Kawasaki-Nishi et al 2001, Wang et al 2004).
Subunit a also provides access channels (hemi-channels) that allow H+ to reach and
leave the buried Glu residues on the proteolipid subunits (Toei et al 2010). Another
V0 component, subunit e, was only recently found to be an integrating subunit of V-
Page | 46
Chapter I - Introduction
ATPase, and its function is still unclear (Sambade and Kane 2004, Compton et al
2006).
The peripheral V1 domain contains always eight different subunits - A, B, C, D, E, F, G,
and H - but the stoichiometry may vary with the species. For example, the number of
the V1 subunits in bovine V-ATPase is A3B3CDEFG2H2, whereas in the yeast it is
A3B3CDE3FG3H. The A and B subunits form tree heterodimers arranged in a
hexameric cylinder (Fig. I.14). Each heterodimer is made of a catalytic A subunit
where the ATP binds, and a non-catalytic B subunit with regulatory function, and
together they are responsible for ATP hydrolysis. All the other V1 subunits bind this
A3B3 hexamer, most likely via the B subunit (Imamura et al 2006, Zhang et al 2008,
Maher et al 2009, Ma et al 2011).
V1 and V0 domains are connected by two types of stalks, central and peripheral, that
comprise subunits from both domains. Subunits D and F form a heterodimer located
in the lower part of the central cavity of the A3B3 cylinder (Basak et al 2013); subunit
d is located on top of the ring of proteolipid c subunits and provides a connection
between subunits D and F of V1 and the c-ring of V0. Together, subunits D, F and d
form the central stalk that serves as a rotor, coupling the energy released from the
hydrolysis of ATP to the rotation of the c-ring in V0 (Forgac 2007, Ma et al 2011). On
the contrary, the peripheral stalks serve to resist the torque generated during
rotation of the rotary complex (central stalk + c-ring), thus maintaining subunit a and
the A3B3 hexamer in a fixed position. The number (two or three) and composition of
peripheral stalks is still controversial and may vary across species (Xu et al 1999,
Wilkens et al 1999, Domgall et al 2002, Venzke et al 2005, Kitagawa et al 2008, Zhang
et al 2008). Nevertheless, the most accepted structure is as follows: subunits E and G
form cytoplasmic EG heterodimers that are present in two or three copies. Depending
on that, one or two peripheral stalks are formed by EG heterodimer(s) bound to the
single C subunit in one side of the A3B3 hexamer. On the opposite side of A3B3,
another stalk is formed by an EG pair bound to the H subunit. Each stalk is complete
by binding of subunits C or H to the amino-terminal domain of the transmembranar
subunit a (Wilkens et al 2004, Ohira et al 2006, Zhang et al 2006, Diepholz et al 2008,
Zhang et al 2008, Rahman et al 2013).
Page | 47
Chapter I - Introduction
Figure I.14 – Structure of the V-ATPase. The V-ATPase is composed of two domains: the V1
peripheral domain which is composed of eight different subunits (A-H, coloured yellow and
orange) and is responsible for ATP hydrolysis; and the integral V0 domain that comprises six
subunits (in yeast: a, c, c’, c’, d, and e, coloured blue and gray) and is involved in the
translocation of protons across the membrane, from the cytoplasm into the lumen. ATP
hydrolysis drives the rotation of a central rotor (subunits D, F, d, c, c’, and c’’). Subunit a
possesses two hemichannels that allow protons from the cytoplasmic to reach buried
glutamic acid residues (coloured green) on the c, c’, c’’ ring and to leave from these sites to
the luminal side of the membrane following interaction of the glutamate residues with the a
subunit arginine residue (coloured red). The V1 and V0 domains are connected by a central
stalk (subunits D, F, and d) and two or three peripheral stalks (subunits C, E, G, H and the Nterminal cytoplasmic domain of subunit a). From Toei et al 2010.
Aside from the basic role in the V-ATPase functioning, several subunits have
additional roles with relevant biological significance. For instance, B and C subunits
are involved in the interaction of V-ATPase with the cytoskeleton, by including actin
binding sites (Holliday et al 2000, Vitavska et al 2003, Holliday et al 2005); this
interaction have an important role in modulating the density of V-ATPases at the
plasma membrane (Forgac 2007). Subunit C is also required for the V0-V1 domains
reversible dissociation (chapter I: section 4.2.3.). In fact, it is the only protein that
releases completely from the V1 and V0 domains upon dissociation of the V-ATPase
complex (Kane 2006, Zhang et al 2006). Subunit H is the only subunit that is not
strictly required for the assembly of the H+ pump subunits, but it is necessary for VPage | 48
Chapter I - Introduction
ATPase function and for the interaction of the V-ATPase with other cellular proteins
such as the HIV protein NEF, the endocytic adaptor protein AP-2 and the Golgi
ectoapyrase (Ho et al 1993, Wilkens et al 2004). More, interaction between subunits
H and F inhibits ATP hydrolysis upon V0-V1 dissociation, avoiding an uncoupled and
thus useless ATPase activity (Jefferies and Forgac 2008, Basak et al 2013). Subunit E
is a central piece of the peripheral stalks, binding to several subunits, namely G, C, H,
and B and possibly subunit a (Xu et al 1999, Arata et al 2002, Féthière et al 2005,
Rishikesan et al 2008). It is required for the stable assembly of V1 subunits, probably
by binding RAVE and aldolase, and it is also crucial for functioning of the assembled
pump (Zhang et al 1998, Lu et al 2002, Smardon et al 2002, Lu et al 2004, Hayashi et
al 2008, Dettmer et al 2010). Subunit a is involved in reversible dissociation of the
V1-V0 domain, and exists in multiple isoforms that contain the information necessary
for targeting the V-ATPase to the appropriate membrane; the cytoplasmic N-terminal
domain is the key region for both processes (Qi et al 2007, Hinton et al 2009).
Adding even more complexity to the V-ATPase system, at least seven of the fourteen
V-ATPase subunits exist in multiple isoforms in mammalian cells. In each case, one
isoform is ubiquitously expressed while the remaining isoforms are tissue- specific,
and may have additional regulatory roles regarding the pump activity (Toei et al
2010).
4.2.2. Mechanism of activity
Vacuolar (V-)ATPases operate by a rotary mechanism. H+ are first engaged at the
cytoplasm-facing hemi-channel of subunit a and protonate buried Glu residues in the
c-ring subunits. Then, the ATP binding and hydrolysis at the V1 A3B3 hexamer drives
the rotation of the rotary complex (central stalk and the attached c-ring) relative to
subunit a and A3B3, which are held in position by the peripheral stalks. As result of
rotation, the protonated Glu residues on the c-ring cross the lipid bilayer and reach
the other hemi-channel of subunit a, in the luminal side of the membrane. Here, the
buried Arg residue in subunit a interacts with the protonated Glu residues on the c-
ring, stabilizing them in their deprotonated form, and thus releasing H+ into the
luminal hemichannel. Other buried charged residues in the C‑terminal domain of
Page | 49
Chapter I - Introduction
subunit a line the lumenal hemi-channel through which H+ exit the membrane.
Continued rotation of the c-ring places the deprotonated Glu residues once again in
contact with the cytoplasmic hemi-channel, where they can be protonated again. In
this way, rotary motion driven by ATP hydrolysis in V1 drives unidirectional
transport of protons across the membrane through V0. Because there are three ATP
binding sites in the A3B3 hexamer, and six to ten protonation sites in the c-ring, it is
predicted that approximately 2-3.3 H+ are transported across the membrane per ATP
hydrolyzed (Forgac 2007, Cipriano et al 2008, Toei et al 2010).
4.2.3. Regulation of activity
The assembly of all V-ATPase subunits into a functional enzyme complex requires
specific chaperone proteins in the endoplasmic reticulum (ER), but they can also
assemble into separate V1 and V0 domains that can associate at a later stage (Forgac
et al 2007). Once the enzyme complex is complete, its activity must be precisely
controlled at each cellular location. This can be achieved by at least 5 mechanisms:
• Reversible dissociation of V-ATPase into inactive, non-functional V0-V1 domains:
this process can occur rapidly in nutrient depleted cells as a means of conserving
cellular stores of ATP (Kane 1995, Summer et al 1995). Additionally, it can also
occur at particular intracellular compartments in which the complex resides, as a
consequence of the luminal pH. Dissociation and reassembly appear to be
independently controlled processes and involve a number of different regulatory
proteins, including RAVE/rabconnectin, aldolase and other glycolytic enzymes, and
protein kinase A (Kane 2012).
• Changes in the coupling efficiency between ATP hydrolysis and H+ translocation:
this control of the amount of H+ transported per ATP hydrolysed can be
accomplished by presence of different isoforms of subunit a or due to external
factors such as changes in ATP concentration or in the level of proteolysis
(Cipriano et al 2008).
• Changes in the abundance of V-ATPase complexes at a given cellular location, by
reversible exocytosis and endocytosis of the pump: regulates the level of acid
secretion by V-ATPase at the plasma membrane in renal cells and osteoclasts
(Lafourcade et al 2008).
Page | 50
Chapter I - Introduction
• Reversible disulfide bond formation between specific amino acid residues of the
catalytic site of subunit A: blocks ATP hydrolysis and the subsequent H+ pumping
(Lin et al 1997, Shao and Forgac 2004).
• Membrane lipid composition also seems to affect the pump activity. Particularly,
specific lipids are required for the ATP hydrolysis function of the V1 domain; and
the level of membrane fluidity may control the rate of V0-V1 assemblydisassembly (Lafourcade et al 2008).
4.2.4. V-ATPase functions
V-ATPases are present in the membrane of several intracellular compartments,
mediating lumen acidification that is required for different functions. Particularly, the
acidic pH generated by the V-ATPase in sorting endosomes is required for the
uncoupling of internalized ligand–receptor complexes, by inducing changes in
proteins conformation. This way, it facilitates the recycling of unoccupied receptors
back to the cell surface and the further processing of the ligand, as demonstrated for
important ligand-receptor mediated signaling pathways, including Wnt, Notch and
JNK (Cruciat et al 2010, Vaccari et al 2010, Petzoldt et al 2013). The degradative
enzymes contained in secretory vesicles as well as in lysosomes and other digestive
organelles also require V-ATPase- mediated acidic pH to be activated and
consequently process or degrade the internalized molecules. In fact, this is essential
for the processing of proinsulin into insulin in the pancreatic islet cells and for
proteins degradation into amino acids. Additionally, V-ATPases within secretory and
digestive organelles also establish proton and membrane potential gradients across
the membrane, which are used to drive transport of small molecules and ions.
Examples include the uptake of neurotransmitters and ATP in secretory vesicles, the
uptake of various amino acids and Ca2+ sequestration in yeast vacuoles, and the
extrusion of amino acids from the lysosome into the cytoplasm. Vacuolar acidification
has also been reported to be involved in the transport of lysosomal enzymes from the
Golgi apparatus to the lysosomes (Forgac 2007, Hinton et al 2007, Jefferies et al
2008).
Page | 51
Chapter I - Introduction
V-ATPases can function independently of their electrogenic proton pumping activity.
Thus, they directly participate in vesicle budding within early endosomes by serving
as the docking site for proteins that regulate this process. In a similar fashion, VATPase integral domain V0 directly participates in membrane fusion through the
mixing of the hydrophobic proteolipid subunits of the V-ATPases present in the two
fusing membranes. This mechanism seems to participate in membrane fusion in
yeast, in synaptic vesicle release in Drosophila neurons, fusion of cuticle-containing
vesicles with the plasma membrane of epidermal cells of C. elegans and release of
insulin from pancreatic islet cells (Hinton et al 2007).
V-ATPases are also present at the plasma membrane in a variety of specialized cells,
particularly various epithelial cells, where they play important functions in acid
secretion. For example, in the kidney, proton transport via V-ATPases in intercalated
cells is essential for whole body pH (acid-base) homeostasis, by mediating acid
secretion into the urine or the resorption of acid equivalents into the tubule lumen,
depending on the systemic pH. In osteoclasts, V-ATPase activity at the plasma
membrane is crucial for bone resorption, by providing an acidic extracellular
environment that directly dissolves the bone matrix and activates secreted proteases
that participate in bone resorption. In the male reproductive tract, maintenance of
acidic pH in the vas deferens and epididymus is mediated by plasma membrane V-
ATPases in clear cells, and this is important for sperm maturation and maintenance in
a quiescent state (Hinton et al 2007, Jefferies et al 2008).
Plasma membrane- V-ATPases also function in cell migration and invasion. For
instance, during angiogenesis and tumor metastasis, this proton pump promotes an
acidic extracellular environment that facilitates the degradation of extracellular
matrix by proteases, thus facilitating cell movements. At the same time, proton
extrusion avoids cytosolic acidification of cells under high metabolic activity, which
could otherwise lead to apoptosis (Sennoune and Martinez-Zaguilan 2007). Also,
there are cases in which V-ATPase primary function is to create a transmembrane
electrical potential that energizes the membrane, allowing for the secondary
transport of other needed molecules or ions. That is the case in the cells of the insect
midgut. These cells must secrete the excessive potassium (K+) provided by the insect
Page | 52
Chapter I - Introduction
diet. For that, V-ATPase must first secrete H+ into the luminal space, creating a
luminal positive membrane potential. Only then K+ can be secreted via the K+/2H+
antiporter that transports H+ into the cell and K+ into the lumen (Wieczorek et al
1991). Membrane potential regulation by plasma membrane V-ATPase has also been
showed to affect regeneration of Xenopus tadpole tail, by serving has an electrical
signal that affects cell proliferation and innervation (Adams et al 2007).
Page | 53
Chapter I - Introduction
5. Tools for dissecting bioelectrical signals
Unlike mRNA and protein levels revealed by in situ hybridization and
immunohistochemistry, physiological properties such as voltage gradients and ion
fluxes cannot be studied in fixed samples: reporters must be used in vivo (Levin and
Stevenson 2012). Taken that, electrophysiological techniques such as patch-clamp
and implanted or tissue surface static/stationary electrodes have been used over the
last century to demonstrate the presence of electric signals in vivo. Particularly, the
non-invasive vibrating voltage probe developed in the 1970s was a huge advance,
decreasing the resolution limit of EC detection down to micro-amperes (μA), thus
allowing the recording of extracellular, low intensity endogenous ECs of biological
significance that would be otherwise missed. All these techniques have been crucial in
the acknowledgment of electrical signals as key modulators of important processes
such as development and regeneration. Nevertheless, they give poor or no indication
of the actual ionic composition of the currents (Shipley and Feijó 1999, Reid and Zhao
2011), which is crucial to understand the molecular basis of endogenous ECs and how
they participate in the orchestration of cell behaviours. The first method to give
accurate information on the contribution of single ion species to endogenous ECs was
the self-referencing ion-selective vibrating probe (chapter I: section 5.1.) (Shipley and
Feijó 1999).
Nowadays there is an increasing amount of molecular and genetic tools for
characterizing bioelectric events such as voltage gradients and the content or flow of
individual ion species. Those include voltage or ion-specific fluorescent molecular
dyes and genetically encoded sensors; pharmacological screens (chemical genetics)
using chemicals that affect ion transporters or ion flows; and genetic gain- or loss-of-
function experiments targeting specific ion transporters (Levin 2012, Levin and
Stevenson 2012). These modern techniques give invaluable contributions to the field
of bioelectricity, but none replaces the electrophysiological techniques, especially the
voltage and ion-selective vibrating probes, that are still the only non-invasive
methods for describing the natural bioelectrical properties of organisms.
Page | 54
Chapter I - Introduction
5.1. Scanning Ion-selective Electrode Technique
Scanning Ion-selective Electrode Technique (SIET) (Applicable Electronics) is a non-
invasive technique that measures stable low magnitude (µV) extracellular ion-specific
fluxes, in aqueous bathing media, provided there’s a sufficient signal-to-noise ratio.
This has been used in different systems (Zonia et al 2002, Marenzana et al 2005,
Nguyen and Donin 2010, Kreitzer et al 2012). It consists of an ion-selective electrode
(ISE) pulled out of a glass micropipette that is backfilled with an ion-specific
electrolyte - an electrically conductive solution - and tip-filled with the corresponding
ionophore (also known as liquid ion exchanger, LIX) – a liquid membrane that is
selectively permeable to a specific ion species (Fig. I.15A, bottom right panel). The
electrode is placed in an electrode holder with a silver/ silver chloride wire, which
makes the connection between the ion selective electrode and the systems
electronics. The circuit is closed by a KCl reference electrode placed far away (>4 cm)
from the measurement region. The ISE is directly connected to a headstage amplifier
coupled to a system of 3D stepper motors (Fig. I.15A, top right panel). The stepper
motors are controlled by the ASET software. This motion control system allows the
ISE positioning and movement in a pre-defined routine, between two positions, one
closer to the target tissue (10-20 µm), and another 10-100 microns apart. A typical
“move, wait and measure” routine, defined in the ASET “sampling rules”, determines:
(1) the path of the ISE – the excursion distance and the 3D angle of the movement –
and (2) the vibration frequency, that includes the waiting time (amount of time the
ISE remains stationary in each end of the path, to allow the LIX to stop wobbling and
the re-establishment of the ion gradients potentially disrupted by the mechanical
stirring), and the averaging time (amount of time during which voltage is recorded
and then averaged). The electrode records the direct current (DC) voltage potential
(µV/µm) between the pre-defined positions. Such electrical signal included 2
fractions: (1) the voltage produced by the experimental target (target voltage), and
(2) a background voltage, always present due to the difference in specific ion
concentration between the recording solution and the internal concentration of the
electrolyte in the electrode. The headstage preamplifier augmented the overall
voltage signal detected by the ISE by a factor of 10. The signal is then sent to the main,
differential amplifier, which amplified only the target voltage by an additional 100x,
by subtracting the background voltage to the overall signal. Finally, the 1000x
Page | 55
Chapter I - Introduction
magnified target voltage is recorded in the ASET, after analog to digital (A/D)
conversion (Fig. I.15B). The electrical signal that reaches ASET is proportional to the
concentration of the particular ion species under study, and is transformed into fluxes
(concentration per area and per time unit) using the Nernst equation and Fick’s law.
The detected fluxes are classified according to their direction: an influx, when an ion
species has a net flow from the measuring solution into the tissues, or an efflux, when
the net flow is from the tissues under study into the surrounding medium (Fig. I.15C).
Figure I.15 – Scanning Ion-selective Electrode Technique (SIET). (A) SIET components
inside Faraday cage (left pannel), and detail of the headstage (right, top pannel) and ionselective electrode (right, bottom pannel) (B) Diagram of the complete SIET system (Modified
from Applicable Electronics, Inc. SIET Manual). (C) The final output of SIET is the
measurement of ion-specific flux magnitude and direction: influx or efflux, whether the
movement is directed to or from the tissue to the bathing medium.
Page | 56
Chapter I - Introduction
6. Aims of the thesis
This PhD project intended to contribute to the understanding of the physiological and
molecular basis of endogenous ionic currents during adult vertebrate regeneration,
and their interaction with canonical molecular pathways involved in the
regeneration. For this purpose the adult zebrafish caudal fin was used as a
regeneration model. The specific goals of this project were:
• To describe the ion composition of EC associated with the regeneration of caudal
fins along the PD axis; and to generate a spatial-temporal map of the extracellular
dynamics of particular ion species during regeneration.
• To unveil the molecular and cellular basis of the ion dynamics associated with
regeneration.
• To understand the role of specific ion transporters in the regeneration
mechanism.
• To establish a link between ion dynamics and known molecular pathways
involved in the regeneration process.
Page | 57
Chapter I - Introduction
Page | 58
Chapter II – Materials and Methods
Chapter II
Materials and
Methods
Page | 59
Chapter II – Materials and Methods
Page | 60
Chapter II – Materials and Methods
1. Animal model
1.1. Zebrafish strains and husbandry
Most experiments were performed on wild type (WT) AB strain zebrafish from the
fish facility stocks at the Instituto Gulbenkian de Ciência (IGC). Heterozygous fish
carrying the V-ATPase retrovirus-induced mutation atp6v1e1bhi577tg were first
acquired from ZIRC and then expanded by inbreeding. All fish were raised and
maintained under standard procedures (Westerfield 1995), including feeding 3 times
a day and a 14 hour light/ 10 hour dark photoperiod. For most regeneration studies,
we used 6-12 month old adult fish kept at 30°C in isolated tanks with re-circulating
water. When larval fin fold studies were required, embryos (< 72 hours post-
fertilization - hpf) and larvae up to 6 days post-fertilization (dpf) were kept at 28°C in
small petri dishes filled with a standard embryo medium (Appendix 1: A1.19). All
procedures and protocols were approved by the ethical committees of the IGC and
Faculdade de Medicina da Universidade de Lisboa (FMUL), and were in accordance
with the Portuguese legislation.
1.2. General procedures in Adult Zebrafish
1.2.1. Anaesthesia and euthanasia
Prior to manipulation, animals were anaesthetized in a petri dish, with 0.6 mM
Tricaine (3-aminobenzoic acid ethyl ester methansulfonate, Sigma-Aldrich #A5040)
diluted in the bathing water. After the experimental procedure, fish were returned to
their tanks and monitored for complete recovery. When necessary, we generated an
artificial water flow through the gills using a plastic pipette, to ease the recovery from
the anaesthesia. When animals were no longer under study, they were euthanized by
10 minute incubation in 15 mM Tricaine.
Page | 61
Chapter II – Materials and Methods
1.2.2. Caudal fin amputation and tissue collection
Anaesthetized fish were transferred to a petri dish. Caudal fins were amputated with
sterile razor blades, under a stereoscope. The amputation planes used were:
• Distal amputation: one single cut, 1-2 bone segments before the first bifurcation of
the fin rays (Fig. II.1A). Note that this is the standard amputation plane, used
throughout this work except when stated otherwise.
• Proximal amputation (defined based on its position relative to the distal
amputation plane): one single cut, 2 bone segments distal to the most posterior
scale that covers the caudal peduncle (Fig. II.1B).
• Proximal-distal (PD) amputation: Both previously described amputation planes
were used simultaneously in the same fin: the dorsal and ventral halves of the fin
were amputated at distinct planes (distal and proximal) and a third cut along the
proximodistal axis, halfway through the dorsoventral axis, completed tissue
removal (Fig. II.1C).
• Caudal peduncle amputation: one single cut, at the proximal margin of the most
lateral rays, where they meet the fin base that had musculature, endoskeleton and
scales (Shao et al 2009) (Fig. II.2).
Fish were allowed to regenerate for different periods of time before being used in
further experiments. For tissue collection, fins were re-amputated at specific time
points, 1 to 3 bone ray segments proximal to the first amputation plane. Fixation and
storing methods were according to the subsequent procedure and are described
together with each protocol.
Figure II.1 – Planes of caudal fin amputation. (A) Distal amputation. (B) Proximal
amputation. (C) Proximal-distal amputation. Red line: amputation plane. Dashed line:
segmented bone rays. Scales are represented by the grey rounded shape at the base of the fin.
Page | 62
Chapter II – Materials and Methods
Figure II.2 – Plane of caudal peduncle amputation. Red line: amputation plane.
1.3. General procedures in zebrafish embryos and larvae
Zebrafish embryos were obtained by outbreeding (for wild type, AB strain) or
inbreeding (for atp6v1e1bhi577tg/+ line) of adult fish according to standard procedures
(Westerfield 1995). For in situ hybridization experiments, 0.2 mM N-phenylthiourea
(PTU) (Sigma-Aldrich #P7629) was added to the embryo medium around 24 hpf, to
block the development of pigmentation that could interfere with the coloured
precipitate that results from the in situ hybridization experiments.
1.3.1. Embryo and larvae anaesthesia and euthanasia
Embryos and larvae were anaesthetized in 1 mM Tricaine diluted in embryo medium.
Recovery from the anaesthesia and euthanasia were as described in chapter II,
section 1.2.1.
1.3.2. Fin fold amputation
Fin fold amputation was performed with sterile razor blades in 2 dpf embryos,
immediately distal to the posterior end of the notochord, under a stereoscope.
Embryos were allowed to regenerate for different periods of time before collection
and processing.
1.3.3. Embryo and larvae collection, fixation and initial processing
Whole
animals
were
collected
with
a
sterile
plastic
pipette.
For
immunohistochemistry, they were fixed overnight at 4°C in 0.2% paraformaldehyde
Page | 63
Chapter II – Materials and Methods
(PFA) in phosphate buffered saline (PBS; pH 7.4), and stored in PBS (Appendix 1:
A1.19) at 4°C. For in situ hybridization, whole organisms were fixed overnight at 4°C
in 4% PFA in PBS, then dehydrated in an increasing methanol series and stored in
100% methanol at -20°C. Before further processing, embryo chorions were manually
removed using sterile forceps, under a stereoscope. This allows reagent penetration
during sample processing.
Page | 64
Chapter II – Materials and Methods
2. Scanning Ion-selective Electrode Technique (SIET)
SIET had never been applied to adult zebrafish before, and therefore a new setup had
to be created and adapted. This was achieved by the optimization of different
components of the SIET system described in the next sections. Then, the technique
was used to investigate the presence of ion- specific currents during regeneration of
the adult zebrafish caudal fin.
2.1. Construction of ion-selective electrodes (ISE)
2.1.1. Pulling conditions
All electrodes were pulled out of 1.5 mm diameter glass capillaries (World Precision
Instruments (WPI) #TW150-4) in a P-97 Flaming/Brown pipette puller (Sutter
Instrument, Co.). Different puller conditions (pressure, heat, pulling strength and
velocity) were used to produce several electrode shapes (tip diameter and taper
length) (Tables III.1 to III.3). We chose the pulling conditions that generated an
electrode that produced the least noise and had a spatial resolution adequate to the
study target (adult zebrafish caudal fin).
2.1.2. Silanization
The electrodes’ walls were rendered hydrophobic by silanization, to ensure that once
they were filled with a hydrophobic ionophore cocktail (LIX) (chapter II: section
2.1.3.), this solution wouldn’t leak out of the electrode into the bathing aqueous
solution. Pulled electrodes were placed vertically tip-up in a metal rack inside a petri
dish, covered with a large beaker and heated at 210°C for at least 3 hours. Then, 70 µl
silane (N,N-dimethyltrimethylsilylamine, Sigma-Aldrich #41716) were microinjected
inside the beaker, where it immediately volatilizes and adheres to electrodes. The
oven was turned off and the electrodes were allowed to cool down before storage at
room temperature in a desiccator.
Page | 65
Chapter II – Materials and Methods
2.1.3. Electrode filling
Silanized electrodes were back-filled with a 2 cm long column of an ion-specific
electrolyte using a syringe coupled to a plastic needle, and tip-filled with the
corresponding ionophore (liquid ion-specific membrane) (Table II.1) under an optical
microscope, by capillary transfer from a non-silanized electrode previously filled with
the ionophore solution. This completed the ISE construction. For each ion of interest,
the ionophore column length was optimized simultaneously with the electrode shape
(chapter II: section 2.1.1), in order to get the shortest column possible without
ionophore leakage, again to decrease electrical noise.
Table II.1 – Ion-specific electrode filling solutions
Ion
species
Ionophore
Electrolyte
Hydrogen
Hydrogen Ionophore II- cocktail A,
Sigma-Aldrich #95297-1EA
40 mM KH2PO4/
15 mM KCl, pH 6
Potassium
Potassium Ion Exchanger, WPI #IE190
100 mM KCl
Sodium
Sodium Ionophore II-cocktail A, Sigma-Aldrich #71178-1EA
100 mM NaCl
Calcium
Calcium Ionophore I-cocktail A, Sigma-Aldrich #21048-1EA
100 mM CaCl2
Chloride
Chloride Ionophore I-cocktail A, Sigma-Aldrich #24902-1EA
100 mM KCl
2.2. Completing the SIET system
To complete the SIET system, the ISE was connected to a 10x signal amplification Ion
Polarographic Head Stage (Applicable Electronics, Inc.), through a microelectrode
holder, straight (WPI #EHB1) with reversible silver/silver chloride wire previously
electrocoated with 3M KCL. A Dri-Ref2™ reference electrode (WPI) also connected to
the head stage completes the circuit. The voltage signal amplification system also
included a differential amplifier (IPA-2 ion/polarographic amplifier, Applicable
Electronics, Inc.), that amplified the electric signal by an additional 100x. The overall
1000x magnified target voltage was recorded in the computer Automated Scanning
Electrode Technique software (ASET) (Science Wares), after analog to digital (A/D)
conversion.
Page | 66
Chapter II – Materials and Methods
The vibrating electrode system was attached to a customized upright stereoscope. A
x0.75 dry objective lens was used for imaging. The stereoscope equipped with a
charge-coupled device camera allowed images to be visualized on a black and white
monitor and recorded with a frame grabber controlled by the ASET. The recording
parts were mounted on an air table for vibration isolation and enclosed in a steel
Faraday cage. All electrical equipment was grounded.
2.3. Calibration of the ISE
Calibration of the ion-selective probe had two main goals: (1) to test the ISE accuracy
and (2) to set a calibration curve that was the base for the conversion of voltage into
ion fluxes. This was all based on the Nernst equation, which establishes the
equilibrium relationship between the voltage gradient and the concentration gradient
across a selective membrane (in this case, the ionophore), for a particular ion species.
For ISE calibration, the voltage was measured in 3 standard solutions with a known
10-fold increase in the concentration of the ion under study (Table II.2). Plotting the
voltage output (mV) against the known ion concentration (mM) should yield a linear
correlation with an appropriate absolute Nernst slope: 56-58±10 mV for monovalent
ions (H+, K+, Cl-) and 27-29±5 mV for bivalent ions (Ca2+). This corresponded to a
good Nernstian response, and only the electrodes with such a slope were used for
data acquisition. The slope and intercept of the electrode calibration curve were used
after data acquisition, to convert the voltage output of the electrode into ion
concentrations (chapter II: section 2.9.).
Table II.2 – Ion-specific calibration solutions
Ion-species
I
Calibration solutions
II
III
Hydrogen
pH 8, 0.1 M KPO4
pH 7, 0.1 M KPO4
pH 6, 0.1 M KPO4
Potassium
0.1 mM KCl
1 mM KCl
10 mM KCl
Sodium
0.1 mM NaCl
1 mM NaCl
10 mM NaCl
Calcium
0.1 mM CaCl2
1 mM CaCl2
10 mM CaCl2
Chloride
0.1 mM KCl
1 mM KCl
10 mM KCl
Page | 67
Chapter II – Materials and Methods
2.4. Recording solution and anaesthesia optimization
Lin et al (2006) optimized a “recording solution” for zebrafish embryos, composed by
(mM): 0,4 NaCl; 0,2 MgSO 4 ·7H 2 O; 0,08 K 2 HPO 4 ; 0,005 KH 2 PO 4 ; 0,2 CaSO 4 · 2 H 2 O;
pH=6,8. To verify if this medium was suitable for adults, 5 fish were amputated and
allowed to regenerate for 2 weeks in that recording solution, in isolated tanks at 28°C.
A control group was treated the same way but maintained in normal “fish water”.
Thereafter, the recording solution (Lin et al 2006) was adapted to each target ion-
species by testing different ionic concentrations until there was good electrical signal
and low noise. The anaesthetic Tricaine was added prior to SIET measurements. For
that, Tricaine concentration was optimized, so that fish would keep immobilized for
the longest period of time, without compromising survival (Table III.4). Three fish
were anaesthetized under one of three Tricaine concentrations (0.3, 0.45, 0.6 mM).
Then, we monitored the following parameters: (1) time to fall into deep anaesthesia,
(2) survival time under anaesthesia (3) recovery after Tricaine removal. A similar
approach was used to optimize two alternative sedation methods that were used to
titrate any effect of Tricaine on the results: BTS (N-benzyl-p-toluenesulfonamide,
Sigma-Aldrich #S949760) (Cheung et al 2002) and cold-shock (10 °C). During SIET
experiments, the ion-specific recording medium enriched with Tricaine was replaced
with a fresh solution every two hours.
2.5. Recording chamber optimization
Several setups were designed and tested. We selected the chamber that minimized
the influence of fish opercula movement on the ionic fluxes established in the
aqueous medium perturbation, and thus reduce the influence of fish movement on
data acquisition.
2.6. Artificial Source
All parameters that required optimization needed to be tested individually, under a
SIET assay with a predictable and reproducible result. For that, we replaced the
caudal fin with an artificial source of the ion of interest, made out of glass capillaries
Page | 68
Chapter II – Materials and Methods
filled with a 1% (p/v) agarose/specific ion-rich solution compared to the bathing
solution (Table II.3), and measured the flux. Because the artificial source had a known
ionic concentration that was higher than the recording media, it was possible to
predict what the measured flux should be if the parameters under optimization were
appropriate (a strong efflux should be detected), therefore confirming the system
accuracy. Parameters analyzed in this way included the ISEs and the recording media.
Table II.3 – Ion-specific artificial source solutions
Ionspecies
Ion-rich solution for
artificial source
Hydrogen
pH 3, 0.1 M KPO 4
Potassium
1 M KCl
Sodium
1 M NaCl
Calcium
1 M CaCl 2
Chloride
1 M KCl
2.7. Data acquisition and analysis
For data acquisition, fish were anaesthetized in the recording solution and
immobilized in the previously optimized recording chamber. The ISE was positioned
in frame with the caudal fin through the ASET controlled 3D stepper motors (CMC-4)
(Applicable Electronics, Inc.) that are connected to the headstage. The same motion
control system was used to move the ISE during data acquisition, between one
position closer to the caudal fin tissue and another 50-70 µm farther away, in a
“move, wait and measure” routine defined in the ASET sampling rules according to
the target ion (Appendix 1: A1.1). A background (reference) measurement was taken
far away (5 cm) from the fish at the beginning and end of each experiment to account
for the background noise. Positioning and data acquisition was monitored through a
camera-connected monitor. The electrical signal measured at each end of the
sampling routine was recorded in the ASET. That signal is proportional to the
concentration of the specific ion species under study, and was transformed into fluxes
(concentration per area and per time unit) using the Nernst equation and Fick’s law
of diffusion: J = Cu(dc/dx) where C is the ion concentration in the solution (calculated
using Nernst equation with ISE calibration values, chapter II: section 2.3.); u is the ion
Page | 69
Chapter II – Materials and Methods
mobility; and dc is the concentration difference over distance dx (Smith et al 1999,
Reid and Zhao 2011).
Using this approach, we measured ion-specific voltage at the 3rd, 4th and 5th dorsal
and ventral rays and corresponding inter-ray regions of 5 AB WT caudal fins
previously amputated at the distal amputation plane. The main regeneration stages
(0.08 hours post-amputation (hpa) – wound healing, 24 hpa – blastema formation, 48
hpa – blastema maturation, 72 hpa – regenerative outgrowth) were screened for
proton (H+), potassium (K+), sodium (Na+), calcium (Ca2+) and chloride (Cl-) fluxes.
For additional H+ flux screening, 8-10 caudal fins were amputated at the PD plane
(chapter II: section 1.2.2. and Fig. II.1C), and flux recording was performed at
additional regeneration time points. One-way ANOVA and post-hoc Tukey HSD test
were used to compare H+ flux at all regeneration stages screened, paired T-test was
used for comparisons within each time point at the ray level and independent T-test
to compare ray- inter-ray fluxes.
Page | 70
Chapter II – Materials and Methods
3. Microarray
Caudal fins amputated at the distal amputation plane were collected at 3, 24, 48 or 96
hpa. Uncut caudal fins (0 hpa) were also collected and used as a control. Two
replicates were used per time point, each consisting of three fins. Total RNA was
isolated using RNeasy Mini Kit (Qiagen). The quality and quantity of the RNA was
determined using the 2100 Bioanalyzer and RNA 6000 Nano LabChipreg (Agilent
Technologies, Palo Alto, CA), following manufacturer’s instructions. Further RNA
processing and microarray analysis were conducted by the Gene Expression Unit at
the Instituto Gulbenkian de Ciência. Briefly, 100 ng of total RNA from each sample
were used to generate biotinylated and fragmented complementary RNA (cRNA)
using the Two-Cycle Target Labelling kit (Affymetrix, Santa Clara, CA). Then, 10 µg of
cRNA from each sample were hybridized to Affymetrix GeneChip Zebrafish Genome
Arrays (Affymetrix, Santa Clara, CA, USA). Arrays were scanned with an Affymetrix
scanner 3000. All procedures followed the manufacturers’ instructions. Scanned
arrays were analyzed first with GCOS 1.4 software to obtain Absent/Present calls and
for subsequent analysis with dChip 2010 (http://www.dchip.org). The arrays were
normalized to a baseline array with median CEL intensity by applying an Invariant Set
Normalization Method (Li et al 2001). Normalized CEL intensities of the ten arrays
were used to obtain model-based gene expression indices based on a PM (Perfect
Match)-only model. All genes compared were considered to be differentially
expressed if the 90% lower confidence bound of the fold change between experiment
and baseline was above 1.2 in both replicate datasets and if the transcript had at least
one Present Call per replicate. Validation of the microarray included comparisons
with published datasets and quantitative PCR. For gene annotation, we considered
the sequence similarity to known mammalian proteins, determined by BLAST search
of each Affymetrix probe set against the UniGene database, the “nonredundant” NCBI
database, and the “monthly” NCBI database.
Page | 71
Chapter II – Materials and Methods
4. Quantitative real-time PCR (qRT-PCR)
Total RNA was extracted from fin regenerates using TRIzol® reagent (Invitrogen
#15596-026) according to the manufacturer’s protocol. 10 fins amputated at the
distal plane were used to extract RNA for each of the following time points: 0 hpa
(uncut fin tissue, used as control), 24, 48 and 72 hpa. First-strand cDNA was
synthesized from 1 µg of RNA from each sample using the RevertAid™ H Minus First
Strand cDNA Synthesis Kit (Fermentas #K1631) with Random Primer p(dN) 6 .
Primers for quantitative real-time-PCR (qRT-PCR) are in Table II.4. qRT-PCR was
performed in an Applied Biosystems 7900HT Fast Real-Time PCR System with 384-
Well Block Module (7900HT Fast System), using the SYBR Green labelling system.
Samples were run in triplicates. Detailed reaction and cycling conditions are
described in Appendix 1: A1.2. No template control (NTC) reactions, which lacked
cDNA, were used to confirm absence contamination or primer-dimer. The specificity
of the reactions was confirmed using melting curve analysis. fgf20a and atp6v1e1b
levels were normalized to the housekeeping gene ef1a. Quantification of the relative
expression was performed using the relative standard curve method. Standard curves
were constructed based on six 1:5 serial dilutions of a 100 pmol/µl (0.1mM) cDNA
solution. Target quantity in each experimental sample was determined by
interpolation from the standard curve and normalization against the target quantity
of the calibrator sample (uncut fins). The calibrator, then, becomes the 1x sample, and
all other quantities are expressed as an n-fold difference relative to the calibrator.
Table II.4 – Sequence-specific primers for quantitative real-time PCR
Gene
Sequence specific Primers (5' - 3')
atp6v1e1b Fw: AGGTCCTGAAGGCCAGAGAT
Rv: AACCAGTCCGTCCATCAGAG
ef1α
Fw: ACGCCCTCCTGGCTTTCACCC
Rv: TGGGACGAAGGCAACACTGGC
fgf20a
Fw: CGTGGTGTGGATAGCGGATTG
Rv: GCCATGCCGATACAGGTTAGAAG
Page | 72
Melting TºC
59.4
59.4
65.7
63.7
61.8
62.4
Chapter II – Materials and Methods
5. Whole mount in situ hybridization
This technique allows the detection of specific mRNAs in a tissue or organism of
interest. Briefly, the mRNA hybridizes with a complementary strand produced in vitro
(antisense probe). The probe nucleotides are labelled with specific epitopes that are
then recognized by high-affinity antibodies. The antibodies are conjugated with
enzymes that generate a coloured precipitate when exposed to a certain substrate.
Thus, mRNA location and semi-quantification are detected by the differential
accumulation of the precipitate in the tissues under study, according to the level of
mRNA expression.
5.1. Cloning of gene specific DNA sequences
Probes for atp6v1e1b, atp6v1a, atp6ap2, pICln, all slc9a family genes, wnt5a, wnt10b,
aldh1a2, cyp26a2, fgf20a and osx were obtained by cloning of gene fragments as
described in the next sections.
5.1.1. Isolation and recombination of DNA sequences for the genes of interest
Total RNA was extracted from 1 to 3 dpf zebrafish embryos using TRIzol® reagent
(Invitrogen #15596-026) according to the manufacturer’s instructions. The RNA was
used to synthesize cDNA with the RevertAid™ H Minus First Strand cDNA Synthesis
Kit (Fermentas #K1631) using Random Primer p(dN) 6 . For each gene of interest
sequence-specific primers were designed (Table II.5) and used to generate gene
specific partial sequences, by amplification of the cDNA in a polymerase chain
reaction (PCR) (Appendix 1: A1.3). The PCR products were extracted from a 0.8%
agarose gel after electrophoresis and purified with the QIAquick® gel extraction kit
(Qiagen #28704). All DNA fragments except for atp6v1e1b were ligated into the
multiple cloning site (MCS) of pGEM®-T Easy plasmid vector (Promega #A1360,
Appendix 2: A2.1) according to the manufacturer. The MCS is flanked by phage
promoters (SP6 and T7) that can be used to produce RNA in vitro. For atp6v1e1b, the
Page | 73
Chapter II – Materials and Methods
Table II.5 – Sequence-specific primers for amplification of the genes of interest
Gene
Sequence specific Primers (5' - 3')
Annealing
Gene
TºC used fragment
for PCR size (bp)
atp6v1a
Fw: GGCAACCATCCAGGTGTATGAGG
Rv: CAGCCACAGGCATGTTTGAGG
59
782
atp6ap2
Fw: CCTGGTCATGTGACTGGTGTTGC
Rv: GAGACAGACGTCCACGAATCTGC
59
547
58
673
atp6v1e1b Fw: CTCGAGCGACGTCCAGAAACAGATCAAGC
Rv: CGAATTCCCATGAACTTGCGGTTCTGGTTCG
pICln
Fw: GCTGTCCTGGTTTGATGGATCAGGG
Rv: GGTGTAGAAGGAGGGAATGTCACCG
56
424
slc9a7
Fw: CCTTCGAGAAATCCACAGTGTGG
Rv: GCTGAAGATGCCTATGAAGACGC
58
517
slc9a1
Fw: CGTTCACCTCGCGCTTCACG
Rv: AACAGGTCGACGAGTGGCCG
58
568
slc9a2
Fw: AGAACCTCCTGTTCGCCGCC
Rv: AGCCCCAGTTCCACTCGTGC
59
563
slc9a3a
Fw: GCTGAGGGCAGCTTTCCTGG
Rv: CAGGATGATCTGAGGCAGCAGG
58
358
slc9a3b
Fw: GGTCTCCGGTGCATTACATGAGGC
Rv: CTTTGTCTGCTCCCCAGACGATTCC
58
329
slc9a5
Fw: GGATGGAGAGTCTTCTCACCACC
Rv: CCACAGCTGAGATCAGAGCTCC
59
488
slc9a6a
Fw: GGTTTCTGCACGAGACTGGACTGG
Rv: CCAGAACTGTCACTGGATCAGTGGC
59
516
slc9a6b
Fw: GCGATTTGGTGTCCATTCGCC
Rv: GACAGGACGATAGCCACAGCG
58
549
slc9a8
Fw: GCTGATGGACACGCTGAACAGC
Rv: GCAGAGATCAGAGAGCCGAACG
58
596
wnt5b
Fw: GGACACCTACTTCTGGCAGTGACC
Rv: CGAAGCGGTAGCCATAGTTGACG
59
505
wnt10a
Fw: GGACCGATCTTCTCCTCAGACAGG
Rv: GAAGTGCTCCATCACACCGTGC
59
602
aldh1a2
Fw: GGCTGATCTGGTGGAGAGAGACAG
Rv: GAACCAGCAGTGCAGCATTGACC
59
645
cyp26a2
Fw: CCGTTCATTGGAGAAACGCTCC
Rv: GCACCACTTCTGTGTTCAGACC
59
805
fgf20a
Fw: GCTTCTCTCACGGCTTGGAGAGC
Rv: GCTCAGGAACTCGCTCTGGATCC
59
570
osx
Fw: GCTATGCTAACTGCGACCTGC
Rv: GATTGAGCGATGCTTGAGGAGCC
59
544
Page | 74
Chapter II – Materials and Methods
PCR product was ligated into the MCS of pBluescript® II KS+ (Appendix 1: A1.5,
Appendix 2: A2.2). For that, the vector was previously digested with EcoRI and XhoI
restriction enzymes and dephosphorylated (Appendix 1: A1.4) to prevent it from
becoming circular again.
5.1.2. Transformation and clone selection
The recombinant plasmid DNA was delivered into DH5α competent E. coli (Invitrogen
#18265-017) by heat-shock (Appendix 1: A1.6). Only successfully transformed cells
were able to grow in 5% ampicillin/LB/agar plates. Five colonies were randomly
selected and tested for the correct clone: to increase the amount of clones, and
therefore the amount of recombinant DNA, each colony was separately incubated for
16 h at 37°C in liquid LB (Appendix 1: A1.19) with 5% ampicillin. The plasmid DNA
was extracted using the Wizard® Plus SV Minipreps DNA Purification System
(Promega #A1460) and subjected to a restriction analysis (Appendix 1: A1.7). Briefly,
the plasmid was digested with appropriate enzymes that cut the DNA on both sides of
the insert (Table II.5). If the DNA of interest was successfully cloned, it would be
released and observed as a separate band of a specific size (Table II.5) on an agarose
gel, after electrophoresis. Positive clones were sequenced in the 3130xl Genetic
Analyzer® (Applied Biosystems #3130XL) using BigDye® Terminator v1.1 Cycle
Sequencing kit’s (Applied Biosystems #4337449) protocol (Appendix 1: A1.8).
Sequence homology to the target gene and insert’s orientation on the plasmid were
confirmed by comparison to the reference sequences of the genes of interest available
at
the
National
Center
for
Biotechnology
Information
(NCBI)
(http://www.ncbi.nlm.nih.gov), using the online alignment tool (BLAST).
website
5.2. Recombinant DNA amplification
The clone with the best homology to the sequence of interest was transformed in
DH5α competent E. coli (Appendix 1: A1.6), using 1 μL DNA. It was then extracted
using the QIAfilter Plasmid Midi kit (Qiagen #12243), and stored at -20°C.
Page | 75
Chapter II – Materials and Methods
5.3. Plasmid linearization and in vitro RNA probe transcription
The multiple cloning site (MCS) of pGEM®-T Easy and pBluescript® II KS+, where the
PCR products were inserted, is flanked by T7 and SP6 promoters and T7 and T3
promoters, respectively. Those promoters have opposite orientations, recognized by
RNA polymerase T7 and SP6, or T7 and T3, respectively. For in vitro RNA probe
production, the vectors were linearized with one appropriate restriction enzyme
from the vector’s MCS (one that would cut the plasmid once, and wouldn’t cut the
inserted PCR product) in one of the flanking sides of the insert, and transcribed with
the RNA polymerase from the opposite end of the insert (Table II.6), using
digoxigenin- labelled nucleotides. As a result, we obtained 2 digoxigenin-labelled
probes per gene of interest: (i) an antisense probe, complementary to the mRNA of
interest; (ii) a sense probe, with the same sequence than the target mRNA, used as a
negative control. Probes were stored at -20°C. Detailed protocols are in Appendix 1:
A1.8 and A1.9.
Table II.6 – Enzymes used to produce in vitro RNA probes from recombinant DNA
Gene
Plasmid vector
aldh1a2
cyp26a2
osx
atp6ap2
SacII
SpeI
SP6
T7
AS
S
pGEM -T Easy
atp6v1a
wnt5b
wnt10a
SpeI
SacII
T7
SP6
AS
S
pGEM -T Easy
NcoI
SpeI
SP6
T7
AS
S
pGEM -T Easy
pICln
slc9a7
SpeI
NcoI
T7
SP6
AS
S
pGEM -T Easy
atp6v1e1b
XhoI
EcoRI
T7
T3
AS
S
pBluescript II KS+)
fgf20a
slc9a1
slc9a2
slc9a3a
slc9a3b
slc9a5
slc9a6a
slc9a6b
slc9a8
Page | 76
Restriction
RNA
Probe
enzyme
polymerase orientation
®
®
®
®
®
Chapter II – Materials and Methods
5.4. In situ hybridization protocols for caudal fin and whole embryos
After collection, caudal fins and whole embryos were fixed in 4% PFA in PBS buffer
(Appendix 1: A1.19) overnight at 4°C, dehydrated in an increasing concentration
series of Methanol in PBT (PBS with 0.1% Tween-20), and stored in 100% methanol
at -20°C, for at least 24 hours before beginning the in situ hybridization. Detailed
protocols are in Appendix 1: A1.11 and A1.12, respectively. Briefly, rehydrated
samples were digested with proteinase K to open pores in the cells’ membranes. This
made the mRNA more accessible to the overnight hybridization with an antisense
digoxigenin-labelled probe. Specific labelling was controlled using sense RNA probes.
The following day, non-specific bound probe was removed through several washes
and the samples were incubated overnight with an anti-digoxigenin antibody
conjugated with alkaline phosphatase. Day 3 started with several washes to remove
the non-specific bound antibody. Then, tissues were incubated in BM Purple
substrate, to stimulate alkaline phosphatase reaction that results in a coloured
precipitate. After fully developing, the reaction was stopped in PBT. In fins amputated
at the PD plane the final precipitation reaction was allowed to develop until full
staining of the proximal regenerate, regardless the level of staining at the distal
amputation plane. For each gene and time points analysed, the protocol was repeated
at least twice, using 3 or more fins per assay. Photographs were taken on a Leica Z6
APO stereoscope equipped with a Leica DFC 320 colour camera. Samples were stored
in 1% Azide in PBT at 4°C.
Page | 77
Chapter II – Materials and Methods
6. Whole mount immunohistochemistry
This technique is used to detect target proteins in the tissues or organisms of interest,
based on the property of antibody binding to specific antigens of interest. Caudal fins
and whole embryos and larvae were collected as described (chapter II: sections 1.2.2.
and 1.3.1.) and fixed overnight in the appropriate fixative (Table II.7), to avoid the
epitope chemical masking by the fixative, which would prevent antibody binding.
When using rhodamin-phalloidin (Invitrogen R415), samples were processed
immediately after fixation, since dehydration with an alcohol would prevent the toxin
signal. Detailed protocols are in Appendix 1: A1.13 and A1.14. Briefly, tissues were
rehydrated when necessary, permeabilized with acetone (or Triton-X if using
rhodamin-phalloidin) and incubated overnight with the primary antibodies (Ab) that
bound the target antigens under study. On day 2, the non-specifically bound primary
Ab were removed by several washes and tissues were incubated overnight with
adequate ALEXA-conjugated (Invitrogen™) secondary Ab (Appendix 1: A1.15), to
allow binding to the 1ary Ab. When using rhodamin-phalloidin, it was added together
with the secondary Ab. The next day, non-specific bound secondary Ab was washed
out and DNA staining was carried out by DAPI or TO-PRO III® (Invitrogen™)
incubation for 10 or 15 minutes, respectively, to aid in the determination of the
cellular location of the target antigen. Finally, by laser excitation under a confocal
microscope (Zeiss LSM710), we were able to detect the presence and location of the
target protein(s) by the fluorescence of the secondary Ab, as well as other labelled
molecules. For each antigen and regeneration time point analysed, the protocol was
repeated at least twice, using 3 or more fins per assay.
6.1 Cell proliferation assay
Proliferating cells were detected by whole mount immunohistochemistry in fins from
atp6v1e1bhi577aTg/+ fish, using anti-Phospho-Histone-3 (H3P) antibody. The number of
H3P cells was counted in a 160 µm2 area of the regenerating mesenchyme and of the
mesenchyme immediately below the amputation plane. We used three-dimensional
Page | 78
Chapter II – Materials and Methods
projections of confocal images through the mid 20 µm of the mesenchymal depth, and
pan-cadherin to exclude epithelial cells. Statistical analysis was performed using
paired T-test.
Table II.7 – Primary antibodies. Italic indicates antibodies that did not react with zebrafish
Antigen
Fixative
Dilution
Produced
in
Target
Company - ref
ATP6V1A
0.2% PFA
1:200
Rabbit
Mouse
ATP6V1E1
-
-
Rabbit
Human
SLC9A7
-
-
Rabbit
Human
Genscript A00938
Santa Cruz sc20946
Lifespan
Biosciences LSC40446
PhosphoHistone-3
4% PFA
1:200
Rabbit
Mouse
Caspase-3
Dent's
1: 600
Rabbit
Human
pICLn
Dent's
1:200
Goat
Pan-cadherin
Dent's
1:200
Mouse
Millipore 06-570
Abcam ab13847
Santa Cruz scHuman
22127
Abcam ab6528-100
Page | 79
Chapter II – Materials and Methods
7. Histological techniques
7.1. Cryopreservation and sectioning
Freshly collected tissues were fixed in 4% PFA/PBS for 2h at 4°C. All samples were
incubated on 15% sucrose in PBS overnight at 4°C. They were then embedded in 15%
gelatin prepared in the previous sucrose solution, for 1 hour at 37°C, and transferred
together with the gelatin to cryomolds. Once samples orientation was adjusted, they
were fast-frozen in isopropanol pre-cooled in dry ice, and stored at -80°C. 12 µm-
thick sections were made on a Leica Cryostat and processed for histological staining.
Tissues previously stained by whole mount in situ hybridization were sliced into 18
µm sections, mounted in Aquatex® and photographed under Leica DM5500
microscope attached to a colour camera.
7.2. Hematoxylin-Eosin staining
Hematoxylin-Eosin staining (H-E) is a histological staining that gives an overview of
the tissue structure and facilitates the distinction between cell types. It is based on
the differential staining of nucleus, which stain blue upon hematoxylin treatment, and
cytosolic and extracellular proteins, which stain in different tones of pink and red
after incubation with eosin.
Sections were made as described in chapter II: section 7.1. Gelatin was removed by
incubation in PBS at 37 °C for 5-10 minutes. Slides were washed in distilled water for
5 minutes and stained with Hematoxylin solution, Harris modified (Sigma-Aldrich
#HHS128) for 8 minutes. They were then rinsed in tap water, nuclear staining was
differentiated though 3consecutive dips in 0.5 % chloridric acid prepared in 70%
ethanol, and slides were washed in warm running tap water for 8 minutes. For
protein staining, samples were placed in 95% ethanol for 2 minutes, incutated with
Eosin Y solution, alcoholic (Sigma-Aldrich #HT110132) for 2 minutes and dehydrated
in 100% ethanol (2x 2 minutes). They were cleared in xilol for 5 minutes and
mounted in GLCTM Mounting Medium (Sakura, cat nº1408).
Page | 80
Chapter II – Materials and Methods
8. In vivo manipulation techniques
8.1. Microinjection
Microinjection was used to deliver different inhibitors of a specific ion transporter of
interest, the V-ATPase, directly into zebrafish embryos (Rosen et al 2009) and adult
regenerating caudal fins (Thummel et al 2006, Hyde et al 2012). We used a Narishige
IM 300 injector and needles pulled out of glass capillaries (WPI #1B100-6) in a P-97
Flaming/Brown pipette puller (Sutter Instrument, Co.). The volume of solution to
inject was approximately 1.4 nL per embryo and 70 nL per fin ray or blastema. Onecell stage embryos were microinjected directly into the yolk cell (Appendix 1: A1.16).
For microinjection of adult caudal fin (Appendix 1: A1.17), fish were amputated at
either the distal or proximal level; microinjections performed up to 6 hpa directly
targeted the inside of the wounded edge of each fin ray; at later stages of
regeneration, delivery was made into each ray blastema.
8.2. Electroporation
Electroporation of the caudal fin (Appendix 1: A1.18) was performed immediately
after microinjection, to open pores in the cells membrane that facilitated the entry of
the injected molecules. The technique was adapted from Thummel et al 2006 and
Hyde et al 2012. The whole fin was electroporated, using a 10 mm diameter flat platin
electrode (CUY650P10, Sonidel™ Limited) connected to an Electro Square Porator,
ECM 830 (BTX®) electroporator. Pulse conditions were as follow: 10 consecutive 50
milisecond pulses of 25V, with a 1 second pause between every two pulses.
8.3. Dose-response curves for ion transporter inhibitors
Before applying any experimental molecule to adult fish, we built a dose-response
curve using embryos. Besides allowing the evaluation of the toxicity of the
compounds under test, this allowed the assessment of their specificity, by comparing
Page | 81
Chapter II – Materials and Methods
the embryos phenotype with our embryo lethal V-ATPase mutant embryos. For
Concanamycin A dose-response-curve, AB WT embryos from the same batch were
incubated from fertilization until 3 dpf in a different drug concentration (10, 50, 100,
250 and 500 nM) or in the corresponding solvent concentration (Dimethyl sulfoxide
(DMSO) 0.01, 0.05, 0.1, 0.25 and 0.5%, respectively) to control its effect. A sample was
left untreated to account for the intrinsic quality of the laying. All solutions were
completely renewed daily. For morpholinos (MOs) dose-response-curve, a similar
experimental design was used, except that embryos were microinjected with the MO
concentrations under test (0.25, 0.5 and 1 mM) or the corresponding control MO.
Again, a control group of embryos was not subjected to any treatment. 50 embryos
were used per experimental treatment. The number of normal, dead and abnormal or
morphant embryos was counted at 1, 2 and 3 dpf. Photographs were taken at the
same time points, under a Zeiss SteREO Lumar.V12 stereoscope.
8.4. Pharmacological inhibition of V-ATPase activity in regenerating
caudal fins
We used Concanamycin A (concA) to inhibit the V-ATPase activity in regenerating
caudal fins of AB WT fish. The drug was dissolved in 100% DMSO to a 100 µM stock
solution and diluted in Danieau medium (mM: 58 NaCl, 0.7 KCl, 0.4 MgSO 4 *7H 2 O, 0.6
Ca(NO 3 ) 2 , 5.0 Hepes, pH 7.6) to working concentrations (100 nM, 500 nM, and 1 µM
ConcA). Fins were amputated at the distal level. ConcA was microinjected into one
half of the caudal fin every 12 h between 6-42 hpa to account for the dilution effect on
the drug availability, and the other half received the corresponding control at the
same time points. The same number of fish (3-4) received the inhibitory molecule at
the dorsal and ventral part. Photographs were taken at 24, 48 and 72 hpa. The area of
regenerating tissue after each treatment (concA and DMSO control) was compared
with a paired T-test. Results were plotted as the difference (%) between the concA
and control regenerate areas.
Page | 82
Chapter II – Materials and Methods
8.5. Morpholino-mediated knockdown of V-ATPase subunit in the caudal
fin
Morpholino antisense oligonucleotides (MO) are small synthetic oligonucleotides
(around 25 nucleotides long) designed to bind specifically to complementary RNA
sequences. In such way, they interfere with gene expression in a predictable fashion
that includes blocking translation, modifying splicing and inhibiting miRNA activity
and viral replication (Eisen and Smith 2008, Moulton and Jiang 2009, Gene Tools LLC
site). All morpholinos tested were designed by Gene Tools, LLC and intended to block
translation of the V-ATPase cytosolic subunit atp6v1e1b, by binding to the AUG
translational start site (Table II.8). Upon arrival they were dissolved and stored
according to the manufacturer’s guidelines. The three atp6v1e1b fluorescein-tagged
MOs (fluo-MO-1, 2 and 3) and the corresponding control mismatches fluoresceintagged MOs (cfluo-MO-1, 2 and 3, modified MO sequence with no biological target)
were delivered to the regenerating caudal fin of AB WT fish as a 1 mM solution
(Thummel et al 2006, Bill et al 2009, Hyde et al 2012). We used the experimental
design described in the previous section 8.4., except that fluo-MOs were only
delivered once, at 2 hpa or 16 hpa, and microinjection was immediately followed by
electroporation.
Vivo-morpholinos (vivo-MO) are the most recent MO technology. Each one comprises
a MO oligo with a unique covalently linked delivery moiety, which allows it to enter to
cells without need of electroporation, opposite to fluo-MOs (Morcos et al 2008). We
used a atp6v1e1b vivo-MO with the same oligo sequence than fluo-MO-1 (which we
identified as the most efficient atp6v1e1b fluo-MO), as well as the corresponding
control vivo-MO (cvivo-MO) (Table II.8). They were delivered at 0.5 mM by
microinjection into 6-8 regenerating caudal fins of AB wild type or atp6v1e1bhi577tg/+
(AB) fish. We first confirmed that generic vivo-MO injection did not produce non-
specific effects on regeneration. For that, the cvivo-MO was injected into the rays of
the dorsal part of the fin, at 2 or 16 hours after proximal or distal amputation, and the
ventral portion of the fin was left untreated to account for natural regeneration
defects. Only after this test, we injected the atp6v1e1b- specific vivo-MO. The
experimental design was similar to the described for concanamycin A delivery.
Briefly, each caudal fin was amputated at either distal or proximal plane;
Page | 83
Chapter II – Materials and Methods
microinjection of the atp6v1e1b vivo-MO or cvivo-MO was done at 2 hpa or 16 hpa, in
opposite halves of the fin rays (dorsal and ventral). Photographs were taken at 24, 48
and 72 hpa. For those time points, the area of regenerated tissue after either vivo-MO
and cvivo-MO treatment was measured and used to calculate the percentage (%) of
regenerated area upon V-ATPase subunit knockdown compared to the control region
of the same fin. Statistical significance of the atp6v1e1b vivo-MO effect on
regeneration was assessed by comparing the regenerated area upon vivo-MO and
cvivo-MO injection, through a paired t-test.
Table II.8 – Sequences of the morpholinos used
Morpholino Target mRNA
fluo-MO-1
fluo-MO-2
Sequence (5' to 3')
TCG GCA TCG CTG AGC GCC A
zatp6v1e1b
TCG GCA TCG CTG AGC GCC ATG ACT G
fluo-MO-3
TGC AGA TCC TGC TCC TGC TGC TTT A
cfluo-MO-1
TCc GCA TgG CTG AcC GCg A
cfluo-MO-2
MO type
no target
cfluo-MO-3
TCc GCA TgG CTG AcC GCg ATG AgT G
Fluoresceintagged
Fluoresceintagged
TGg AcA TCg TGC TgC TcC TGC TTT A
vivo-MO
zatp6v1e1b
cvivo-MO
no target
TCG GCA TCG CTG AGC GCC A
CCT CTT ACC TCA GTT ACA ATT TTA TA
vivomorpholino
8.6. Fin fold regeneration
Mutant fish lacking atp6v1e1b were obtained by incross of atp6v1e1bhi577tg/+(AB)
adults. The fin fold of 15 AB WT and 15 atp6v1e1bhi577tg/- mutant larvae was
amputated at 2 days post amputation (dpa). At 5 dpa the regenerated area was
measured and compared to the area of non-amputated larvae of the same genotype,
with an independent T-test. The two fish lines couldn’t be compared directly due to
genotype- specific morphometric diferences. We also looked for phenotypic defects
by visual inspection. Independent t-test was used to score statistical significance.
Page | 84
Chapter II – Materials and Methods
9. Microscopy techniques
9.1. Scanning electron microscopy
Caudal fins amputated at either distal or proximal amputation plane were collected at
1, 3, 6 or 12 hpa. Uncut caudal fins were also collected and used as a control. Tissues
were immediately fixed in 2.5% glutaraldehyde/0.2 M sodium cacodilate buffer for 4
hours at 4°C, followed by several washes in 0.2 M sodium cacodilate buffer. Samples
were dehydrated in an increasing concentration series of acetone solutions until
100%. Critical point was then performed on a Bal-Tec CPD 030 Critical Point Dryer
and sputtering was done for 4 minutes on a Bal-Tec SCD 005 Sputter Coater, under
standard protocols. Imaging was done on a FEI Quanta 3D FEG focused ion
beam/scanning electron microscope.
9.2. Microscopy and image analysis
For in situ hybridization and in vivo manipulation protocols, images were obtained
with a Leica Z6APO stereomicroscope equipped with a Leica DFC320 colour camera.
Immunohistochemical stainingss were imaged on a Zeiss LSM 710 confocal
microscope. The software ImageJ was used to analyze the Z stacks, and to measure fin
regenerate area and blastema length. All statistical analyses were done on SPSS 16.0
software.
Page | 85
Chapter II – Materials and Methods
Page | 86
Chapter III - Results
Chapter III
Results
Page | 87
Chapter III - Results
Part of the results of this thesis were published in an international, peerreviewed publication (Appendix 4): Monteiro J, Aires R, Becker JD, Jacinto A, Certal
AC, Rodríguez-Léon J. (2014) V-ATPase Proton Pumping Activity Is Required for
Adult
Zebrafish
Appendage
doi:10.1371/journal.pone.0092594
Page | 88
Regeneration.
PLoS
ONE
9(3):
e92594.
Chapter III - Results
Contribution of the candidate to the results described in chapter III:
1. Optimization of the Scanning Ion-selective Electrode Technique
Joana Monteiro optimized SIET, including optimization of the ISEs, recording media,
recording chamber and the artificial source recordings. Fernando Ferreira optimized
the Cl- and Na+ -selective electrodes.
Part 2. Ion-specific fluxes during adult zebrafish caudal fin regeneration
Joana Monteiro performed the ion-specific flux recordings and the data analysis for
H+, K+ and Ca2+, and the description of the ion-specific composition of electric
currents during regeneration. Joana Monteiro and Fernando Ferreira performed the
Cl- and Na+ -specific flux profiling.
Part 3. Molecular source of proton efflux during regeneration of the adult
zebrafish caudal fin
Joana Monteiro performed the qRT-PCR assays, and the in situ hybridizations and
immunostainings regarding the regenerating caudal fin. Joana also performed the
functional experiments using ConcA and morpholinos. Joana Monteiro, Ana Catarina
Certal and Jörg D. Becker performed the transcriptomic analysis of the regenerating
caudal fin. Rita Aires described V-ATPase expression pattern during zebrafish
embryonic development and participated in the morpholino injections.
Part 4. Roles of V-ATPase and H+ efflux in the regenerative process
Joana Monteiro performed the SIET flux recordings, morpholinos delivery, in situ
hybridization and immunostaining experiments, Hematoxylin-Eosin stainings. Rita
Aires and Joana Monteiro produced the antisense probes used for in situ
hybridization for several genes of interest. Joana Monteiro, Ana Catarina Certal and
Joaquín Léon performed the scanning electron microscopy analysis.
Experiments thoughout the thesis were designed by Joana Monteiro, Ana Catarina
Certal and Joaquín Léon. Discussion of the results involved Joana Monteiro, Ana
Catarina Certal, Joaquín Léon and António Jacinto.
Page | 89
Chapter III - Results
Page | 90
Chapter III - Results
Part 1 - Optimization of the Scanning Ion-selective
Electrode Technique
To the best of our knowledge, this is the first report on the use of the Scanning IonSelective Electrode Technique (SIET) to measure ion fluxes in adult zebrafish.
Zebrafish are freshwater animals, bigger than the most usual animal models studied
with SIET, where opercula movement is intimately associated with breathing, thus
creating a continuous level of perturbation of the surrounding media. To adapt SIET
to these specific characteristics, many of its components had to be optimized, from
the electrode and recording chamber design to the measurement media and data
acquisition path details on its associated ASET software. Most of the optimization
assays had the common goal of improving electrical signal-to-noise ratio, by
decreasing the electrical noise and/or increasing the electrical signal. This is essential
for the detection of such low magnitude electric signals that could otherwise be
hidden in the background noise and pass unnoticed.
1.1. Ion-selective electrode
A big electrode tip diameter (≥ 3-4 µm), short taper length, and short ionophore
column length (≤ 50 µm) are ideal conditions to minimize electrode resistance and
electrical noise. Regarding the electrode tip diameter, tips up to 20 µm diameter can,
theoretically, be used, because that was our spatial resolution limit - the diameter of
the smallest region of the fin that we want to study (the distal end of uncut rays).
However, such a large tip becomes leaky for all of the ion-specific ionophores, even
with a long (125 µm) ionophore column (Tables III.1 and III.2). Other tested
combinations of electrode tip diameter, and taper and ionophore column length failed
to succeed, due to a poor compromise between all parameters: if the ionophore
column was too short and/or the tip diameter was too wide, the ionophore leaked
completely; on the other hand, long ionophore columns and/or thin tip diameters
increased noise (Tables III.1 and III.2).
Page | 91
Chapter III - Results
Table III.1 – Optimization of ion-selective electrodes for H+, Na+, Ca2+ and Cl- -specific
flux recordings using SIET
Ionophore
column lenght
(µm)
25
50
75
100
125
Electrode tip diameter (µm)
2-4
Ionophore
retention; Nerst
behaviour
9-11
20
Ionophore
leakage
Ionophore
Ionophore
retention; Nerst
retention; Nerst
behaviour
behaviour,
Electric noise
Ionophore
leakage
Table III.2 – Optimization of K+-selective electrodes for flux recordings using SIET
Ionophore
column lenght
(µm)
Electrode tip diameter (µm)
2-3
25
50
75
Ionophore
leakage
100
125
Ionophore
retention; Nerst
behaviour
9-10
20
Ionophore
leakage
Ionophore
leakage
The optimized ion-selective electrodes (ISE) are showed in Fig. III.1 and their detailed
characteristics are listed on Table III.3. For protons (H+), sodium (Na+), calcium (Ca2+)
and chloride (Cl-), optimized electrodes were similar. They resulted from a great
compromise between wide tips, short tapers and short ionophore columns, only
possible due to the low drift properties of the corresponding ionophores. The large
tip diameter reflected a spatial resolution adequate for this study, allowing for the
screen of ion-specific fluxes in large areas of the regions of interest (ray or inter-ray)
at a single time. For potassium (K+), different electrodes had to be designed. K+
ionophore is by nature very leaky. To strengthen its binding to the electrode walls, we
had to increase the contact area ratio, through a narrower tip and a longer taper that
widen very gradually until it reached the glass capillary diameter. Although this
Page | 92
Chapter III - Results
increased the resistance (R ± 2-4 gΩ based on Shabala et al 2006, Smith et al 1999)
and the noise, a good signal could still be detected.
Figure III.1 – Optimized ion-selective electrodes (ISE). (A) ISE for H+, Na+, Ca2+ and Cl- flux
recording. (B) ISE for K+ flux detection. (a, b) Details of the tip of the electrodes showed in A
and B, respectively (squares). Arrowheads: ionophore-filled region.
Table III.3 – Characteristics of the optimized ion-selective electrodes for SIET
application to adult zebrafish caudal fin
Tip
diameter
(µm)
Tapper
lenght
Ionophore
collumn lenght
(µm)
Puller conditions
Heat= 560; Pull= 1;
Velocity= 29; Time=250;
Pressure= 585
K
+
2-3
long
100
H
+
9-11
short
50
+
9-11
short
25
2+
9-11
short
50
-
9-11
short
25
Na
Ca
Cl
Heat= 550; Pull= 5;
Velocity= 23; Time=250;
Pressure= 600
1.2. Recording media
Any recording medium used for SIET- based ion flux detection in adult fish must
include an anaesthetic to keep fish anaesthetized during SIET experiments. The
optimal Tricaine concentration was 0.45 mM, since it allowed us to maintain fish
(n=3) immobile for 25-30 minutes, a time window long enough to perform SIET
recordings. Fish recovered in 3-6 minutes after removal from the anaesthetic
solution. Under higher doses of Tricaine, the time window that fish could be
Page | 93
Chapter III - Results
anaesthetized without compromising its survival was too short for our assay whereas
by using milder concentrations fish weren’t sufficiently quiet under a reasonable time
window (Table III.4).
Regarding the recording solution, we used a SIET medium optimized by Lin et al
(2006) as a starting point (chapter II: section 2.4). That was an “artificial” fresh water
solution that pretended to mimic local tap water used in their fish facility. We
maintained adult fish in this “artificial” fresh water for two weeks, without any signs
of stress. They swam, fed and bred normally, and importantly, they regenerated at the
same rate as fish kept in the usual bathing water (Fig. III.2). Taken that, we concluded
that this medium was a physiological bathing solution for adult zebrafish, thus it
could be used as the recording solution for SIET experiments, after the required ionspecific adjustments (Table III.5).
Table III.4 – Response of fish to different Tricaine concentrations (mM)
Tricane
Time to deep
Maximum survival
Recovery
concentration anaesthesia
time under
time
(mM)
(minutes)
anaesthesia (minutes) (minutes)
0.3
> 20
> 30
2- 4
0.45
5- 8
25- 30
3- 6
0.6
2-3
10- 15
2
Figure III.2 – Caudal fin regeneration rate under different fish bathing solutions. Fish
regenerated at the same rate in the normal bathing water and in the “artificial” fresh water,
used as basic recording medium for SIET experiments.
Page | 94
Chapter III - Results
Table III.5 – Optimized recording medium for each ion species investigated with SIET
+
+
+
-
2+
H
(μM)
K , Na , Cl
(μM)
Ca
(μM)
NaCl
MgSO4·7H2O
K2HPO4
KH2PO4
CaSO4·2H2O
MOPS
Tricaine
400
200
80
5
200
450
400
200
80
5
200
600
450
400
25
80
5
50
600
450
pH
6,8
6,8
6,8
For the detection of K+, Na+, Ca2+ and Cl- fluxes, we prevented pH change of the
recording solution over time by adding MOPS, a biological buffer at near neutral pH.
As a result, we obtained more stable ion flux detections than without the buffer. For
K+, Na+, Cl- , no further changes were made to the initial recording solution, since the
concentration of these ions was low enough to attain a sufficiently good signal-to-
noise ratio during flux measurements. However, to get a good Ca2+ signal, we had to
decrease its background concentration (concentration in the recording solution) to a
quarter. The amount of magnesium (Mg2+) was lowered to half the concentration of
Ca2+, to avoid interference with the Ca2+ signal, since both ions have similar size and
chemical reactivity, and consequently Ca2+ ionophore is partially permeable to Mg2+.
For H+ flux detection, we first tested, without success, the recording solution used for
K+, Na+ and Cl-. Eventually, H+ fluxes became evident after removing MOPS. This
buffer was likely sequestrating most H+ ions and consequently dissipating the
biologically-generated H+ gradient in the recording solution (Kunkel et al 2001). In
fact, the basic recording medium already contained a mixture of potassium phosphate
dibasic and monobasic (K 2 HPO 4 and KH 2 PO 4 , respectively) that provided a slight
phosphate buffering capacity, so the medium was not completely unbuffered; we thus
used it directly to measure H+ fluxes, after adding 0.45mM Tricaine (Table III.5).
Because this anaesthetic tends to lower the pH of aqueous solutions (“MS222”
Alpharma Technical Bulletin 5, 2001), a new recording solution was made every 2
hours.
Page | 95
Chapter III - Results
1.3. Recording chamber
A major issue regarding the use of SIET in adult fish is that even under anaesthesia,
they maintain a opercula movement required for normal breathing that perturbs the
ion gradients and increases electric noise. The key to reduce this effect was the
recording chamber design. The optimized set-up was custom-made and is showed in
Fig. III.3A. Briefly, it comprised 2 chambers. The smaller one was a 45 mm diameter
plastic petri dish filled with a ±5 mm thick layer of recording solution/1% agarose. An
anaesthetized fish was laid down on a bed sculpted out of the agarose, with its caudal
fin stepping out of the petri dish through a hole previously made on the dish’s lateral
wall. The fish was then immobilized through a cover of parafilm fixed to the agarose
with wood pins. The small chamber was fitted into a bigger, rectangular chamber, and
the whole setup was filled with the appropriate recording medium. Ion-specific fluxes
were measured at the caudal fin, now isolated in the larger chamber (Fig. III.3 B-D).
Figure III.3 – Recording set-up for SIET application to adult zebrafish caudal fin. (A)
Custom-designed recording chamber. (B) Recording parts of the SIET, inside Faraday cage.
Page | 96
Chapter III - Results
(C, D) Details of ISE position relative to the caudal fin, during data acquisition, in (C) frontal
view and in (D) lateral view.
1.4. Artificial sources
By measuring the flux coming out of an artificial source of the ion of interest using the
previously optimized SIET components, we verified the accuracy of our SIET system
(Fig. III.4). For each ion-species, flux intensity was higher closer to the artificial
source and decreased with distance as the ISE was moved away from the source. At
each step, the flux was stable, without noise peaks. The background measurement
was ≈ 0. These results confirmed the absence of ionophore leakage and a good signalto-noise ratio.
Figure III.4 – Artificial source for potassium (K+), sodium (Na+), proton (H+), calcium
(Ca2+) and chloride (Cl-), respectively (A-E). Arrowhead indicates the first 100 µm ISE
withdrawal from the artificial source. Before that, all withdrawals were 50 µm. Background
measurement is represented by the gray line in each graphic.
Page | 97
Chapter III - Results
Discussion
Scanning ion-selective electrode technique (SIET) allows the direct detection of single
ion species that carry EC in a non-invasive, extracellular manner that does not
damage nor perturb the functioning of cells and tissues (Shipley and Feijó 1999).
The great resolution of SIET allows it to detect very low electric signals. These include
biologically significant signals that would otherwise be missed, but also electrical
noise that would be left out of the resolution limit in other electrophysiology
techniques. Thus, reducing noise, defined as the unwanted and random fluctuations
in the electric signals, is imperative to attain a sufficient signal-to-noise ratio that
allows the electrical signals to be clearly isolated. There are two main categories of
noise that can affect SIET: (1) interference (either electric or electromagnetic) from
external sources such as the main power supply and electric powered equipment in
the room; and (2) random noise from the intrinsic properties of the substances from
which the different SIET components are made, including the resistance of the ion-
selective electrode (ISE) and the intrinsic EC that the preamplifier has to draw in
order to measure the voltage generated by the electrode (Budai 2004).
In the present study, electrical interference was successfully reduced by grounding
and shielding all electrical equipment in the room, and furthermore by enclosing the
ISE and headstage in a Faraday cage for electrical isolation. Random noise was limited
by minimizing the resistance of the ISE, which is in great part a function of the ISE
shape. In a hydraulic analogy, it is more difficult to push water through a long, narrow
pipe than a wide, short pipe. In the same way, an electrode (the “pipe”) with large tip
and short taper has lower resistance to the passage of EC (the “water”) through it,
which makes it less susceptible to noise (Reid and Zhao 2011). Because our study
object (zebrafish caudal fin) was a large structure, we didn’t need a great spatial
resolution, and so we could use large tip diameters to decrease noise. This was a great
advantage compared to the majority of the described studies, where small tip
diameters are mandatory due to the small size of the study object (examples:
Marenzana et al 2005, Certal et al 2008, Nguyen and Donin 2010, Kreitzer et al 2012).
Short ionophore column also reduces the probe’s electrical resistance, making it less
susceptible to electronic interference (noise) (Reid and Zhao, 2011). Nevertheless,
Page | 98
Chapter III - Results
large tips and short tapers do not coupe with a short ionophore column, which would
easily leak, thus making it impossible to detect ion specific electric signals (remember
that the ionophore is the ion-specific membrane that allows ion-specific voltage
measurements). Consequently, a fine-tuning between the three parameters was
crucial for noise reduction. Additionally, the intrinsic properties of the ionophores
must be taken into account. For instance, K+ ionophore has a low ability to adhere to
the silanized glass walls of the electrode, and is thus very leaky. To counteract this
property, we had to design K+-specific electrodes with a smaller tip and longer taper
compared to the remaining ISEs used.
Regarding the optimization of the recording solution, there were two main and
opposing constraints. On one hand, the SIET signal-to-noise ratio is defined by the
measured ion-specific gradient compared to the concentration of that ion in the
recording solution (background concentration). Consequently, to ease the detection
of a specific ion flux, the recording solution should have a simple ionic composition,
with a particularly low concentration of the ion of interest. This reduces noise,
increases the signal-to noise ratio and allows the detection of smaller signals that
would otherwise be masked by a high background ion concentration (Kunkel et al
2006). On the other hand, deviations from the normal ionic environment of the study
target (animal, organ or cell) may induce changes in the physiological ion movement
coefficients and important biological effects can occur (Shipley and Feijó 1999). Our
optimized recording solution was a compromise between these restrictions: it was
based on an artificial solution that mimicked the water used in the zebrafish tanks
(Lin et al 2006), where we decreased the concentration of specific ions depending on
the ion of interest.
For K+, Na+, Ca2+ and Cl-- specific flux detection, the recording solution was enriched
with MOPS buffer to stabilize the pH around 7.2, which is the normal pH of the
zebrafish water. This counteracted the medium acidification by both the anaesthetic
(Tricaine) and the CO 2 released during fish respiration. This way, MOPS avoided
changes in the concentration of free H+ from perturbing biochemical processes such
as the normal transcellular and transepithelial ion transport, thus resulting in more
stable ion-flux detection. On the contrary, adding MOPS to the H+-specific recording
Page | 99
Chapter III - Results
solution would have hindered H+ flux detection, since it sequestrates free H+ in
solution (that is how it stabilizes pH), thus dissipating biologically-generated H+
gradients (Kunkel et al 2001). It is thus not surprising that we used the basic
recording solution for H+ flux detection, without adding any buffer. In fact, the basic
recording solution contained a small concentration of the natural buffer phosphate.
The use of this natural buffer has been contested by many authors, because it
participates in cellular metabolism and so its presence in the medium could affect
normal physiology (Kunkel et al 2001). Nevertheless, we used a very low phosphate
concentration (0.085 mmol/L). More, fish maintained in the basic recording medium
for two weeks fed, swam, bred, behaved and regenerated normally, indicating that
none of the recording medium components had deleterious effects on fish. It is also
arguable that phosphate could be transported into or out of cells, such that their
concentration in the recording medium would change near cells surface, resulting in a
very instable H+ gradient around a cell or tissue. However, we detected stable H+
fluxes both near the fin tissue and the artificial source, again indicating the suitability
of our recording solution.
Finally, the last crucial element that required optimization was the recording
chamber. The designed double chamber set-up had two major advantages: (1) the
physical barrier created between the 2 chambers containing the caudal fin and the
fish body minimized the destructive wave effect of the opercular movements on the
ionic gradients established near the caudal fin – the physical perturbation of the
recording medium by the fish body becomes restricted to the smaller chamber; and
(2) the big volume of recording solution contributed to the stability of the medium
composition, by increasing the dilution effect.
Taken all, the adaptation of SIET to our working model (adult zebrafish caudal fin)
was a multi-step process that required optimization of several distinct components of
the technique. Even though this was time-consuming, the optimized technique could
then be used to produce unprecedented data regarding ion-specific fluxes specifically
established during regeneration.
Page | 100
Chapter III - Results
Part 2 - Ion-specific fluxes during adult zebrafish caudal fin
regeneration
To assess the role of single ion dynamics (electrical current (EC) and/or
concentration gradients) during regeneration, we used SIET to build a spatial
(ray/inter-ray) and temporal (0.08, 6, 24, 48, 72 and 96 hours post-amputation - hpa)
profile of ion-specific fluxes throughout the regeneration of AB wild type adult
zebrafish caudal fin, after amputation at the distal plane. Five ions - K+, Na+, H+, Ca2+
and Cl- - were investigated, due to their great biological significance (Reuss 2005,
Newman 2001, Levin 2009).
2.1. Spatial ion-specific flux profile
As soon as 5 minutes post amputation (= 0.08 hpa), Na+ and Ca2+ efflux were
significantly higher at the ray level compared to the inter-ray (p<<0.05, independent
T-test) (Fig. III.5B, C). Six hours later, still during the wound healing phase, those
spatial differences had faded to levels below statistical significance. Overall, the flux
pattern throughout regeneration was similar at both ray and inter-ray regions, for
each ion species (Fig. III.5). Therefore, from here on we focused on the ray areas,
which contain the bigger variety of cell types and embrace a higher level of tissue
complexity.
2.2. Temporal ion-specific flux profile
Uncut fins (0 hpa) maintained a slight efflux for all ions measured, but this was not
significantly different from the background flux (p>0.05, independent T-test). Upon
amputation, this general ionic profile suffered a profound change (Fig. III.5).
For K+, Na+ and Ca2+ there was a massive increase in the outward flux immediately
after amputation (0.08 hpa), over 69-fold, 248-fold and 90-fold respectively, at the
Page | 101
Chapter III - Results
ray level. But such high effluxes were not sustained and decreased rapidly with time
(Fig. III.5A-C). In fact, 0.08 hpa was the only time point when flux intensity
significantly changed when comparing all the regeneration stages screened (p<0.05,
one-way ANOVA). Nevertheless, at 6 hpa K+, Na+ and Ca2+ -specific fluxes were still 4-,
51- and 9- fold higher than in uncut fins (0 hpa) respectively, and recovery of flux
intensity to levels closer to those of uncut fins only took place after complete wound
healing (>12 hpa).
As to Cl- temporal flux profile (Fig. III.5D), the statistical analysis found no significant
differences between any of the time points analyzed (p>0.05, one-way ANOVA).
However, Cl- flux followed an obvious pattern throughout regeneration: the outward
current increased upon amputation, over a 344-fold change in the first minutes after
amputation (0.08 hpa). In contrast with K+, Na+ and Ca2+, this ionic current was
sustained at the ray level for at least 6 hours during the wound healing (at 6 hpa, 313fold increase relative to uncut fins), and only then started to decrease towards the
levels of uncut fins (0 hpa), as regeneration continued.
H+ flux profile (Fig. III.5E) was quite different from all other ion species tested. After
amputation (0.08 hpa), an inward current appeared with over 13-fold higher
intensity than uncut fins (0 hpa), but the opposite direction (influx instead of efflux).
This high influx was significantly different from the detected in the remaining
regeneration stages (p< 0.05, one-way ANOVA) but rapidly decreased below
statistical significance by 6 hpa. However, unlike all other ion species, H+ flux didn’t
return to background intensity similar to uncut fins after the wound had closed.
Instead, by 24 hpa, when the wound had completely healed and a blastema was
starting to form, the influx had reverted to an outward current significantly higher
than the one detected before amputation (p<0.05, one-way ANOVA; over 14-fold
increase compared to uncut fins). This efflux intensity was maintained until the end of
blastema maturation (48 hpa) and only then decreased towards levels closer to the
uninjured tissue.
Page | 102
Chapter III - Results
Figure III.5 – Pattern of potassium (K+), sodium (Na+), calcium (Ca2+), chloride (Cl-) and proton
(H+) -specific fluxes during the main regeneration stages of the adult zebrafish caudal fin (A-E,
respectively). For each ion species, measurements at the ray and inter-ray levels are represented by
dark and light coloured bars, respectively. Panels at the right: detail of the ion-specific flux pattern
described in the left panels, from 24 to 96 hpa. (†) p<0.05, independent T-test; (*): p<0.05, one-way
ANOVA; hpa: hours post-amputation; 0 hpa correspond to the uncut fin (control).
Page | 103
Chapter III - Results
2.3. Ion-specific composition of electric currents during regeneration
Although we haven´t assessed total electric current (EC) in zebrafish caudal fins, it is
generally accepted that upon wounding, an injury EC called injury potential is set due
to the disruption of the transepithelial potential and subsequent outward flow of
charged ions and molecules at the wound site, and it only disappears when the
wound heals. Accordingly, our data showed that upon fin amputation, K+, Na+, Ca2+
and Cl- -specific efflux intensity increased up to 3 orders of magnitude compared to
the non-injured control fins, and returned to levels similar to the control by the end of
wound healing (Fig. III.6). This strongly suggests that those ions are components of
the injury potential. Na+ seems to be the major ionic contributor for the wound EC in
the zebrafish regenerating caudal fin, as its efflux alone was 3-fold higher than the
flux of all other ions together soon after amputation (0.08 hpa), and still 2-fold higher
six hours later. K+ had the second highest efflux by 0.08 hpa but rapidly decreased. On
the contrary, Cl- efflux kept at high levels for at least 6 hpa, when it was higher than
K+, Ca2+ and H+ fluxes together. Thus, whereas K+ seems to contribute only to the
initial stages of the injury potential, Cl- seems to be a longer-term contributor.
Regarding Ca2+ efflux, it was very low compared to the remaining ions, and its little
contribution to the injury potential seems to be restricted to the initial stage of
wound healing (0.08 hpa) (Fig. III.6).
Figure III.6 – Contribution of individual ion-species to the total ionic flux during the
first 6 hpa, when wound healing is taking place. Fluxes for potassium (K+), sodium (Na+),
calcium (Ca2+), chloride (Cl-) and proton (H+). hpa: hours post-amputation.
Page | 104
Chapter III - Results
As for H+, the flux intensity was very low as compared to all other ions and its
contribution to the wound EC should be negligible. Nevertheless, H+ efflux was the
only one established and maintained during the stages that follow wound healing,
suggesting a different role during regeneration, which we further investigated.
Discussion
Dynamic ion-specific fluxes accompany regeneration
It has been known for decades that ECs and the associated EFs accompany
regeneration events; these are not an epiphenomenon, but rather electrical signals
necessary for regeneration success. The source that drives these ECs has been
investigated in amputated amphibian limbs: nerves were an early and great candidate
to drive such electrical signals (Borgens et al 1977), but the most convincing results
argue for a skin source (Borgens et al 1977). Efforts have also been made to
understand how injury-induced electrical signals interfere with regeneration. So far,
it has been showed that they affect the migration, proliferation and differentiation of
cells as well as the patterning of tissues, all of which are required during regeneration
(for a review, see chapter I: section 3.3.2). Despite these invaluable data, the
identification of the ion species that actually carry the relevant ECs remains
imperative for a full comprehension of the bioelectrical signals and how they
integrate with chemical and genetic cues to control regeneration. This will provide
new ways of modulating bioelectrical signals in order to understand and augment
regenerative capacity (Levin 2007). Several assays based on ion substitution in the
extracellular medium and pharmacological treatments that targeted specific ion
translocators have shed light on some of the ions and ion translocators involved in
the wound healing- and regeneration-associated ECs (Borgens et al 1979b, Reid et al
2005, Reid et al 2009, Vieira et al 2011), but until now a direct detection of those ion
species during epimorphic regeneration was lacking. In the present study, we
determined the specific ions that carry ECs throughout regeneration of the adult
zebrafish caudal fin regeneration. We have showed that at least five ion species, K+,
Na+, H+, Ca2+ and Cl- contribute to the amputation-stimulated ECs.
Page | 105
Chapter III - Results
It is classically assumed that in all regeneration-competent structures, at least two
distinct ECs are generated after amputation. An injury-induced EC (the injury
potential) establishes upon wounding, and because it results from the disruption of
the transepithelial potential, it disappears when the wound heals. Nevertheless, EC
continues to be detected during most of the remaining regenerative process,
revealing the existence of a second, regeneration-associated EC distinct from the
injury potential (Borgens et al 1977, Suzuki et al 2005, Reid et al 2009). Our ion-
specific flux recordings agreed with the presence of two distinct ECs. Upon fin
amputation but not in uncut tissues, there was a great efflux of K+, Na+, Ca2+ and Cl- at
the amputation plane. The effluxes gradually decreased and returned to the low pre-
amputation flux intensity by 12 hpa, when the wound healing was complete. These
ion-specific flux profiles coincide with the timing of establishment and extinction of
the injury potential, strongly suggesting that the four ion species contribute to such
leakage current. In regeneration stages later than the wound healing, K+, Na+, Ca2+ and
Cl- fluxes were no longer significant; instead, a small but stable H+ efflux established,
consistent with the presence of a second EC, associated with regeneration-specific
stages.
The injury potential: one ubiquitous phenomenon, different ionic contributions
Regarding the ion-specific fluxes that we detected during the wound healing of
amputated fins, Na+ flux overcame the combined flux of K+, Ca2+ and Cl- by 3 orders of
magnitude. Hence, it seems to be the major component of the injury potential during
adult vertebrate regeneration. In agreement with our view, former studies have
showed that the intensity of the wound-induced ECs in amputated amphibian limbs
depend on Na+. Particularly, increasing or decreasing the levels of Na+ enhanced or
reduced the injury potential, respectively (Borgens et al 1977, Borgens et al 1979d,
Borgens et al 1979b, Reid et al 2005, Reid et al 2011a). The reason for Na+ flux
prevalence may lay on the fact that it is the dominant interstitial ion species and thus
it would be the ion leaking the most upon disruption of epithelial integrity (Randall et
al 1997). In line with this idea, we have showed in this work that Cl-, which is usually
the second most abundant ion species outside cells, and K+, which is typically the
dominant ion species in the cytosol, also contribute a good parcel to the injury
Page | 106
Chapter III - Results
potential in the amputated zebrafish caudal fin. On the contrary Ca2+, which is present
in lower levels as a free ion in the cytosol, had only a minor contribution.
K+, Na+, Ca2+ and Cl--specific fluxes have also been detected during the healing of rat
cornea wounds using SIET (Vieira et al 2011), supporting the view that they are
general components of the injury potential in metazoans. Notwithstanding, in
mammalian cornea wounds, EC was generated mainly by Cl- influx (note that influx of
a negative ion translates to an outward flow of positive EC) (Reid et al 2005, Reid et al
2011a, Vieira et al 2011), whereas during wound healing of amputated zebrafish
caudal fins and amphibian limbs the injury potential was driven mainly by Na+ efflux
(Borgens et al 1977, Borgens et al 1979d, Borgens et al 1979b). Thus, we suggest that
the magnitude of individual ion-species contributions to the injury potential is taxonor tissue-dependent. Such heterogeneity could result from the distinct ionic fluxes
accounting for the TEP in the uncut tissue. In fact, different ionic compositions of the
TEP were described for the uncut corneal epithelia in mammals versus amphibians
(Zhao 2012) - distinct taxa - and for the cornea and appendages in Xenopus (Candia et
al 1968, Borgens et al 1979b) - distinct tissues of the same organism. The
physiological taxon- and tissue-dependent differences could be related to the
extracellular and environmental conditions that homologous structures and distinct
body parts of single organisms usually experience, which dictate the major ion
transfers required to maintain homeostasis. It will be interesting to investigate if
differences in the ionic composition of the wound-induced ECs are related to the
regenerative ability of different tissues/organisms.
As a final consideration about the injury potential, it should be noted that it is
classically defined as a passive leakage EC that corresponds to the flow of charged
ions and molecules at the wound site down their electrochemical gradient. If so, the
EC should peak immediately after wounding, decreasing gradually as a new
electrochemical equilibrium was reached. Nevertheless, in the mammalian cornea,
the EC peaks some tens of minutes after wounding, and the fluxes of individual ion
species have distinct and dynamic time courses. Besides, the intensity of both the
injury potential and the fluxes of specific ions such as Cl-, Ca2+ and Na+ can be
modulated using inhibitors (furosemide, ouabain) or enhancers (ascorbic acid,
Page | 107
Chapter III - Results
aminophylline, DIDS) of specific ion transporters (Song et al 2002, Reid et al 2005,
Reid et al 2011a, Vieira et al 2011). In the amputated zebrafish caudal fin, Cl- efflux
also remained at high levels for at least 6 hpa. Altogether, these data strongly suggest
that at least part of the injury potential is actively generated and regulated by the
activity of specific ion translocators.
Proton efflux accompanies regeneration stages that follow wound healing
As previously explained, an EC distinct from the injury potential accompanies most of
the regenerative process that follows wound healing. This regeneration-associated EC
is unlikely to reflect a passive movement of charged particles down their
electrochemical gradient, because it is established after the epithelial seal and the
transepithelial potential are restored. Instead, it is thought to be actively generated
and controlled at the cellular level by the activity of specific ion transporters (Levin
2007). For a long time, the ions that carry this EC remained unknown, as well as the
corresponding ion translocators (Borgens et al 1977).
In the present work, we have showed that H+ efflux is present during regeneration
stages later than the wound healing. We did not detect significant fluxes of K+, Na+,
Ca2+ or Cl- during the regenerative stages that follow wound closure, even though for
decades Na+ has been suggested to affect regeneration-associated ECs in amphibian
appendages (Borgens et al 1977, Reid et al 2009). In fact, a recent study regarding
Xenopus tadpole tail regeneration indicated Na+ as a major component of the EC that
accompanies regeneration, based on two main evidences: (1) tadpoles in Na+-free
solution (but not in Cl--free solution) had significantly reduced ECs upon amputation
and correspondingly reduced regeneration rate; (2) fin punch wounds healed
normally in Na+-free solution, suggesting this ion is essential for regeneration but not
wound healing (Reid et al 2009). Importantly, direct modulation of Na+ transport is
sufficient to induce tail regeneration in non-regenerative conditions, and the voltagegated Na+ channel Na v 1.2 was recently identified as the molecular source of Na+
transport during Xenopus tadpole tail regeneration (Tseng et al 2010). Taken all,
there is little doubt that Na+ flux contributes greatly to regeneration-associated ECs in
amphibians. Nevertheless, it is possible that, similar to the injury potential, the ionic
Page | 108
Chapter III - Results
composition of the regeneration-associated EC varies among taxa. In fact, the ECs in
amputated Xenopus tadpole tail and wounded mammalian cornea are affected
differently by the same ion channel/pump- inhibitors and enhancers, suggesting that
different ion transporters are involved (Reid et al 2009). It is also possible that our
SIET recordings have missed a parcel of the Na+-specific fluxes, especially if we
consider the low efficiency of the ionophore (no more than 40% of selectivity for Na+)
that typically produces noisier measurements and less specific ion flux detection.
Opposite to the Na+ ionophore, the H+-ionophore used in our SIET experiments is
highly specific (efficiency approximate 100%) and the recordings were very stable,
strengthening the accuracy of our H+ flux recordings. H+ efflux was first detected at
the cut surface several hours after caudal fin amputation, and it was present for at
least 5 days after wound closure.
Therefore, we propose that H+ efflux contributes to a regeneration-specific
endogenous EC in an adult vertebrate. This hypothesis was further supported by the
dynamic nature of the H+ efflux recorded - it increased during blastema formation and
decreased thereafter. A similar dynamic behaviour was described for regeneration-
specific ECs in amphibians, which seem to be controlled by the activity of ion
transporters and required for regeneration (Reid et al 2009). Thus, H+ efflux could be
an important part of the signalling cues that govern regeneration stages later than
wound healing.
Page | 109
Chapter III - Results
Page | 110
Chapter III - Results
Part 3 - Molecular source of proton efflux during
regeneration of the adult zebrafish caudal fin
3.1. V-ATPase is up-regulated during adult zebrafish caudal fin
regeneration
To find candidate H+ transporters that could relate to regeneration and to the H+
efflux detected (Chapter III: part 2), we used different and complementary
approaches that will be described in the following subsections.
3.1.1. Transcriptomic analysis of the regenerating caudal fin
We performed a microarray (Affimetrix) that assessed overall gene expression during
caudal fin regeneration, after distal amputation. The five time points analysed were
representative of main stages of regeneration: 0 hpa (uncut fin, used as control), 3
hpa (wound healing), 24 and 48 hpa (blastema formation and maturation,
respectively), and 96 hpa (regenerative outgrowth). The accuracy of the microarray
was assessed by two approaches. First, we confirmed that fgf20a, which is one of the
most specific regeneration markers known (Whitehead et al 2005), was up-regulated
in a similar level in the microarray and by qRT-PCR: the values were 6.42- and 8.52-
fold change relative to uncut fins, by qRT-PCR and microarray, respectively (Fig. III.7
and Table III.6). Second, we compared the expression profile of known regeneration
markers in previously published work and in our microarray database. The
expression of at least 20 genes overlaid with published data, further validating the
results from the present array (Table III.6).
Of the ~15000 transcripts present in the Affymetrix GeneChip Zebrafish Genome
Arrays, 7692 satisfied the criteria used to select relevant data (chapter II: section 3),
including fold-change ≥1.2 (relative to the uncut fins) in one or more time points
during regeneration and at least one Present Call per replicate (Table III.7). The
number of down-regulated transcripts at 3 hpa outnumbered the up-regulated ones
Page | 111
Chapter III - Results
in over 1000. Interestingly, this difference gradually faded as regeneration
progressed and by 96 hpa there were already more transcripts up-regulated than
those down-regulated.
Figure III.7 – qRT-PCR for fgf20a at 24 hpa. qRT-PCR showed 6.42-fold up-regulation of
fgf20a relative to uncut fins, which agrees with the level of up-regulation in the microarray,
validating its accuracy. hpa: hours post amputation. (*) p<0.05, independent T-test.
Table III.6 - Validation of the microarray. Twenty genes identified as regeneration
markers in previously published databases had a concordant fold-change in the present
microarray. hpa: hours post-amputation. Blue: down-regulation; red: up-regulation.
Fold-change relative to uncut fin
Gene
(reference)
Acession
aldh1a2: aldehyde dehydrogenase 1a2
bambi
(4)
bmp6: bone morphogenetic protein 6
fgf20a: fibroblast growth factor 20a
fn1: fibronectin 1
(3, 6)
(7)
her6: hairy-related 6
igf2b
(5)
(4)
(2)
actβa: activin βa/ inhibin βaa
jag1a: jagged 1a
(2)
(4)
junb: jun B proto-oncogene
(7)
junbl: jun B proto-oncogene, like
(7)
mdka: midkine-related growth factor
mmp9: matrix metalloproteinase 9
(4)
(7)
(3)
3 hpa 24 hpa 48 hpa 96 hpa
NM_131850.1
-
2,36
6,76
1,89
NM_131784.1
-1,79
1,49
4,11
4,58
BM889629
-
-
1,36
1,47
BQ092536
-
8,52
13,02
2,94
NM_131520.1
-
5,96
4,44
5,02
NM_131079.1
-1,74
1,23
2,06
2,36
AF250289.1
1,40
2,18
3,92
2,90
CD605751
7,48
5,52
1,69
2,43
NM_131861.1
4,40
4,77
3,05
2,71
BC053234.1
3,24
3,60
2,79
1,66
BC053154.1
2,48
2,66
2,22
1,71
-
3,93
3,96
3,71
CD014404
BC053292.1
4,15
2,23
1,90
1,97
msxb: muscle segment homeobox B
(1)
BI886929
-1,48
-
2,37
2,46
msxc: muscle segment homeobox C
(1)
AL730680
-4,94
-1,65
1,81
2,48
BG308878
1,45
1,28
1,22
1,34
sall1a: sal-like 1a (Drosophila)
Page | 112
(4)
Chapter III - Results
(Table III.6, continued)
Gene
Fold-change relative to uncut fin
(reference)
Acession
smarca4: SWI/SNF related matrix
associated actin dependent regulator of
(7)
chromatin subfamily a member 4
sox11a: SRY-box containing gene 11a
(4)
sox11b: SRY-box containing gene 11b
(4)
tgfβr2: transforming growth factor, β
(4)
receptor II
3 hpa 24 hpa 48 hpa 96 hpa
AI415791
U85090.1
3,10
1,22
5,13
1,69
4,13
1,69
2,59
NM_131337.1
-1,31
1,28
2,59
4,48
AY178449.1
-1,39
-1,73
-1,84
-1,27
References: (1) Akimenko et al 1995, (2) Jazwinska et al 2006, (3) Mathew et al 2009, (4)
Schesbesta et al 2006, (5) Smith et al 2006, (6) Whitehead et al 2005, (7) Yoshinari et al 2009
Table III.7 – Differentially expressed transcripts during regeneration. Total number of
transcripts significantly up-regulated (up) or down-regulated (down) in the arrays, compared
to uncut fins. hpa: hours post amputation.
7692 transcripts
Time point
Up
Down
3 hpa
1716
2886
24 hpa
1637
1917
48 hpa
2014
2270
96 hpa
1904
1763
Filtering of the dataset (7692 transcripts) for genes related with ion transport
returned a total of 370 transcripts with altered expression in one or more time points
during regeneration (Table III.8 and Appendix 3). Similar to the observed in the
whole dataset, at early regeneration stages the number of down-regulated ion-
transport related transcripts outnumbered the up-regulated ones, and the opposite
was true for late regeneration (Table III.8, compare 3, 24 and 48 hpa with 96 hpa).
Many transcripts exhibited altered expression level at a single time point rather than
being up- or down-regulated during the whole regenerative process (“time pointspecific transcripts”). In fact, at 3 hpa the number of time point- specific transcripts
exceeded more than one-third (37.90%) of the differentially expressed transcripts.
For regeneration stages later than the wound healing (24, 48 and 96 hpa), the
percentage of time point- specific transcripts was much smaller, varying between 7%
and 12% of the differentially expressed mRNA sequences.
Page | 113
Chapter III - Results
Between 36.53 % and 47.04 % of the relevant ion transport- related transcripts at 3
hpa continued to be differentially expressed at least until 96 hpa (Fig. III.8). In
addition, at each time point a new set of transcripts began differential expression.
This revealed that ion transport- related transcripts have a dynamic expression
during regeneration, which suggests that specific ion transport- related genes are
required at particular stages of regeneration.
We finally looked into the expression of H+ transporters. The following H+
transporters had a modified expression level compared to uncut fins, but only some
were further investigated in the context of the present study, as explained next
(Appendix 3):
• slc16a1 and slc16a3: these H+ symporters were up-regulated at 24 hpa and
between 3 and 48 hpa, respectively. They are members of the solute carrier
family 16 and catalyse
the H+-coupled transport of monocarboxylates (eg. glycolysis products lactate,
pyruvate) across the plasma membrane. In such way, their activity is fundamental
for normal cellular metabolism and pH regulation (Adijanto and Philp 2012). By
the time we analysed the microarray, Scl16a1 (MCT1) and Slc16a3 (MCT4) had
been associated to cell migration (Zhang et al 2005, Gallagher et al 2007), which is
a crucial cell behaviour during wound healing. Nevertheless, we were most
interested in studying the role of H+ efflux in regeneration stages later than the
wound healing, because the detected H+ efflux established after wound healing.
Thus, we did not address these H+ transporters further.
• F-ATPase (ATP synthase, H+ transporting, mitochondrial): 7 of the 11 subunits of
ATP synthase were up-regulated between 24 and 96 hpa (atp5c1, atp5a1, atp5g,
atp5h, atp5l, atp5f1 and atp5d). In animal cells, F-ATPase is mainly located to the
inner membrane of mitochondria, where it use the energy from the H+
electrochemical gradient into the matrix to synthesize ATP (Wieczorek et al 1999,
Saroussi and Nelson 2009). Taken such a function and cellular location, it was
unlikely that F-ATPase contributed to the regeneration-associated H+ efflux
detected using SIET.
Page | 114
Chapter III - Results
• V-ATPase (ATP hydrolase, H+ transporting): 4 subunits (atp6v1ba, atp6v1c1,
atp6v1d, atp6v1e1) of this 14-subunit H+ pump were up-regulated between 24
and 96 hpa, in the ion transport- related dataset. A careful analysis of the whole
dataset returned another 7 V-ATPase subunits that were also up-regulated
between 24 and 96 hpa (atp6v1g1, atp6v1h, atp6v1f, atp6v0c, atp6v0d1, atp6ap1,
atp6ap2) (Table III.9). It remains unclear why they were not included in the “ion
transport” filter. We decided to further assess the role of V-ATPase and its
relation to the H+ efflux previously detected in this work, for several reasons.
First, even though V-ATPase has housekeeping functions in virtually all
eukaryotic cells, it also performs cell- specific functions (see chapter I: section
4.2.4). Second, it can localize to both intracellular membranes and the plasma
membrane, thus it could mediate cellular H+ extrusion. Third, the time period of
V-ATPase up- regulation agreed with the H+ efflux that we had previously
detected (chapter III: part 2). Four, by the time we started analysing the
microarray, this H+ pump was showed necessary for tail regeneration in a larval
model (Xenopus tadpole) (Adams et al 2007). Altogether, these facts suggested
that regeneration- associated H+ extrusion could be related to increased V-
ATPase expression, which would represented a new finding regarding adult
vertebrate regeneration and its dependence on both genetic and bioelectrical
events.
• slc9a7 (accession AW826698): best known as nhe7, it is a member of the Na+/H+
exchanger family (NHE), that was up-regulated between 48 and 96 hpa. This
antiporter is ubiquitously expressed in the trans-Golgi network and in post-Golgi
vesicles, regulating organellar pH homeostasis by transporting luminal H+ into
the cytosol in exchange for either Na+ or K+ (Numata and Orlowski 2001, Lin et al
2005). It can also be present at the plasma membrane, where it has a role at least
in cell migration (Kagami et al 2008, Lin et al 2007). At the time of microarray
analysis Na+/H+ exchangers were also known to interact with V-ATPase in
different cellular functions (Heming and Bidani 2003, Sandbichler and Pelster
2004, Hille and Walz 2007, Kamachi et al 2007). In fact, like the V-ATPase, nhe7
was up-regulated in stages later than the wound healing. Thus, we considered
Nhe7 as another candidate that could contribute to the H+ efflux associated to
regeneration stages that follow wound closure.
Page | 115
Chapter III - Results
Table III.8 – Differentially expressed ion transport-related transcripts during
regeneration. Number of transcripts in the “ion transport” category that were up-regulated
(up) or down-regulated (down) compared to uncut fins, including transcripts with expression
altered at one single time point (in brackets). hpa: hours post amputation.
Up (time point
Down (time point
Total (time point
specific)
specific)
specific)
3 hpa
95 (52)
124 (31)
219 (83)
24 hpa
81 (3)
100 (11)
181 (14)
48 hpa
107 (11)
112 (17)
219 (28)
96 hpa
93 (9)
84 (11)
177 (20)
Time point
Figure III.8 – Dynamic expression of ion transport- related transcripts during
regeneration. Columns of different colours correspond to the number of transcripts in the
“ion transport” category that started being differentially expressed (up- or down- regulated
relative to uncut fins) at a specific time point: at 3 hpa (dark green columns), 24 hpa (blue
columns), 48 hpa (green columns) and 96 hpa (light blue columns). hpa: hours post
amputation.
Table III.9 – V-ATPase subunits differentially expressed in the microarray. 11 of the 14
V-ATPase subunits were up- (red) or down-regulated (blue) during regeneration. hpa: hours
post-amputation.
Fold-change relative to uncut fin
gene
atp6v1e1: ATPase, H+ transporting, lysosomal, V1 subunit
E isoform 1
3hpa
24 hpa 48 hpa 96 hpa
-
1,91
1,64
1,56
atp6v1g1: ATPase, H+ transporting, V1 subunit G isoform 1
atp6v1ba: ATPase, H+ transporting, lysosomal, V1 subunit
B, member a
-
1,71
1,34
1,31
-
1,70
1,48
1,52
atp6v1h: ATPase, H+ transporting, lysosomal, V1 subunit H
-1,36
1,60
1,38
1,30
atp6v1f: ATPase, H+ transporting, V1 subunit F
-1,46
1,45
1,26
-
Page | 116
Chapter III - Results
(Table III.9, continued)
Fold-change relative to uncut fin
gene
3hpa
24 hpa 48 hpa 96 hpa
atp6v1d: ATPase, H+ transporting, V1 subunit D
atp6v1c1: ATPase, H+ transporting, lysosomal, V1 subunit
C, isoform 1
atp6ap1: ATPase, H+ transporting, lysosomal accessory
protein 1
-
1,36
-
-
-1,43
1,36
1,20
-
-1,34
1,30
-
-
atp6v0c: ATPase, H+ transporting, lysosomal, V0 subunit c
-
1,27
-
-
atp6v0d1: ATPase, H+ transporting, V0 subunit D isoform 1
atp6ap2: ATPase, H+ transporting, lysosomal accessory
protein 2
-
1,24
-
-
-1,46
1,21
-
-
3.1.2. Analysis of V-ATPase expression in the regenerating caudal fin
V-ATPase is a multi-protein complex, which makes it very difficult to study the whole
pump. Nevertheless, its function depends on the correct assembly of all its
components, so we looked at individual subunits instead. Taken this, to further
investigate V -ATPase up-regulation in the regenerating caudal fin, indicated in the
microarray, we focused on V-ATPase cytosolic subunit E1b (Atp6v1e1b). Transcripts
for this subunit were the most up-regulated in the microarray, and it is an essential
subunit for the H+ pump assembly (Hayashi et al 2008), function (Foury 1990, Lu et al
2002) and reversible V 0 /V 1 domains disassembly (Lu et al 2001, Forgac 2007).
Besides, at the time of the subunit choice, it was the only known E subunit isoform in
the zebrafish, homolog to the ubiquitous mammalian subunit E2, and there was an
available zebrafish mutant line for this subunit at the Zebrafish International
Resource Center (ZIRC). Additionally, we tested the V-ATPase cytosolic subunit A
(Atp6v1a), for which there is a commercially available specific antibody (Genscript
A00938).
3.1.2.1. qRT-PCR analysis of atp6v1e1b relative expression during regeneration
qRT-PCR analysis of atp6v1e1b confirmed that, at 24 hpa, V-ATPase was up-regulated
1.76±0.22 - fold relative to the uncut fin (Fig III.9). At 48 and 72 hpa the up-regulation
was lower (1.40±0.11/ 1.34±0.17 respectively), yet still significant (p<0.05,
independent T-test).
Page | 117
Chapter III - Results
Figure III.9 – qRT-PCR for atp6v1e1b during main stages of caudal fin regeneration.
qRT-PCR showed significant up-regulation of atp6v1e1b between 24 and 72 hpa relative to
uncut fins. hpa: hours post amputation. (*) p<0.05, independent T-test.
3.1.2.2. Expression pattern of atp6v1e1b and atp6v1a during zebrafish
embryonic development
It has been extensively proposed that the mechanisms activated during regeneration
of an organ or body section are the same that coordinate the embryonic development
of that structure. Thus, we analysed the expression pattern of V-ATPase during
zebrafish embryonic development, particularly during the development of the fins.
For that, we used atp6v1eb- and atp6v1a- specific mRNA probes produced in vitro.
The median fin fold, which precedes the formation of the unpaired dorsal, anal and
caudal fins, was not stained between 24 and 72 hpf (Fig. III.10). Expression at the
pectoral fins primordia appeared around 44 hpf, in the mesenchyme (Fig. III.11D,
arrowheads) and was maintained until 56 hpf, when it began to fade (Fig. III.11E-G,
arrowheads; Fig. III.12B). In order to confirm the accuracy of these results, we
compared the expression of atp6v1eb- and atp6v1a at the whole body level, with the
description available in the literature. From 24 to 33 hours post-fertilization (hpf),
atp6v1e1b seemed to be spread through the whole body, reflecting the ubiquitous
character of the V-ATPase. Nevertheless, it was particularly evident in the neural cells
of the neural tube marginal zone (Fig. III.11A-C, Fig. III.12A). At 48 hpf, transcripts
were found in the telencephalon, rombencephalon and in the eyes, while maintaining
the expression at the neurons of the neural tube marginal zone (Fig. III.11E, Fig.
III.12B). At this time, atp6v1e1b was concentrated at the H+-ATPase rich cells (Fig.
III.11E, arrows), which are present in the skin, in the region of the yolk sac and the
yolk tube (Lin et al 2006). A similar staining was found for atp6v1a at 48 hpf (Fig.
Page | 118
Chapter III - Results
III.11F, arrows). At 72 hpf, the encephalon and retira were stained (Fig. III.11H, Fig.
III.12C). This pattern agreed with the described distribution of V-ATPase in zebrafish
embryos, confirming the specificity of our in vitro synthesized mRNA probes (Golling
et al 2002, Lin et al 2006, Nuckels et al 2009, Chung et al 2010).
Figure III.10 –atp6v1e1b is not expressed in the median fin fold of zebrafish embryos.
In situ hybridization for atp6v1e1b performed at (A) 24 hpf and (B) 72 hpf. hpf: hours postfertilization.
Figure III.11 –Expression of V-ATPase subunits atp6v1e1b and atp6v1a during
zebrafish embryonic development. In situ hybridization for atp6v1e1b at (A) 24 hpf, (B) 29
hpf, (C) 33 hpf, (D) 44 hpf, (E) 48 hpf (G) 56 hpf and (H) 72 hpf; and for (F) for atp6v1a at 48
hpf. From 24 to 33 hpf (A-C) atp6v1e1b concentrated in the neural tube marginal zone. VATPase subunits expression at the pectoral fins primordia was evident between 44 and 48
hpf (D-F arrowheads), when transcripts were also present in the telencephalon,
rombencephalon, eyes, and H+-ATPase rich cells (E arrows). At 72 hpf encephalon and retira
were stained(H). hpf: hours post- fertilization
Page | 119
Chapter III - Results
Figure III.12 –atp6v1e1b expression in zebrafish embryos: whole body view. In situ
hybridization for atp6v1e1b at (A) 24 hpf, (B) 48 hpf and (C) 72 hpf. At 24 hpf (A), atp6v1e1b
spread through the whole body, a reflex of the ubiquitous character of the V-ATPase. Strong
staining was clear for several components of the central nervous system (A-C), as well as the
H+-ATPase rich cells (B). hpf: hours post-fertilization.
3.1.2.3. Expression pattern of atp6v1e1b and atp6v1a during regeneration of
the caudal fin
In adult fish, uncut caudal fins showed no expression of either atp6v1a or atp6v1e1b
to levels detectable by in situ hybridization (note that V-ATPase is ubiquitously
expressed, but in low levels) (Fig. III.13A, E). However, both genes exhibited a
regeneration-associated over-expression. Importantly, atp6v1a and atp6v1e1b had a
similar expression pattern at all regeneration stages, as expected for genes that form
part of the same multi-subunit complex. At 24 hpa, both transcripts were strongly
expressed in the blastema- forming region above the amputation plane (Fig. III.13B,
F). By the end of blastema maturation (48 hpa), the expression domain of the two V-
ATPase subunits was expanded, accompanying the growth of the blastema (Fig.
III.13C, G). By 72 hpa both transcripts were fading but could still be observed in the
distal regenerating region (Fig. III.13D, H).
Page | 120
Chapter III - Results
Figure III.13 – Expression of V-ATPase subunits atp6v1e1b and atp6v1a during caudal
fin regeneration. Whole mount in situ hybridization for atp6v1e1b (A-D) and atp6v1a (E-H)
showed a similar expression pattern for both V-ATPase subunits: they are not detected in
intact fins (A, E) but are specifically up-regulated in the regenerating tissue, at (B, F) 24 hpa;
(C, G) 48 hpa; (D, H) 72 hpa. hpa: hours post-amputation.
3.1.2.4. Immunolocalization of Atp6v1a during caudal fin regeneration
To further describe the distribution of the V-ATPase in the adult caudal fin, we used
anti-ATP6V1A antibody, after confirming its specificity through the staining of larval
H+-ATPase rich cells (Fig. III.14). To gain insights into the tissue and cellular
localization of V-ATPase, we simultaneously detected Atp6v1a and Pan-Cadherin,
which stains epithelial cells but not mesenchyme; and then Atp6v1a and F-actin
cytoskeleton, which is in close association with the plasma membrane (using
rhodamin-phalloindin (Invitrogen®)). Due to technical constrains of the imaging
system, we could not stain the three structures at the same time.
In the uncut caudal fin, Atp6v1a was mainly restricted to the epidermis and it
appeared in a scattered pattern, which is not surprising considering the ubiquitous
character of the V-type H+-pump (Fig. III.15A). During regeneration, some epithelial
cells were also stained, but this was not considered to be regeneration –specific
staining, as it resembled the staining in intact fins. Notwithstanding, Atp6v1a was
Page | 121
Chapter III - Results
clearly up-regulated in the regenerating tissue. By 24 hpa it was strongly up-
regulated in the blastema (Fig. III.15B, Fig. III.16A-A’’’, Fig. III.17A), and its expression
domain accompanied blastema expansion until 48 hpa (Fig. III.15C, Fig. III.16B-B’’’).
At 72 hpa, it was present especially in the areas of regenerative outgrowth (Fig.
III.15D). In addition, from 48 hpa to 72 hpa, Atp6v1a also accumulated in small
groups of cells lining parallel to the amputation plane, that were possibly the regions
of ray segment joints formation (Fig. III.15C, D; Fig. III.17B). Regarding the cellular
localization of V-ATPase, Atp6v1a didn’t co-localize with F-actin, but it stained
immediately below (Fig. III.17A). Taking into account that this protein is part of the
cytosolic domain of the H+ pump, our results did not exclude a possible plasma
membrane location of the whole pump.
Figure III.14 – Atp6v1a localizes specifically to the H+-ATPase rich cells in zebrafish
embryos. Immunohistochemical detection of Atp6v1a (green) in the zebrafish embryo yolk
sac, 48 hour post fertilization. Only H+-ATPase rich cells were stained, confirming the
specificity of the antibody. (A) 40x magnification. (B) Detail of panel A (square), 100x
magnification. Blue: nucleat staining with DAPI.
Page | 122
Chapter III - Results
Figure III.15 –Immunolocalization of Atp6v1a in the regenerating caudal fin.
Immunohistochemical detection of Atp6v1a (green) showed (A) scattered protein pattern in
intact fins, in contrast to (B-D) a strong protein localization in the regenerating tissue, at (B)
24 hpa, (C) 48 hpa and (D) 72 hpa. Arrowheads indicate regions of segment joint formation.
10x magnification. hpa: hours post-amputation.
Figure III.16 –Atp6v1a localizes to the blastema. Immunohistochemical detection of
Atp6v1a, showing specific staining of blastema cells during blastema formation (24 hpa, AA’’’) and maturation (48 hpa, B-B’’’). Blue: DAPI (nuclear staining); green: Atp6v1a; red:
rhodamin-phalloidin (F-actin staining). 40x magnification. hpa: hours post-amputation.
Page | 123
Chapter III - Results
Figure III.17 – Detailed view of Atp6v1a localization in the regenerating fin tissue.
Immunohistochemical detection of Atp6v1a: (A) Blastema cells at 24 hpa express high levels
of Atp6v1a. (B) Segment- joint cells highly express Atp6v1a at 72 hpa. Blue: DAPI (nuclear
staining); green: Atp6v1a; red: rhodamin-phalloidin (F-actin staining). magnification 63x.
hpa: hours post-amputation.
3.1.3. Analysis of Nhe7 expression in the regenerating caudal fin
Another H+ transporter identified in the microarray as up-regulated was Nhe7
(Scl9a7) (chapter III: section 3.1.1). nhe7 was up-regulated in stages later than the
wound healing (at 48 and 96 hpa), and therefore we hypothesized that it could
contribute to the H+ efflux associated to regeneration stages that follow wound
closure. However, it was not possible to confirm the regeneration-specific expression
of Nhe7. At the mRNA level, in situ hybridization for nhe7 was inconclusive, because
both the gene- specific (antisense) and non-specific control (sense) probes produced
similar results at the main regeneration stages (Fig. III.18). For detection at the
protein level, we searched for commercially available antibodies with specific
reactivity for the zebrafish antigen. There were no zebrafish specific antibodies, but
the anti-SLC9A7 from Lifespan Biosciences (LS-C40446a) was predicted to react to
the zebrafish antigen, and therefore it was tested. Nevertheless, it didn’t react to
slc9a7.
Taken all, we have found several H+ transporters differentially expressed during
regeneration. We confirmed that at least the V-ATPase is up-regulated in the
regenerating tissue of the fin, during time points that coincide with the regenerationassociated H+ efflux recorded (chapter III. Part 2), suggesting a causal relation.
Page | 124
Chapter III - Results
Figure III.18 – In situ hybridization for nhe7 during caudal fin regeneration. Specific upregulation of nhe7 during caudal fin regeneration remained inconclusive, since the in situ
hibridization for nhe7 (A-C) and for the corresponding non-specific control RNA (D-F)
returned similar results, for all time points analysed: (A, D) 24 hpa, (B, E) 48 hpa and (C, F)
72 hpa. hpa: hours post-amputation.
3.2. V-ATPase inhibition affects adult caudal fin regeneration
To investigate the regeneration-specific role of V-ATPase H+ pump, we used different
functional approaches with the common goal of knocking down V-ATPase function.
The results from those assays will be described next.
3.2.1. Effect of atp6v1e1b knockout in larval fin fold regeneration
The use of gene- specific transgenic or mutant fish is probably the most direct way of
assessing that gene’s function. Taken that, we used the zebrafish V-ATPase mutant
line atp6v1e1bhi577aTg/+ (AB), which is commercially available at the Zebrafish
International Resource Center (ZIRC), to investigate the functional role of the VATPase during regeneration. atp6v1e1bhi577aTg/+ (AB) is a recessive retrovirus-
inserted mutation. Homozygous embryos exhibit profound developmental defects,
including reduced pigmentation, decreased otolith and body size, skeleton shape
deficiencies at the mandibular and pharyngeal arches, disrupted sensory system and
Page | 125
Chapter III - Results
reduced response to external stimuli (Golling et al 2002). Distinction from AB wild
type embryos is easier from 2 days post-fertilization (dpf) on, when the previous
phenotypic changes start to accumulate (Fig. III.19). V-ATPase subunit knockout
becomes lethal around 6 dpf (Nuckels et al 2009), long enough to study the effects of
the gene knockout in the larval fin fold. In fact, many evidences suggest that
regeneration of adult and larval caudal appendage follow similar mechanisms
(Kawakami et al 2004, Yoshinari et al 2009, Kawakami 2010). Taken that, we
amputated the fin fold of 2 dpf atp6v1e1bhi577aTg/- mutants as well as wild type (AB)
fish and then compared the regenerate area with uncut fin folds of the same
genotype. At 5 dpf, the uncut mutant larvae were underdeveloped and had a smaller
fin fold than the uncut wild type (Fig. III.20A, C, E p<0.05, independent T-test). In the
regenerated fin folds there were no additional phenotypic differences between the
two fish lines, although both mutant and wild type regenerated fin folds had a
rougher appearance than their uncut siblings (Fig. III.20, compare A-B, C-D). There
was also no significant difference in the regenerated fin fold area compared to the
uncut (control), for both wild type and mutants (Fig. III.20E, p>0.05, independent Ttest). Overall, these results suggested a normal larval regeneration process in the
absence of V-ATPase.
Figure III.19 – Phenotypic characterization of V-ATPase- mutant zebrafish embryos
and larvae. (A-C) atp6v1e1bhi577aTg -/- mutants exhibit many developmental defects, including
reduced pigmentation and decreased body size. (D-F) AB wild type zebrafish. dpf: days postfertilization.
Page | 126
Chapter III - Results
Figure III.20 – Larval fin fold regeneration in wild type and V-ATPase mutant zebrafish
embryos/larvae. (A, C) Uncut (control) larval fin fold of atp6v1e1bhi577Tg-/- mutants and wild
type (AB) zebrafish, respectively, at 5dpf. (B, D) Regenerated fin fold of atp6v1e1bhi577Tg-/mutant and wild type (AB) zebrafish, respectively, at 5dpf. The fin fold had been amputated at
2 dpf. Note that regeneration occurred normally in the absence of V-ATPase (compare B with
D). (E) Area of uncut and regenerated fin fold was similar, for either fish lines, at 5 dpf. (*):
p<0.05, independent T-test. dpa: days post-amputation.
3.2.2. Pharmacological inhibition of V-ATPase activity in the regenerating
caudal fin
To assess the functional significance of the V-ATPase during adult fin regeneration,
we used Concanamycin A (concA), a specific inhibitor that blocks V-ATPase activity
by binding to the V 0 c subunit (Huss et al 2002). First, we tested concA in AB wild type
embryos and larvae in order to test its toxicity and specificity. Fish incubated from
fertilization until 3 dpf in 0.01-0.5 % DMSO (used as concA solvent) developed
normally and had a survival rate similar to non-treated control embryos (Fig. III.21A-
F, Fig. III.22A). On the other hand, 11% of the embryos incubated in 100 nM concA
Page | 127
Chapter III - Results
had reduced pigmentation at 2 dpf, and by 3 dpf 53% of them had decreased head
and body size, and very reduced mobility and escape response to touch (Fig. III.21M-
O). Such abnormalities were similar to those found in V-ATPase mutant embryos
(chapter III: section 3.2.1; Fig. III.19). Exposure of embryos to lower concA
concentrations (10 or 50 nM) wasn’t enough to produce a phenotype (Fig. III.21G-L),
whereas concA concentrations higher than 100 nM (250 or 500 nM) were too toxic,
causing 100% mortality by ≤3 dpf (Fig. III.21P-R). These results confirmed that the
fish response to concA was specific and not a consequence of DMSO exposure. Doseresponse curves also showed that 100 nM was the concA dose that produced the most
specific effects while maintaining a low mortality level (Fig. III.22B).
Based on this, we chose 100 nM concA as the starting concentration in our assays to
inhibit V-ATPase activity in adult caudal fins. Six caudal fins were amputated at the
distal plane; concA was microinjected in one half of the fin every 12 h from 6 to 42
hpa, and the other half received the DMSO control (0.1%) at the same frequency. A
comparison of the regenerated area in both regions of the fins showed that V-ATPase
inhibition slightly reduced the regenerating area for the first 48hpa (Fig. III.23A-A’’,
D). In 50% of the fins such decrease was ≥10%, but it was not statistically significant
(p>0.05, paired T-test). Thus, we tested two higher drug concentrations - 500 nM and
1 µM - in an attempt to increase the phenotype. Treatment of fins with 500 nM concA
extended the period of decreased regenerated area at least until 72 hpa (Fig. III.23B-
B’’, D), but only 16% of the fins maintained an area reduction ≥10% for the entire
time-window. Unexpectedly, further increase of concA concentration to 1µM led to
the phenotype disruption, with the average regenerated area oscillating between
higher and smaller area than the fin region treated with the DMSO control (Fig.
III.23C-C’’, D).
For all concA treatments tested, the variability of the results was high, as showed by
the large bars of standard error of the mean in Fig. III.23D. That likely contributed to
the lack of statistically significance of the results. Nevertheless, we could depict a
tendency for decreased regenerative outgrowth in areas treated with the V-ATPase
activity inhibitor. This was more obvious at 48 hpa, which is precisely the time point
Page | 128
Chapter III - Results
at which we expected the greatest concA outcomes, due to the cumulative effect of the
four microinjection rounds that ended at 42 hpa.
Figure III.21 –Effects of Concanamycin A (concA) in the embryonic development of AB
wild type zebrafish. Incubation of embryos, since fertilization, in (A-C) embryo medium, (DF) 0.5% DMSO (concA solvent) or (G-L) concA at 10 nM or 50 nM didn’t affect embryonic
development. Treatment with (M-O) 100 nM concA induced developmental abnormalities
typical of V-ATPase activity impairment, confirming the specificity of the drug for the V-APase
at this dose. Higher concA concentrations (P-Q) 250 nM and (R) 500nM were toxic. dpf: days
post-fertilization.
Page | 129
Chapter III - Results
Figure III.22 – DMSO and Concanamycin A (concA) dose-response curves for larval
zebrafish mortality, survival and abnormal phenotype, at 72 hours post fertilization.
Embryos incubated in (A) DMSO (%: 0.01, 0.05, 0.1, 0.25, 0.5) and (B) concA (nM: 10, 50, 100,
250, 500). 100nM concA was the optimal dose: it gave the best abnormals:mortality ratio.
Page | 130
Chapter III - Results
Figure III.23 – Inhibition of V-ATPase activity in the regenerating caudal fin using
concA. ConcA at (A-A’’) 100 nM, (B-B’’) 500 nM and (C-C’’) 1 µM. (D) Relative area (%) of
concA treated regions was not significantly different from the DMSO (control) treated
regions. p>0.05, paired T-test. hpa: hours post-amputation.
3.2.3. Morpholino-mediated knockdown of atp6v1e1b in the regenerating
caudal fin
To knockdown V-ATPase at the mRNA level, we blocked the expression of the V-
ATPase cytosolic subunit atp6v1e1b, using three different atp6v1e1b- specific
fluorescein-tagged morpholinos (fluo-MOs-1/2/3, Table II.8). We first tested the
atp6v1e1b- specific fluo-MOs toxicity and specificity in embryos, through
microinjection into one-cell stage fish. The cytoplasmic bridges connecting these
early embryonic cells allow rapid diffusion of the hydrophilic fluo-MOs, resulting in
ubiquitous delivery (Bill et al 2009). Control-fluo-MOs (cfluo-MO) did not affect
embryonic development, as all injected and non-treated embryos had normal
phenotype and behaviour (Fig. III.24A-F, M). None of the fluo-MOs seemed toxic at the
concentrations tested, since mortality rate didn’t increase with the concentration of
neither atp6v1e1b- specific fluo-MO or cfluo-MO (Fig. III.24J, L). On the other hand, all
three atp6v1e1b fluo-MOs were specific for the V-ATPase, as the induced morphant
phenotype resembled that of mutant fish lacking the same V-ATPase subunit (chapter
III: section 3.2.1) (Fig. III.24G-I). Regarding atp6v1e1b fluo-MOs efficiency, it
increased with the concentration delivered and, importantly, it depended on the fluo-
MO sequence (Fig. III.24K). Fluo-MOs -1 and -3, which had completely nonoverlapping sequences, produced morphant rates that reached 80% and 86% of the
live embryos at 3 dpf, respectively, when delivered as 1 mM solution. Surprisingly,
fluo-MO-2, which only differed from fluo-MO-1 in six additional nucleotides at the
3’end, had a much lower efficiency: 37% of morphants.
Considering the previous results in embryos, all atp6v1e1b- specific fluo-MOs and
cfluo-MOs were delivered to amputated AB wild type adult caudal fins as 1 mM
solution. The MO and the control MO were microinjected in opposite halves of the fin
2 or 16 h after amputation at the distal plane, and the whole fin was then
Page | 131
Chapter III - Results
electroporated. The regenerated area in both regions of the fin was compared. In
average, delivery of atp6v1e1b- specific fluo-MO-1 at either 2 or 16 hpa decreased the
regenerated area between 24 and 72 hours post- injection (hpi) (Fig. III.25A-A’’, D-D’’,
G, H). In 30-40% of the fish, the regenerated area was at least 10% smaller than in the
control. atp6v1e1b knockdown with fluo-MO-3, at either 2 or 16 hpa, produced a
pattern similar to fluo-MO-1 for the first 48 hpi. For that period, 30-50% of the fins
had a regenerate area reduction ≥10%, and then the pattern was inverted (Fig.
III.25C-C’’, F-H). Despite this general regeneration impairment with either fluo-MO,
results only met statistical significance for treatments performed at 16 hpa (p>0.05,
paired T-test) (Fig. III.25 G-H). Finally, the effect of atp6v1e1b fluo-MO-2 in the
regenerating fin was unclear, oscillating between increased and reduced regenerate
area (Fig. III.25B-B’’, E-E’’, G, H). An aspect common to all treatments with atp6v1e1bspecific fluo-MOs was the high standard errors of the mean (Fig. III.25 G-H), indicative
of variability in the results.
In sum, atp6v1e1b knockdown using fluo-MOs induced a significant reduction in the
regenerated area, reinforcing the results previously obtained using concA (chapter
III: section 3.2.2). These data further suggest a role for the V-ATPase during
regeneration. Particularly, V-ATPase knockdown seems to affect the regeneration
rate more that the regenerative ability itself, as, despite the reduced area,
regeneration still progressed.
Page | 132
Chapter III - Results
Figure III.24 – Analysis of the specificity and toxicity of atp6v1e1b-specific fluoresceintagged morpholinos (fluo-MO), in zebrafish embryos. Visual inspection (A-I) and doseresponse curves for zebrafish mortality (J, L) and abnormal/morphant phenotype (K-M)
revealed that embryos not injected (A-C) or injected at one-cell stage with control-fluo-MO1/2/3 (D-F, L-M) developed normally. Embryos injected with atp6v1e1b- specific fluo-MO1/2/3 (G-I, J-K) had abnormal development, confirming fluo-MOs specificity for the V-APase.
All fluo-MOs had low toxicity, as they did not increase mortality (J, L), dpf: days postfertilization.
Page | 133
Chapter III - Results
Figure III.25 – atp6v1e1b knockdown during fin regeneration, using fluoresceintagged morpholino (fluo-MO). atp6v1e1b fluo-MO-1 (A-A’’, D-D’’), atp6v1e1b fluo-MO-2 (BB´´, E-E’’) and atp6v1e1b fluo-MO-3 (C-C´´, F-F’’) and corresponding control fluo-MOs-1/2/3
(cfluo-MOs) delivered as 1mM solution at (A-C’’) 2 hpa or at (D-F’’) 16 hpa. (G-H) Relative
regenerate area (%) of fin regions treated with atp6v1e1b fluo-MO-1/2/3 compared to the
Page | 134
Chapter III - Results
regions delivered with the cfluo-MO. MOs delivered at 2 hpa (G) or 16 hpa (H). atp6v1e1b
fluo-MOs-1 and -3 decreased the area of regenerated tissue. (*) p<0.05, paired T-test.
hpa/hpi: hours post-amputation/injection.
Discussion
Proton translocators are up-regulated during caudal fin regeneration
The current advances in molecular biology and imaging techniques promise to enable
a radical advance in our understanding of the integration of biophysical and
biochemical control mechanisms (Levin 2007). For instance, the downstream effects
of ion flows have been suggested to depend on the precise transporter(s) involved,
indicating that not only the type of ion but also the dynamics of its movement may act
as signals (Levin 2007). So far, it was found that the H+ pump V-ATPase and the
voltage-gated Na+ channel NaV1.2 are essential for the regeneration of Xenopus larvae
tail (Adams et al 2007, Tseng et al 2010), and that the H+,K+-ATPase is required for
planarian head regeneration (Beane et al 2011). Nevertheless, evidence for
conservation of these mechanisms in other models, including adult vertebrates, is still
lacking, and so is the discovery of additional ion fluxes and corresponding ion
translocators relevant for regeneration. In that regard, in part 2 of chapter III, we
showed that at least H+ efflux is induced during adult vertebrate appendage
regeneration, likely by the controlled activity of H+ translocators; and in this part 3 of
chapter III, we assessed the molecular basis of actively generated ion fluxes during
appendage regeneration in an adult vertebrate model.
We used a microarray (Affimetrix) to assess the gene expression in the different
stages of zebrafish caudal fin regeneration. This genome array technique provides the
foundation to quickly identify new genes and pathways involved in specific
mechanisms of interest (Schesbesta et al 2006). In fact, previous studies have
successfully used this and other large-scale analysis approaches to generate a
comprehensive and detailed database of differentially expressed genes during
zebrafish fin regeneration (Padhi et al 2004, Schesbesta et al 2006, Mathew et al
2009). Notwithstanding, a careful analysis of the ion translocators expression had
Page | 135
Chapter III - Results
never been performed. We were particularly interested in H+ translocators that could
mediate the regeneration-associated H+ efflux detected using SIET. We found one
major candidade H+ transporter: the H+ pump V-ATPase, which was up-regulated at
least between 24 and 96 hpa. Importantly, the time period of V-ATPase up-regulation
agreed with the H+ efflux previously detected, suggesting that the regeneration-
associated H+ extrusion could be associated to the increased V-ATPase expression.
Nhe7 was another candidate due to its up-regulation time window and interaction
with V-ATPase in several cellular functions.
Other H+ transporters identified as up-regulated in the array were slc16a1 and
slc16a3. We did not considered them to be good candidates to mediate the H+ efflux
previously detected, due to the non-overlapping time points of the establishment of
transcripts up-regulation and H+ efflux. However, recent studies have showed that
MCT1 (Slc16a1) and MCT4 (Slc16a3) are involved not only in cell migration but also
in cell proliferation, deddiferentiation and maintenance of the undifferentiated state
(Gallagher-Colombo et al 2010, Washington et al 2013, Zhu et al 2014). Since all these
cell behaviours are required during regeneration, it would be interesting to assess, in
future work, the role of these H+/solute co-transporters in appendage regeneration.
Despite the great data provided by the microarray, it is important to keep in mind
that other ion transporters might have been missed from this analysis due to the
limitations of the technique. Even though Affimetrix zebrafish microarray includes
over 14900 transcripts, many of these transcripts correspond to yet unknown genes.
Besides, this genome array covers roughly one-third of the estimated zebrafish
genome (14900 transcripts), which means that two-thirds of the genome is left out of
the analysis (“GeneChip® Zebrafish” 2004). Therefore, as the zebrafish genome is
unveiled and new large-scale techniques become available, additional molecules
relevant for regeneration may be found, including ion translocators. Another critical
aspect is that microarray screens only take into account the transcription level fold-
change. Several ion transporters can be present in the tissues in the active/inactive
form, and simply switch to the opposite configuration (inactive/active) upon
stimulation (amputation), without need for further gene transcription. Consequently,
such molecules would be missed in a microarray experiment.
Page | 136
Chapter III - Results
V-ATPase is up-regulated in the regenerating fin tissue and is a candidate
molecular source for the regeneration associated- H+ efflux
The expression pattern of V-ATPase and also Nhe7 was further assessed using whole
mount in situ hybridization of antisense RNA probes and whole mount
immunohistochemical detection of specific antigens using targeted antibodies. These
are two powerful techniques for examining the overall and dynamic domain of
expression of the molecules of interest (genes or proteins, respectively) in time and
space (Lodish et al 2004). It has been proposed that the two techniques have limited
capacity to detect molecules expressed in the intra-ray mesenchyme of zebrafish
caudal fins or in the equivalent region in regenerating fins, because the bone matrix of
the growing lepidotrichia constitute a physical barrier to the penetration of reagents
including anti-sense RNA probes and antibodies (Smith et al 2008). Nevertheless,
both techniques have been extensively applied to the zebrafish caudal fin, and have
successfully identified several molecular factors involved in each step of the fin
regeneration, in both the external and internal sides of the bone matrix (Akimenko et
al 1995, Blum and Begemann 2011, Borday et al 2001, Hoptak Solga et al 2008,
Laforest et al 1998, Lee et al 2009, Mathew et al 2009, Poss et al 2000b, Stoick-Cooper
et al 2007b, Whitehead et al 2005).
We were not able to confirm the up-regulation of Nhe7 in the regenerating tissue, at
neither mRNA nor protein levels, even though the accuracy of our microarray had
been confirmed by qRT-PCR experiments and comparison to published microarray
datasets. NHE7 is one of the nine isoforms of the electroneutral Na+/H+ exchanger
(Slc9a or NHE), all of which share a conserved secondary structure of transmembrane
segments at the N terminus (Orlowski and Grinstein 2003, Nakamura et al 2005).
Therefore, our microarray results regarding slc9a7 could be masked by cross-
hybridization of related genes from the same family (Rajeevan et al 2001). In fact,
other members of the NHE family have been suggested to have a role in mechanisms
necessary for regeneration: at least NHE1 is required for cell migration (Clement et al
2013, Ludwih et al 2013), and NHE2 may be involved in Wnt signalling (Cruciat et al
2010). Another hypothesis for the observed lack of regeneration-specific Nhe7
staining is the presence of flaws in the experimental protocols, including poor RNA
probe design for in situ hybridization and lack of antibody specificity for the
Page | 137
Chapter III - Results
immunohistochemical detection. In effect, the anti-SLC9A7 was raised against the
human protein, and was only predicted to react to the zebrafish antigen.
V-ATPase expression in the regenerating caudal fin was confirmed by both in situ
hybridization and immunohistochemical staining. Results from both transcript and
protein expression analysis showed that V-ATPase expression domain was in close
association with the blastema, since it accompanied the formation and expansion of
the blastema along the proximal-distal axis, between 24 and 48 hpa. In fact, Atp6v1a
localization to the blastema cells was evident, and confirmed by the absence of co-
staining with pan-Cadherin.
Around 48 hpa the blastema segregates into the non-proliferative distal blastema
(DB), and the highly proliferative proximal blastema (PB) (Nechiporuk and Keating
2002). V-ATPase seemed to be present in the PB, as it localized to a large portion of
the blastema that had the amputation plane as its proximal limit. Since PB and DB
express distinct sets of regeneration-associated genes (Poss et al 2002, Poss et al
2003), it is unlikely that the V-ATPase is also up-regulated in the DB. Importantly, the
cells in the PB are the ones that differentiate into the missing tissues; and
hyperpolarization has been associated to cell differentiation and cell cycle exit in
other systems, including the differentiation of mesenchymal stem cells into the
osteogenic lineage (Konig et al 2004, Sundelacruz et al 2008). Thus, the V-ATPase,
through its H+ extrusion activity, could well be contributing to hyperpolarization in
the PB, in order to induce cell differentiation. In fact, V-ATPase function has been
proposed to be required for retinoblasts exit from the cell cycle and differentiation at
appropriate time (Nuckels et al 2009). This would also agree with the suspected V-
ATPase absence from the DB, since the cells in the DB are kept in an undifferentiated
state, which is an electrical condition typically associated to membrane
depolarization in other systems (Chiabrera et al 1979, Echeverri and Tanaka 2002,
Odelberg 2002, Levin 2012).
Still regarding V-ATPase expression pattern, we noticed that transcript and protein
localization was not coincident at 72 hpa, when the patterning zone (PZ) develops
between the PB and the amputation plane. Transcripts seemed to localize to the PB,
Page | 138
Chapter III - Results
whereas the protein localized more strongly in the PZ. Indeed, this distribution fits
the hypothesis described above regarding a relation between V-ATPase,
hyperpolarization and cell differentiation. As so, we propose that during the
regenerative outgrowth, V-ATPase transcripts accumulate in the cells of the PD, and
translation into protein occurs as the cells enter the (PZ) where they progressively
stop producing transcripts and differentiate into the “new” tissues.
During regenerative outgrowth, V-ATPase also stained small groups of cells aligned
parallel to the amputation plane. A similar pattern has been described for Connexin
43, a gap junction subunit, at both mRNA and protein levels. Particularly, cx43/Cx43
is up-regulated in subpopulations of osteoblasts at the bone segments boundary, and
it seems to regulate osteoblast differentiation and joint morphogenesis during
regeneration (Iovine et al 2005, Sims et al 2009). In fact, it was showed that Cx43
enhances osteogenic differentiation of bone marrow stromal cells by facilitating
BMP7 uniform distribution between cells (Rosselo et al 2009). Interestingly, in the
intact fin we did not find a specific V-ATPase staining at neither segment joints or
lepidotrichia, which suggests that V-ATPase expression is required only when “new”
tissues are being formed. Taken altogether, it would be interesting to assess the
relation between V-ATPase, cx43 and osteoblasts differentiation.
Regarding the cellular localization of the V-ATPase, it is known that this H+ pump is
present at the membrane of intracellular compartments in virtually all animal cells
(Marshansky et al 2014). In addition, it is also expressed at the plasma membrane in
some specialized cell types, such as intercalated cells in the kidney, osteoclasts and
the clear cells of the male reproductive tract (Breton and Brown 2013, Roy et al
2013, Matsumoto et al 2014,), or upon specific events, such as cell migration and
invasion (Sennoune and Martinez-Zaguilan 2007). Here, V-ATPase presence at the
plasma membrane still remains to be confirmed. Noteworthy, Atp6v1a, which was
detected, is a cytosolic subunit of the H+ pump. As so, it functions as part of a
membrane complex that is regulated by assembly/disassembly of its components,
and a pool of subunits is always present in subcellular membranes and in the cytosol.
Thus, it is possible that only a few copies of this pump are acting at the plasma
membrane and become masked by the intracellular staining.
Page | 139
Chapter III - Results
V-ATPase is not required for larval fin fold regeneration
To study V-ATPase function during appendage regeneration we took advantage of a
V-ATPase mutant zebrafish line that is commercially available, in which the mutation
localized to the atp6v1e1b subunit, the most up-regulated V-ATPase subunit
according to our microarray results. This way, we avoided gene targeting strategies
that, despite the invaluable contribute to the understanding of genes’ functions, are
often lengthy and difficult to implement (Cerda et al 2006, Griep et al 2011).
The knockout of any single V-ATPase subunit at the whole organism level is always
embryo lethal due to its relevance during embryonic development (Chung et al 2010,
Golling et al 2002, Adams et al 2006, Nuckels et al 2009). Thus, instead of studying
the adult fin, we investigated the regeneration of the larval fin fold, which has been
suggested to depend on the same mechanisms than the adult appendages (Kawakami
et al 2004, Yoshinari et al 2009, Kawakami 2010). In the wild type embryos, V-ATPase
was not detected in the median fin fold by in situ hybridization, suggesting that it is
not required for the development of the unpaired fins. In fact, in the V-ATPase mutant
larvae, the caudal fin fold developed and regenerated normally. One could easily
interpret these data as an indication that V-ATPase should not be required for the
regeneration of the caudal fin as well. However, it was recently proposed that the fin
fold blastema is not a classical blastema as observed in the adult system, since it does
not have a specific function for proliferation (Mateus et al 2012). Thus, regeneration
of the adult and larval caudal appendages in zebrafish are distinct processes and
should be studied as separate and independent mechanisms.
V-ATPase knockdown affects adult caudal fin regeneration
To study V-ATPase function during adult caudal fin regeneration it was essential to
perform localized gene knockdown in that structure, while the rest of the animal
remained unperturbed (Cerda et al 2006). Conditional mutagenesis allows a precise
tissue-specific and time-restricted analysis, but this technique is lengthy and
dependent on having appropriate promoters, which are often not available (Cerda et
Page | 140
Chapter III - Results
al 2006, Halpern et al 2008). An alternative method was the localized delivery of VATPase inhibitors to the caudal fin, followed by phenotype analysis.
Currently, a handful of specific inhibitors of the V-ATPase are known and represent
valuable tools for the characterization of V-ATPase function (Bowman and Bowman
2005, Huss and Wieczorek 2009). Among them are the plecomacrolide antibiotics,
which offer the greatest advantages: they are commercially available, inhibit all
known eukaryotic V-ATPases, and have been studied thoroughly, including a detailed
description of their structure and inhibitory function(Bowman and Bowman 2005,
Dröse and Altendorf 1997). Concanamycin A (concA) is the most stable
plecomacrolide (Bowman et al 1997). It binds to V-ATPase subunits c, inhibiting the
ion pump by preventing the rotation of the H+ translocating subunits (Bowman and
Bowman 2002, Huss et al 2002, Wang et al 2004). Importantly, its effectiveness and
specificity has been confirmed in vivo (Bowman et al 2004). In fact, concA has up to
20 times the inhibitory effect on the V-type ATPase compared to bafilomycin A1,
which is another plecomacrolide extensively used to inhibit the V-ATPase (Dröse et al
1993, Bowman and Bowman 2002).
ConcA inhibit the V-ATPase in vivo at a large range of concentrations that typically
goes from 5 nM to 1 µM, depending on the target organism (uni- or multicellular) and
on the drug delivery route (eg. dilution in the extracellular medium, microinjection)
(Adams et al 2007, Bowman et al 1997, Dröse and Altendorf 1997). In Xenopus
tadpoles, V-ATPase inhibition using 150 nM concA in the bathing water impaired tail
regeneration without affecting general embryogenesis, wound healing or primary tail
development (Adams et al 2007). In the present work, exposure of the regenerating
fin tissue to 100-500 nM concA produced a small decrease in the area of regenerated
tissue.
The technical constrains of the experimental approach used for concA delivery to the
caudal fin likely contributed to the lack of a stronger phenotype: the fin had to be
subjected to several rounds of microinjection in order to overcome the rapid dilution
of the drug and the consequent decrease in effective concentration; on the other
hand, this may have disturbed tissue integrity. Nevertheless, it was the best
Page | 141
Chapter III - Results
experimental approach that we found, since concA soaked beads did not hold in the
fin, and drug dilution in the bathing water could affect the whole fish rather than
having a localized, regeneration-specific effect. Besides, the cost of inhibiting V-
ATPase via concA dilution in the bathing water would be an undue expense, since we
worked with adult fish that required large volumes of bathing water, and thus large
amounts of the drug.
Delivery of high concA concentration (1 µM) disrupted the detected phenotype. This
was possibly due to the toxic effects of the high drug solvent (DMSO) concentration in
that solution (1% DMSO), since DMSO concentrations above 0.1-0.3% are prone to be
toxic to cells, inducing changes in cell morphology and membrane properties, and
modification of the normal cell cycle, differentiation and apoptosis programs (Larsen
et al 1996, Santos et al 2003). Another possibility is that at 1 µM, concA became
unspecific. In fact, concA is highly specific for V-ATPases only at nanomolar
concentrations; at micromolar concentrations the antibiotic can also inhibit some Ptype ATPases. Therefore, to exclude non-specific effects, only nanomolar
concentrations of the plecomacrolide should be used (Bowman and Bowman 2002,
Dröse and Altendorf 1997).
Another great method to enhance our knowledge on gene function is the use of
antisense RNA technologies, which are far more fast, easy and cheap than
transgenesis and gene targeting techniques (Eisen and Smith 2008, Kurreck 2003,
Achenbach et al 2003). Morpholino oligos (MOs) are the most common anti-sense
‘‘knockdown’’ technique used in zebrafish, and their application to the adult caudal
fin has provided direct evidence for a functional role for several molecules in the
regeneration
including miR-133,
msxb,
fgfr1,
hox13a,
hox13b,
connexin43,
semaphorin3d, igf2b, simplet, notch1b, jag1b, lfng, rbpjκ (Thummel et al 2006,
Thummel et al 2007, Yin et al 2008, Hoptak-Solga et al 2008, Kizil et al 2009, Chablais
and Jazwinska 2010, Quynh and Iovine 2012, Münch et al 2013). This method has
significant advantages over conventional oligonucleotides such as RNAi and antisense
oligonucleotides (RNA or DNA), including higher stability and decreased toxicity and
off target effects (Eisen and Smith 2008).
Page | 142
Chapter III - Results
We used three fluorescein-tagged MOs (fluo-MOs) to knockdown V-ATPase subunit
atp6v1e1b in the regenerating caudal fin. Delivery of either fluo-MO-1 or -3 reduced
the amount of regenerated tissue. The results were more significant when the
atp6v1e1b knockdown was performed at 16 hpa rather than at 2 hpa, suggesting that
V-ATPase is required for regeneration in stages later than the wound healing.
Regarding the accuracy of these results, it is important to note that the chance of
different MOs yielding the same off-target effect is considerably low. Thus, the fact
that the two fluo-MOs caused similar regeneration impairment increased the
confidence that they really shed light on the function of the intended target gene
(Eisen and Smith 2008). Besides, it is unlikely that the phenotype was a consequence
of tissue disruption by the microinjection and electroporation procedures, since the
controls were located in the same fins than the treatment, and were subjected to the
same invasive procedures. In addition, the lack of stronger statistical significance
could well be due to technical difficulties that do not compromise the accuracy of the
phenotype. Particularly, and despite previous groups have reported the successful
electroporation of DNA into fin tissue (Tawk et al 2002, Thummel et al 2006, HoptakSolga et al 2008), a more recent report has stressed the fact that electroporation of
plasmids into the regeneration tail fin is sometimes inconsistently achieved (Hyde et
al 2012). Accordingly, technical difficulties regarding MO electroporation have also
been reported in the chicken (Norris and Streit 2013).
Regarding fluo-MO-2, it did not produce clear morphological changes in the fin at the
concentration used (1 mM). This agrees with the fact that it was the least efficient
fluo-MO regarding the ability to produce morphant embryos. In fact, the knockdown
efficiency of MOs varies to a great degree and so it is common that the optimal dose
will vary between MOs, even when they target same gene (Kamachi et al 2008, Bill et
al 2009). Thus, increasing the delivery concentration of fluo-MO-2 would most likely
result in regeneration impairment. Even so, we chose to avoid the use of fluo-MOs at
concentrations beyond the manufacturer recommendations (1 mM), that could
increase solubility problems of the oligo (https://www.gene-tools.com/morpholino
antisense_oligos).
Page | 143
Chapter III - Results
Overall, in this chapter we showed, by three different approaches (microarray, in situ
hybridization and immunohistochemical staining), that V-ATPase is specifically up-
regulated during regeneration. More, genetic (fluo-MOs) and pharmacological
(concA) blockage of V-ATPase function in the caudal fin decreased the amount of
regenerated tissue, suggesting that V-ATPase function is required for normal
regeneration rate. Importantly, both V-ATPase expression and H+ efflux intensity
seem stronger during blastema formation and decrease thereafter, suggesting a
causal relation.
Page | 144
Chapter III - Results
Part 4 - Roles of V-ATPase and H+ efflux in the regenerative
process
4.1.
V-ATPase
expression
correlates
with
position-dependent
regeneration rate and affects H+ efflux
The adult zebrafish caudal fin can undergo different regeneration rates
simultaneously, depending on the amputation position at the proximal-distal axis of
the fin exoskeleton: the more proximal the amputation, this is, removal of a bigger
portion of the fin, the higher the regeneration rate. As a result, it always takes the
same time for a fin to regenerate, independently of the amputation plane (Fig. III.26).
We took advantage of this property to investigate the possible relationship between
V-ATPase and regeneration rate, that we suggested based on the results in parts 2
and 3 of the present chapter. In addition, we further assessed the proposed causal
relationship between V-ATPase and H+ efflux. All the results are described next. Note
that in this section 4.1, each fin was amputated at proximal and distal planes
simultaneously (PD amputation), which minimized the intra-specific variability and
increased the confidence of the results.
Figure III.26 – Regeneration of zebrafish caudal fin after proximal-distal (PD)
amputation. Regeneration is complete at the same time, regardless the amputation plane
along the proximal-distal axis of the fin. Several regeneration stages are showed: (A) 1 dpa;
(A’) 3 dpa; (A’’) 6 dpa; (A’’’) 14 dpa. dpa: days post-amputation. P indicates proximal
amputation plane and D indicates the region of distal amputation.
Page | 145
Chapter III - Results
4.1.1. atp6v1e1b expression pattern during regeneration after proximal-distal
(PD) amputation
Upon amputation at the proximal plane, atp6v1e1b was first visible around 12 hpa in
the ray segment just below the amputation plane, and to a smaller extent in the inter-
ray (Fig. III.27A, A’). Expression at the distal stump only became evident at 24 hpa, in
the regenerating region immediately above the amputated rays, where the blastema
is forming (Fig. III.27A’’, B, B’’). By that time (24 hpa) atp6v1e1b domain in proximal
stumps was much stronger and wider in the blastema- forming region (Fig. III.27B’),
suggesting a greater amount of atp6v1e1b mRNA compared to distal stumps. At 48
hpa, when blastema maturation is complete, the proximal and distal differences in the
strength of atp6v1e1b signal had faded, even though the transcript domain was still
wider along the proximal distal axis of proximal stumps (Fig. III.27C-C’’). From then on
transcripts expression progressed as described (chapter III: section 3.1.2.3; Fig. III.13).
Figure III.27 – atp6v1e1b is differently up- regulated during regeneration of caudal fin
after PD amputation. In situ hybridization for atp6v1e1b performed at (A) 12 hpa, (B) 24
Page | 146
Chapter III - Results
hpa and (C) 48 hpa, in fins amputated at proximal-distal (PD) plane. (A’, B’, C’) Detail of
proximally amputated regions in A, B, and C. (A’’, B’’, C’’) Detail of distal amputations of A, B,
and C. atp6v1e1b expression started earlier and was stronger in proximal stumps than in
distal ones.P: proximal amputation plane. D: distal amputation. hpa: hours post-amputation.
4.1.2. Immunolocalization of Atp6v1a during regeneration after PD amputation
The V-ATPase expression pattern after PD amputation was also compared at the
protein level, using anti-ATP6V1A. Overall, Atp6v1a staining pattern was similar at
both amputation planes (Fig. III.28A-F), and is described in chapter III: section 3.1.2.4.
Briefly, Atp6v1a was present in the blastema between 24 and 48 hpa, and it the
patterning zone and segment joints at 72 hpa. However, there were important
differences in the length of the staining domain in proximal versus distal regenerates.
At 24 hpa, Atp6v1a staining domain extended for 53.90 ± 5.15 µm long (mean ±
s.e.m.) at proximal stumps, compared to the 29.16 ± 5.02 µm long at the distally
amputated regions (Fig. III.28A, D, G, Fig. III.29). In other words, Atp6v1a domain in
proximal stumps covered almost twice the regenerate length than in the regions
amputated distally, in a proximal:distal length ratio of 1.84±0.17 (mean ± s.e.m.). At
48 hpa, the protein domain was still 1.57±0.08 fold longer in proximal regenerates
(Fig. III.28B, E, G, Fig. III.30). By 72 hpa the proximal-distal differences in the length of
Atp6v1a staining domain were still significant (p<0.05, independent T-test), yet
noticeably smaller (proximal:distal length ratio= 1.14±0.04, mean ± s.e.m) (Fig.
III.28C, F, G) and became negligible from then on. These results agree with the greater
amount of V-ATPase in proximal stumps indicated by in situ hybridization in the
previous section.
The results described in this and the previous section suggested that V-ATPase has a
dynamic expression according to the level of amputation: for each regeneration time
point, the pump expression starts earlier and the expression domain is larger in the
proximal, fast regenerating regions, than in the slower regenerating distal wounds.
Page | 147
Chapter III - Results
Figure III.28 – Comparison of Atp6v1a domain in proximal versus distal regenerates.
Atp6v1a was present in a longer domain of regenerating tissue in proximal stumps than in
distal ones, as determined by visual inspection of the (A-F) immunohistochemical detection
(magnification10x) of Atp6v1a (green) at (A, D) 24 hpa, (B, E) 48 hpa and (C, F) 72 hpa, in
fins amputated at both (A-C) proximal plane and (D-F) distal plane, and by (G) measurement
of the Atp6v1a domain length in proximal (red) and distal (blue) stumps. (*): p<0.05,
independent T-test. hpa: hours post-amputation.
Page | 148
Chapter III - Results
Figure III.29 – Detailed view of Atp6v1a blastemal domain in proximal stumps and
distal stumps at 24 hpa. Immunohistochemical detection of Atp6v1a 24 hours after PD
amputation, showing wider Atp6v1a domain in the region of blastema formation in (A-A’’’)
proximal stumps than in (B-B’’’) distal stumps. Blue: DAPI (nuclear staining). Green: Atp6v1a.
Red: rhodamin-phalloidin (F-actin staining). Magnification 40x. hpa: hours post-amputation.
Page | 149
Chapter III - Results
Figure III.30 – Detailed view of Atp6v1a blastemal domain in proximal stumps and
distal stumps at 48 hpa. Immunohistochemical detection of Atp6v1a 48 hours after PD
amputation, showing wider Atp6v1a domain in the blastema of (A-A’’’) proximal stumps than
that of (B-B’’’) distal stumps. Blue: DAPI (nuclear staining). Green: Atp6v1a. Red: rhodaminphalloidin (F-actin staining). Magnification 40x. hpa: hours post-amputation.
4.1.3 H+ flux pattern after PD amputation
Results from chapter III: parts 2 and 3 suggested V-ATPase as a contributor for the
regeneration-specific H+ efflux. If so, the dynamic expression of V-ATPase along the
PD axis should be accompanied by a concordant H+ efflux pattern. Thus, we assessed
H+ flux throughout regeneration after PD amputation, using SIET (Fig. III.31).
Page | 150
Chapter III - Results
The efflux peaked always at 24 hpa regardless the amputation plane. However, in
proximal stumps H+ efflux started earlier (3 hpa instead of 12 hpa) and was
significantly higher than in distal regions for each time-point (p<0.05, paired T-test).
Besides, proximal H+ efflux decreased more rapidly, since in both proximal and distal
regenerates, no net flux was re-established at the same time, by 5 dpa (Fig. III.31).
This agrees with the different onset and magnitude of V-ATPase expression at
proximal and distal stumps, reinforcing the correlation between H+ efflux and V-
ATPase and extending such correlation to the position-dependent regeneration rate.
Figure III.31 – H+ flux pattern during caudal fin regeneration after PD amputation. Fins
were amputated at the PD plane, and H+ flux was measured using SIET. H+ efflux started
earlier and was significantly higher in fin region amputated proximally (red) than in the fin
region amputated at a distal plane (blue). (*): p<0.05, paired T-test. 0 hpa corresponds to the
uncut, intact fin. hpa: hours post-amputation. dpa: days post-amputation.
4.1.3.1 H+ flux pattern using sedation methods alternative to Tricaine
All ion-specific flux measurements performed so far using SIET (chapter 3: parts 2
and 4) were done in the presence of the anaesthetic Tricaine, which acts by altering
Page | 151
Chapter III - Results
the gating properties of voltage-gated sodium channels (Hedrick and Winmill 2002).
Because SIET detects bioelectric signals based on ion movements, it was important to
understand if Tricaine was affecting overall ion dynamics and consequently biasing
the recorded ion fluxes. To test this, we repeated H+ flux recordings at several
regeneration time points after PD amputation, using agents that base their
anaesthetic power on mechanisms different than Tricaine. To find the appropriate
anaesthetic, we looked up the available literature. Clove oil, metomidate, 2-
phenoxyethanol, benzocaine, quinaldine and quinaldine sulphate are all frequently
used in fish (Ghanawi et al 2011). However, all of them act by interfering with the
normal activity of ion channels or transporters, (Sensch et al 2000, Musshoff et al
1999, Sieb et al 1995, Wang et al 1998, Cullen and Martin 1982), which is precisely
what we wanted to avoid. On the contrary, N-benzyl-p-toluene sulphonamide (BTS) is
a muscle relaxant that reversibly stops muscle contraction by specifically inhibiting
myosin II ATPase activity and myosin-actin interaction (Cheung et al 2002). BTS was
already used in zebrafish embryos and larvae to study muscle function (Dou et al
2008) and organization (Codina et al 2010), but to our knowledge it was never used
to immobilize adult fish. We tested the anaesthetic potential of BTS in adult zebrafish.
Unfortunately, adult zebrafish didn’t respond well to BTS: animals incubated in ≤ 2.5
mM BTS took at least 1 hour to become motionless and then they only survived for 4
minutes, a time-window too short for ion-specific flux recordings. At 4 mM BTS, it
only took 10 min for getting fish immobile, but the survival time-window decreased
even more, to a maximum of 2 minutes (Table III.10). Thus, in the context of our SIET
experiments in adult zebrafish, BTS was not a suitable alternative to Tricaine, and
could not be used.
In face of the lack of suitable chemical anaesthetics that could be used, we turned to
cold-shock (10ºC) as an alternative sedation agent. This method is recommended
when chemical anaesthetics are not desirable (“Guidelines of the Canadian Council on
Animal Care” 2004). The detected H+ flux profile upon PD amputation remained
unchanged compared to H+ flux recordings using Tricaine, with similar efflux
magnitude at each time point and amputation plane (p>0.05, independent T-test)
(Fig. III.32). Based on this, we concluded that Tricaine did not bias H+ flux detection
using SIET.
Page | 152
Chapter III - Results
Table III.10 – Response of fish to different BTS concentrations (mM)
BTS
Time to deep
Maximum survival
concentration anesthesia
time under
(mM)
(minutes)
anesthesia (minutes)
1
> 75
-
Recovery
time
(minutes)
2- 4
2.5
60
4
>10
4
10
2
>10
Figure III.32 – Tricaine does not affect the detection of extracellular H+ efflux during
regeneration of the caudal fin. Using either Tricaine or cold-shock to anaesthetize fish did
not change the magnitude or the pattern of H+ flux during regeneration after PD amputation.
p> 0.05, paired t-test. hpa – hours post-amputation.
4.1.4. H+ flux pattern after fin amputation at the caudal peduncle
The ability of the caudal fin to perform epimorphic regeneration is limited to the
exoskeleton. Fins amputated at the caudal peduncle, which includes endoskeleton,
musculature and scales, either cannot regenerate or give rise to a deficient fin with
abnormal shape and structure, that takes at least twice the time to form compared to
exoskeleton amputations (Akimenko et al 2003, Smith et al 2006, Shao et al 2009)
(Fig. III.33A-B). We took advantage of the different regenerative ability of the caudal
fin elements to further assess the relevance of the H+ flux to regeneration process. For
that, the caudal fin of 10 fish was amputated at the caudal peduncle and H+ flux was
assessed up to 90 dpa using SIET. Results were interpreted taking into account the
regenerative ability of the stumps. Our assumption was that if H+ efflux is required for
regeneration, than it should not be detected in non-regenerative caudal peduncles.
Page | 153
Chapter III - Results
In chapter III: section 4.1.3, we showed that in exoskeleton stumps, H+ efflux peaks at
24 hpa, when a blastema is forming. Then, it gradually decreases during regenerative
outgrowth and returns, by 5 dpa, to the low levels typical of intact fins, when a great
amount of “new” tissue is already present (Fig. III.31). In this section, we reveal that
in the caudal peduncle there was also a rise and fall of H+ efflux after amputation, but
with important differences compared to fin exoskeleton stumps.
Some caudal peduncles exhibited partial regenerative power (Fig. III.33A), but it took
much longer to produce the new tissues than upon exoskeleton amputation. In those,
H+ efflux peaked at 72 hpa (mean±s.e.m = 0.24±0.06 pmol/cm2/s), when the first
signs of new tissue began to appear; then rapidly decreased by 96 hpa (0.06±0.04
pmol/cm2/s) (Fig. III.33C). Between 7 and 10 dpa, when regenerating tissue was
finally evident (Fig. III.33A, C), there was a second H+ efflux increase, that peaked at
10 dpa (0.23±0.05 pmol/cm2/s). Interestingly, upon this second H+ efflux peak, the fin
tissue seemed to regenerate much faster (Fig. III.33A, compare panels from the first
week after amputation (upon cut- 7 dpa) with the panels from the second week (7-14
dpa). As a new, abnormal fin was forming, H+ efflux decreased gradually, and by 21
dpa it had returned to low efflux detected before amputation (0 hpa, 0.001±0.06
pmol/cm2/s) (Fig. III.33C).
In fins that did not regenerate at all upon caudal peduncle amputation (Fig. III.33B),
the first efflux peak was maintained from 48 hpa (0.26±0.06 pmol/cm2/s) until 96
hpa (0.28±0.07 pmol/cm2/s) (Fig. III.33C). Importantly, after a transient efflux drop
around 7 dpa (0.15±0.03 pmol/cm2/s), there was a second increase in the H+ outward
current, by 10 dpa (0.59±0.07 pmol/cm2/s), resembling what was detected for the
regenerating caudal peduncles. However, this efflux was 2.27- fold higher than the
first peak in the same fish, and 2.59- fold higher than in regenerating caudal
peduncles at the same time point and remained at high levels until 90 dpa, except for
a transient decrease at 60 dpa (Fig. III.33C).
Page | 154
Chapter III - Results
Figure III.33 – Analysis of caudal fin regeneration after amputation at the caudal
peduncle. Upon caudal peduncle amputation, fins were (A-A.5) unable to regenerate or (BB.7) regenerated an abnormal fin. (C) In both cases there were two peaks of H+ efflux. When
some fin tissue regenerated (green), H+ efflux decreased after the second peak, eventually
returning to the low levels detected before amputation (0 hpa). On the contrary, in nonregenerative caudal peduncles (purple), H+ efflux increased steeply upon the second peak,
and remained at high levels until 90 dpa. (*): p<0.05, independent T-test. hpa: hours postamputation. dpa: days post-amputation.
Page | 155
Chapter III - Results
Overall, different efflux patterns were established depending on the regenerative
potential of the remainder tissues upon amputation. These results argue in favour of a
role for H+ efflux during regeneration, and suggest that H+ efflux is not sufficient to
trigger regeneration. Instead, the caudal peduncle likely lacks other regeneration
factors that must act, together with the H+ efflux, to trigger regeneration.
4.1.5. H+ efflux is affected by V-ATPase subunit atp6v1e1b knockdown
To deepen the relation between V-ATPase activity and H+ efflux, we analysed the
effect of V-ATPase inhibition on H+ flux. For that, we used atp6v1e1bhi577aTg/+ (AB) fish
to perform an atp6v1e1b knockdown using a gene- specific vivo-MO (Table II.8). This
recent technology can penetrate cells without need of electroporation (GeneTools,
Vivo-Morpholino Information Sheet), hence eliminating a possible source of errors,
and was used with success to study zebrafish caudal fin regeneration (Chablais and
Jazwinska 2010). Briefly, atp6v1e1b vivo-MO was delivered to one half of the fin rays,
2 h after proximal or distal amputation. The other half of the fin received the control
vivo-MO. Then, H+ fluxes were recorded at main regeneration stages, using SIET.
Aside from the higher efflux intensity proximally, distal and proximal stumps had a
similar flux pattern: in the controls, H+ efflux intensity was maximal at 24 hpa and
then decreased gradually (Fig. III.34), similar to the described previously for AB wild
type fish (chapter III, sections 2.2 and 3.1.3). In the fin regions subjected to atp6v1e1b
knockdown, H+ efflux at 24 hpa decreased significantly compared to the controls
(p<0.05, paired T-test), confirming the causal relation between V-ATPase activity and
H+ efflux (Fig. III.34). Surprisingly, by 48 hpa the efflux pattern reverted compared to
the control: as the latter began its descendent path, the former increased significantly
(p<0.01, paired T-test) to a level that resembled the control efflux at 24 hpa for the
same amputation plane. Similarly, at 72 hpa the H+ efflux intensity was higher than in
the control (p<0.01, paired T-test), and was similar to the control efflux at 48 hpa, as
if there was a 24 h delay on flux intensity due to the transient vivo-MO effect. These
results strongly suggest that the level of H+ efflux is controlled by V-ATPase activity
and relevant for position- dependent regeneration.
Page | 156
Chapter III - Results
Figure III.34 – atp6v1e1b knockdown using vivo-MO affects H+ efflux during caudal fin
regeneration. atp6v1e1b knockdown in atp6v1e1bhi577atg/+ fish 2 h after (A) proximal or (B)
distal amputation, using vivo-MO (red and blue), significantly changed the level of H+ efflux
compared to the region of the same fin injected with the control vivo-MO (cvivo-MO) (grey):
decreased H+ efflux a 24 hpa and higher at 48 and 72 hpa. (*): p<0.05, paired T-test. hpa:
hours post-amputation
Overall, the results presented in this section 4.1 showed that the onset and intensity
of both V-ATPase expression and H+ efflux correlate with the different regeneration
rates at proximal and distal stumps. Furthermore, H+ efflux pattern varied according
to the regenerative ability of the stump tissues, and V-ATPase activity contributed to
the regeneration-associated H+ efflux. Taken together, these results suggest that V-
ATPase, as a role in position- dependent regeneration rate, by contributing to the
regeneration associated H+ efflux.
4.2. Histological comparison of the regenerating caudal fin after proximal
and distal amputation
We have suggested above that V-ATPase is involved in the PD differences in
regeneration rate. In addition, there could be differences in the amount and/or type
of cells present in proximal and distal stumps at each regeneration stage before a new
fin is completely formed, which could contribute to the PD differences in regeneration
Page | 157
Chapter III - Results
rate. In fact, a detailed histological comparison of the regenerating tissue after
amputation at proximal and distal regions of the fin exoskeleton is still lacking. To
investigate that, we used Hematoxylin-Eosin (H-E) staining and scanning electron
microscopy. Results are described next.
4.2.1. Hematoxylin-Eosin (H-E) staining of regenerating fins after PD
amputation
H-E staining is a widely used histological technique that eases the identification of
tissues and cell types. Nuclei are stained blue, whereas the cytoplasm and
extracellular matrix have varying degrees of pink staining (Fischer et al 2008).
Therefore, it was used to facilitate the comparison of the cellular composition of
regenerating caudal fins after proximal and distal amputation. There were many
similarities between the regenerating tissue of proximal and distal stumps. At 6 hpa,
when the wound healing is half-way through, the injured regions were covered by
epidermal cells loosely connected (Fig. III.35A, B). At 24 hpa, when the blastema is
forming, there were two distinct epidermal layers: an unpacked and multilayered
wound epidermis (WE), and a basal epidermal monolayer (BEL) made of
cubical/cylindrical cells arranged more tightly. Underlying the basal epidermal layer
was a mass of undifferentiated, star-shaped mesenchymal cells loosely arranged (Fig.
III.35C, D). By the end of blastema formation (48 hpa) both epithelial and
mesenchymal cells were more packed than at previous regeneration time points (Fig.
III.36). Adding to this general composition of all stumps, there were some differences
between proximal and distal regenerates. While the former exhibited foci of
mononuclear, inflammatory cells from 6 until at least 48 hpa, in the latter this
population was only detected from 24 hpa on (arrowheads in Fig. III.35 and Fig.
III.36). Besides, in proximal stumps the WE seemed thicker from 6 hpa to 48 hpa. At
24 hpa it was particularly obvious that epithelial cells at the WE were hypertrophic
and more loose than in distal stumps. Last, at 48 hpa, the blastema was longer in fins
amputated at a proximal plane, due to increased cell number (Fig. III.36, compare A
with B).
Page | 158
Chapter III - Results
Figure III.35 – Hematoxylin-Eosin (H-E) staining of regenerating caudal fins 6 and 24
hours after proximal and distal amputation. Longitudinal sections of regenerating fin rays
at (A, B) 6 hours and at (C, D) 24 hours after (A, C) proximal or (B, D) distal amputation.
Tissues were stained with H-E: nuclei in purple, cytoplasm and extracellular matrix in pink.
The same tissues were present in proximal and distal stumps. Yet, mononuclear,
inflammatory cells (arrowheads) appeared at 6 hpa in proximal stumps (A) and at 24 hpa in
distal stumps (D). The wound epidermis (WE) of proximal stumps was enlarged compared to
distal regenerates. Bt: blastema. BEL: basal epidermal layer. hpa: hours post-amputation.
Page | 159
Chapter III - Results
Figure III.36 – Hematoxylin-Eosin (H-E) staining of regenerating caudal fins, 48 hours
after proximal and distal amputation. Longitudinal sections of regenerating fin rays at 48
hours after (A) proximal or (B) distal amputation. Tissues were stained with H-E: nuclei in
purple, cytoplasm and extracellular matrix in pink. The same tissues were present in
proximal and distal stumps. Note the longer blastema (Bt) in fins amputated at a proximal
plane, due to increased cell number. WE: wound epidermis. BEL (arrow): basal epidermal
layer. Arrowheads: mononuclear, inflammatory cells. Dashed line: amputation plane. hpa:
hours post-amputation.
4.2.2 Scanning electron microscopy analysis of the wound healing stage during
caudal fin regeneration after proximal and distal amputation
Scanning electron microscopy provided a detailed analysis on the composition and
topography of the surface of the regenerating tissue after proximal and distal
amputation (McMullan 1995). Immediately upon amputation, the tissues at the injury
site were very disorganized (Fig. III.37). Some red blood cells and inflammatory cells
were visible (pink arrowheads and arrows, respectively, in Fig. III.37A’ and B’). In
fact, both blood vessels disruption and invasion of the wound by inflammatory cells
within minutes after injury are phenomena characteristic of all wound healing
processes (Li et al 2012, Eming et al 2007, Martin and Leibovich 2005). Thus, their
presence confirmed the accuracy of our assay. In addition, in proximal stumps there
was a loose but well defined network of filaments at the wound edge (Fig. III.37A, A’:
white arrows), whereas in distal wounds such fibers were much less abundant (Fig.
III.37B, B’). These fibers were likely polymerized fibrin that is produced in response
to bleeding; it forms a mesh that contributes to the hemostatic clot that stops blood
loss, and works as a transient substrate for the initial migration of epithelial cells that
will close the wound (Midwood et al 2004).
As soon as 1 hpa, the tissues in the immediate vicinity of the amputation plane were
enlarged. In proximal stumps such enlargement was continuous along the whole fin
edge (Fig. III.38A, Fig. III.39A). On the contrary, in distal wounds the inter-ray regions
were thinner and shorter than the rays, resulting in an indented amputation surface
(Fig. III.39E, Fig. III.39E). Regardless the amputation plane, the epidermal cells at the
wounded rays had lost their characteristic flat, poliedrical shape with well defined
keratin concentric rings. Instead, they were rounded and had a smoother surface,
Page | 160
Chapter III - Results
without or with diffuse keratin rings, which is typical of migrating cells (Campbell and
Crews 2008) (Fig. III.38A, E; Fig. III.39A, E). Some of these cells had already migrated
over the wound surface, but a longitudinal cell- free space along the wound edge was
still evident, confirming that the wound was still open (arrows in Fig. III.38A, E).
There seemed to be more epithelial cells in the wound vicinity and over the wound
edge in proximal stumps than in distal ones, and this difference was most evident at
the inter-ray level. On the other hand, both proximal and distal stumps exhibited
extracellular filaments extending occasionally over the cells, at the wound site
(arrowheads in Fig. III.38A, E; Fig. III.39A, E).
At 3 hpa, more epidermal cells had migrated to cover the wound, regardless the
amputation plane. In proximal stumps there seemed to be more tissue above the
amputation plane than in distal stumps, likely corresponding to additional cells, in
agreement with our H-E staining (Fig. III.35C-D, Fig. III.38B, F, Fig. 39B, F). Besides, in
distally cut fins the inter-ray regions continued to be narrower and shorter than the
ray regions, maintaining an indented surface (Fig. III.38F). Moreover, in proximal
stumps, a dense mesh of extracellular matrix covered the surface of the regenerating
tissue, whereas in distal wounds only occasional filaments were observed
(arrowheads in Fig. III.38B and in Fig. III.39B, F).
By 6 hpa, fins amputated at the distal plane finally displayed a uniform, levelled
surface along ray and inter-ray regions (Fig. III.38G; Fig. III.39G). As wound healing
progressed until completion, more cell layers accumulated at the tip of the wound, to
generate a wound epidermis, and the cell surface in the outer epithelial layer
acquired a rumpled appearance (Fig. III.38C-D, G-H; Fig. III.39C-D, G-H). Interestingly,
at 12 hpa, the regenerating portion of proximally amputated fins continued to be
covered with a mesh of extracellular matrix that was absent in distal stumps, and the
amount of tissue above the amputation plane continued to be higher than in distal
stumps (Fig. III.38D, H; Fig. III.39D, H).
Overall, in this section we showed, through the combined use of hematoxylin-eosin
staining and scanning electron microscopy, that despite a great level of similarity
between proximal and distal stumps cellular composition at the qualitative level,
Page | 161
Chapter III - Results
there are differences in the amount of cells and cell products at each regeneration
time point, which are evident soon after the amputation, during the wound healing.
Figure III.37 – Scanning electron microscopy imaging of the caudal fin immediately
upon amputation at proximal and distal planes. (A-A’) Proximally amputated fin imaged
using (A) 400x and (A’) 1000x magnification. (B-B’) Distally amputated fin imaged using (B)
400x and (B’) 1000x magnification. Polymerized fibrin filaments (white arrows) were more
abundant in proximal stumps than in distal ones. Inflammatory cells (pink arrow) and red
blood cells (pink arrowhead) were present in all stumps. hpa: hours post-amputation.
Page | 162
Chapter III - Results
Figure III.38 – Scanning electron microscopy imaging of the caudal fin during the wound
healing stage after amputation at proximal (A-D) or distal (E-F) planes. (A, E) 1 hpa. (B, F)
3hpa. (C, G) 6 hpa. (D, H) 12 hpa. Arrows: open wound edge. Arrowheads: extracellular matrix
filaments. hpa: hours post-amputation. All images are at 400x magnification.
Page | 163
Chapter III - Results
Figure III.39 Scanning electron microscopy imaging of the caudal fin during the wound
healing stage after amputation at proximal (A-D) or distal (E-F) planes – high magnification
detail of images in Fig. III.38. (A, E) 1 hpa. (B, F) 3hpa. (C, G) 6 hpa. (D, H) 12 hpa. Arrowheads:
extracellular matrix filaments. hpa: hours post-amputation. Magnification: 1000-1500x.
Page | 164
Chapter III - Results
4.3. V-ATPase is required during regeneration in an amputation- plane
dependent manner
In section 3.2 (chapter III) we blocked V-ATPase expression and activity using both
genetic (fluo-MOs) and pharmacological (concA) approaches respectively, in order to
gain insights into a possible role for V-ATPase during regeneration. Now, we wanted
to strengthen the confidence in our previous assays, and to understand the relation
between V-ATPase activity and position-dependent regeneration rate. First, to
account for any non-specific phenotypes, we injected the control vivo-MO (cvivo-MO)
into the dorsal half of the fin of AB wild type fish, 2 or 16 h after proximal or distal
amputation. The fin’s ventral half was left as untreated control. We confirmed that
neither the cvivo-MO nor the injected procedure affected regeneration (Fig. III.40).
Taken that, we proceeded to V-ATPase subunit knockdown using an atp6v1e1b vivo-
morpholino (vivo-MO, Table II.8). Briefly, atp6v1e1b vivo-MO and control vivo-MO
(cvivo-MO) were microinjected into opposite halves of the fin of AB wild type fish, 2
or 16 h after proximal or distal amputation. The same protocol was used in
heterozygous fish that carried the V-ATPase recessive mutation atp6v1e1bhi577aTg,
under the assumption that vivo-MO mediated knockdown of atp6v1e1b translation in
already atp6v1e1b deficient fish should maximize the effects of V-ATPase knockdown
in regeneration. Mutants (atp6v1e1bhi577aTg/-) could not be used in this assay because
the gene knockout is embryo lethal (Nuckels et al 2009). We calculated the relative
area (%) of atp6v1e1b knocked down fin regions compared to the cvivo-MO injected
control regions of the same fin.
Overall, atp6v1e1b knockdown decreased the regenerate area compared to the
control in both fish lines, regardless the delivery time point (Fig. III.41, Fig. III.42). As
predicted, the phenotype was stronger in atp6v1e1bhi577aTg/+ fish (compare Fig. III.41
with Fig. III.42), which agrees with a requirement for V-ATPase during the
regenerative process. In fact, in the atp6v1e1bhi577aTg/+ fish, V-ATPase knockdown at 2
hpa decreased the area of new, regenerating tissue in more than 30% (mean±s.e.m:
35.56±8,72% at 24 hpi and 30.69±5.78% at 48 hpi), whereas regeneration
impairment in the wild type fish, under similar treatment conditions, was not beyond
15% (11.53±5.26% at 24 hpi and 14.05±4.33% at 48 hpi). Interestingly, in both fish
lines, vivo-MO delivery at 2 hpa produced a more significant phenotype in fins
Page | 165
Chapter III - Results
amputated proximally than in those cut distally (Fig. III.41A-B, E; Fig. III.42A-B, E). On
the contrary, vivo-MO delivery at 16 hpa resulted in a more significant area reduction
in distal stumps compared to the proximal ones (Fig. III.41C-D, F; Fig. III.42C-D, F), in
agreement with our previous results for atp6v1e1b knockdown in distal stumps using
fluo-MOs (section 3.2.3). Taken together, these results correlate with the different
onset of both V-ATPase expression and H+ efflux, earlier in the proximal, high
regeneration rate regions, than in the slower regenerating distal stumps, again
correlating to regeneration rate. In addition, considering all the results, it is clear that
the overall regeneration impairment was steeper proximally than at distal stumps:
35.56±8.72% in proximal regenerates (at 24 hpi, for delivery at 2 hpa) compared to
11.73±4.90% in distal stumps (at 24 hpi, delivery at 16 hpa) (Fig. III.42E-F). Thus,
higher regeneration rate seems to have a stronger dependence on V-ATPase activity.
Figure III.40 – Injection of control vivo-MO (cvivo-MO) did not affect fin regeneration.
1mM cvivo-MO was injected into half of the fin rays in (A-B) AB wild type and (C-D)
atp6v1e1bhi577aTg/+ zebrafish, at (A-C) 2 hours or (B-D) 16 hours after proximal (red columns)
or distal amputation (blue columns). For all treatments, relative regenerated area of cvivoMO treated fin regions was similar to the regenerated area in non-injected control regions of
the same fin: p>0.05, paired T-test. hpa: hours post-amputation. hpi: hours post-injection.
Page | 166
Chapter III - Results
Figure III.41 – atp6v1e1b knockdown after proximal and distal fin amputation, using vivo-MO.
(A-D) Fins of AB wild type fish amputated at the (A, C) proximal or (B, D) distal plane. 1mM atp6v1e1b
vivo-MO and control vivo-MO (cvivo-MO) were injected into opposite halves of the fin at (A-B) 2 hpa or
(C-D) 16 hpa. (E-F) The regenerate area upon each vivo-MO delivery was compared. Overall,
regenerate area upon atp6v1e1b knockdown was smaller than after cvivo-MO delivery. atp6v1e1b
vivo-MO delivery at 2 hpa had a stronger effect on proximal stumps (A-B, E), whereas its delivery at 16
hpa impaired regeneration the most at distal stumps (C-D, F), showing that requirement for V-ATPase
depends on the amputation plane. (*) p<0.05, paired T-test. hpa/hpi: hours post-amputation/injection.
Page | 167
Chapter III - Results
Figure III.42 – atp6v1e1b knockdown after proximal and distal fin amputation in
atp6v1e1bhi577aTg/+ zebrafish, using vivo-MO. (A-D) Fins amputated at the (A, C) proximal
or (B, D) distal plane. atp6v1e1b vivo-MO and control vivo-MO (cvivo-MO) were injected into
opposite halves of the fin at (A-B) 2 hpa or (C-D) 16 hpa. (E-F) The regenerate area upon each
treatment was compared. atp6v1e1b knockdown reduced the area of regenerated tissue
compared to the cvivo-MO. Proximal stumps were more affected by atp6v1e1b vivo-MO
Page | 168
Chapter III - Results
delivery at 2 hpa (A-B, E), whereas distal stumps were more affected by its delivery at 16 hpa
(C-D, F), revealing different requirement for V-ATPase according to the amputation plane. (*)
p<0.05, paired T-test. hpa/hpi: hours post-amputation/injection
4.4. V-ATPase affects molecular and cellular events during regeneration
The process of regeneration involves the coordination of multiple molecular
signalling pathways to induce cell behaviours such as migration, proliferation,
apoptosis, dedifferentiation and differentiation, from which new tissues arise. Thus,
to produce the observed regeneration impairment, V-ATPase activity must act
together with other molecules to affect at least some of the required cell behaviours.
In this section, we looked for the specific cell behaviours affected and for the genes
that couple with V-ATPase to produce such regeneration- permissive cell behaviours.
For that, we compared the expression of different regeneration and cell behaviour
markers in control and V-ATPase knocked down fin stumps.
4.4.1. Blastema cell proliferation is reduced upon atp6v1e1b knockdown
Results previously described in this work suggested a relation between V-ATPase
activity and regeneration. Particularly, V-ATPase and the associated H+ efflux were
proposed to be involved in amputation position- dependent regeneration rate. Thus,
we hypothesized that V-ATPase could affect the levels of cell death and cell
proliferation, which are typical modulators of tissues growth. To investigate that, we
knocked down atp6v1e1b in the caudal fin of atp6v1e1bhi577aTg/+ (AB) fish by
delivering vivo-MO to half the fin, 2 h after proximal or distal amputation. The other
half of each fin received the control vivo-MO. Fins were collected at different
regeneration timepoints and immunostained for active-Caspase-3 and Phospho-
Histone-3 (H3P), apoptotic and proliferative markers respectively.
The level of apoptosis seemed similar in both control and treated fish, suggesting that
reduced regeneration upon atp6v1e1b knockdown is not due to increased apoptosis
(Fig. III.43).
Regarding cell proliferation, similar results were found for both proximal and distal
stumps (Figs. III.44-III.46). In the controls, at 24 h after amputation, most H3PPage | 169
Chapter III - Results
positive cells were found in the intra-ray mesenchyme, 1-2 ray segments below the
proximal amputation plane. Some occasional cells stained above the amputation
plane (Fig. III.45A-A’’, C-C’’). At 48 hpa, many proliferating cells had accumulated in
the mature blastema (Fig. III.46A-A’’, C-C’’). Surprisingly, atp6v1e1b knockdown did
not affect the number or location of proliferating cells by 24 hpa (Fig. III.44, p>0.05,
paired T-test; Fig. III.45B-B’’, D-D’’). However, at 48 hpa there were significantly less
blastema cells positive for H3P in atp6v1e1b knocked down stumps than in the
controls (p<0.05, paired T-test): in proximal regenerates, proliferation decreased
40.13%±11.58 (mean±s.e.m), and in distally cut fins, there were 42.31%±7.37 less
proliferating cells than in control blastemas (Fig. III.44, Fig. III.46B-B’’, D-D’’).
Altogether, these results show that V-ATPase is required for normal cell proliferation
in the mature blastema, while having no detectable effect in the early blastema.
Figure III.43 – Immunodetection of apoptotic cells in regenerating fins after atp6v1e1b
knockdown. Immunohistochemical detection of active caspase-3 (green) at 24hpa. Fins of
atp6v1e1bhi577aTg/+ (AB) zebrafish were amputated at proximal plane and injected with (A-A’)
control-vivo-MO and (B-B’) atp6v1e1b- specific vivo-MO in opposite halves, at 2 hpa. Similar
levels of apoptosis were found in control and V-ATPase knocked down stumps (compare A-A’
with B-B’). Blue: DAPI.
Page | 170
Chapter III - Results
Figure III.44 – Quantification of proliferating cells in the blastema upon V-ATPase
knockdown. (A, B) atp6v1e1b vivo-MO and cvivo-MO were injected into opposite halves of
the caudal fin of atp6v1e1bhi577aTg/+ (AB) fish at 2 h after (A) proximal or (B) distal amputation.
After immunohisto-chemical staining for Phospho-Histone-3 (H3P) at 24 and 48 hpa, the
number of H3P-positive cells in 160 µm2 of blastemal tissue was counted, in control (grey)
and atp6v1e1b knocked down (red/blue) stumps. Atp6v1e1b knockdown decreased cell
proliferation by 48 hpa: (*) p<0.05, paired T-test.
Page | 171
Chapter III - Results
Figure III.45 – Cell proliferation in atp6v1e1b knocked down fins, 24 h after proximal
or distal amputation. Immunohistochemical assay for Phospho-HIstone-3 (H3P, green) at
24 hpa, in fins of atp6v1e1bhi577aTg/+ (AB) fish amputated at (A-B’’) proximal or (C-D’’) distal
plane and injected with (A-A’, C-C’’) control-vivo-MO and (B-B’, D-D’’) atp6v1e1b vivo-MO at
2 hpa. Most proliferating cells were below the amputation plane in all samples. Blue: DAPI
(nuclear staining). Images are 3D projections of 20 µm- thick mesenchymal layer. hpa: hours
post-amputation. Dashed line: amputation plane.
Page | 172
Chapter III - Results
Figure III.46 – Cell proliferation in atp6v1e1b knocked down fins, 48 h after proximal
or distal amputation. Immunohistochemical detection of Phospho-HIstone-3 (H3P, green) at
48 hpa, in fins of atp6v1e1bhi577aTg/+ (AB) fish amputated at (A-B’’) proximal or (C-D’’) distal
plane and injected with (A-A’, C-C’’) control-vivo-MO and (B-B’, D-D’’) atp6v1e1b vivo-MO at
2 hpa in opposite halves of the fin previously injected with (A-A’, C-C’’) control-vivo-MO and
(B-B’, D-D’’) atp6v1e1b- specific vivo-MO at 2hpa. Images are 3D projections of 20 µm- thick
mesenchymal layer. Note the fewer H3P-positive cells in the blastema in V-ATPase subunit
Page | 173
Chapter III - Results
knocked down regions of the fin than in the controls (compare A, A’’ with B, B’’ and C, C’’ with
D, D’’). Blue: DAPI (nuclear staining). Dashed line: amputation plane.
4.4.2. V-ATPase subunit knockdown affects fin innervation
Proper tissue innervation is another important factor for normal fin regeneration
(Suzuki et al 2005). As nerve cells are classically associated to bioelectrical events, we
tested if the H+ pump had any influence on. For that, the caudal fin of
atp6v1e1bhi577aTg/+ (AB) fish was amputated at either proximal or distal plane, and
delivered with atp6v1e1b – specific vivo-MO and control vivo-MO to opposite halves
of the fin, at 2 hpa. Fins were collected at 24 and 48 hpa and immunostained for the
neural marker acetylated α-tubulin. 24 hours after either proximal or distal
amputation, axons in the controls extended mainly along intra-ray regions, forming
bundles parallel to the proximal-distal axis of the fin. Actually, these bundles almost
reached the amputation plane, after an initial retraction from the stump that typically
occurs upon amputation (Fig. III.47A-A’’, C-C’’). At 48 hpa, the control stumps were
innervated by axons sprouting, especially in proximal stumps (Fig. III.48A-A’’, C-C’’).
Upon V-ATPase knockdown, there were some changes in this phenotype: at 24 hpa,
fins were less innervated than the controls and axons remained distant from the
amputation plane (Fig. III.47B-B’’, D-D’’). Later, at 48 hpa, axons were just beginning
to invade the regenerating tissue in proximal stumps (Fig. III.48B-B’’) and continued
restricted to the “old” tissue in distal stumps (Fig. III.48D-D’’). These results show that
V-ATPase is required for normal innervation of the regenerating fin.
Page | 174
Chapter III - Results
Figure III.47 – Caudal fin innervation 24 h after proximal or distal amputation and
atp6v1e1b knockdown. Immunohistochemical detection of acetylated α-tubulin (green) at
24hpa, in the fin of atp6v1e1bhi577aTg/+ (AB) fish, previously amputated at (A-B’’) proximal
plane or (C-D’’) distal plane and injected with (A-A’, C-C’’) control-vivo-MO and (B-B’, D-D’’)
atp6v1e1b- specific vivo-MO in opposite halves. Images are 3D projections of 20 µm- thick
mesenchymal layer. Fin innervation was reduced upon V-ATPase subunit knockdown
compared to the controls (compare A, A’’ with B, B’’; C, C’’ with D, D’’). Blue: DAPI (nuclear
staining). hpa: hours post- amputation. Dashed line: amputation plane.
Page | 175
Chapter III - Results
Figure III.48 – Caudal fin innervation 48 h after proximal or distal amputation and
atp6v1e1b knockdown. Immunohistochemical detection of acetylated α-tubulin (green) at
48hpa, in the fins of atp6v1e1bhi577aTg/+ (AB) fish previously amputated at (A-B’’) proximal
plane or (C-D’’) distal plane and injected with (A-A’, C-C’’) control-vivo-MO and (B-B’, D-D’’)
atp6v1e1b-vivo-MO in opposite halves. 3D projections of 20 µm mesenchymal layer. Axons
sprouting localized in the regenerated tissue in the controls (A-A’’, C-C’’). Upon V-ATPase
knockdown, axons were just beginning to invade the regenerated tissue (B-B’’), or continued
restricted to the “old” tissue (D, D’’). Blue: DAPI. Dashed line: amputation plane.
Page | 176
Chapter III - Results
4.4.3. Comparison of regeneration markers expression in proximal and distal
stumps
To find candidate genes that could establish the link between V-ATPase and known
signalling pathways required for regeneration, we selected genes that are
representative of main signalling pathways required for regeneration: wnt10a and
wnt5b, that are part of canonical and non-canonical Wnt signalling respectively
(Stoick-Cooper et al 2007b, Lee et al 2009); aldh1a2, which is required for RA
synthesis (Mathew et al 2009, Blum and Begemann 2012); msxb and mkp3, which are
downstream targets of Fgf signalling (Akimenko et al 1995, Nechiporuk and Keating
2002, Lee et al 2005); and osx and shh, which are required for osteoblast
differentiation and patterning (Laforest et al 1998, Quint et al 2002, Brown et al 2009,
Sousa et al 2011, Azevedo et a 2012, Zhang et al 2012). The function and expression
pattern of all these regeneration markers has been extensively documented by other
authors, for fin regeneration after amputation at the distal (standard) plane
(reviewed in Tal et al 2010, Yoshinari and Kawakami 2011). Here, we focused on the
differences in the gene expression between proximal and distal regenerates. In that
sense, the expression pattern of those genes was assessed in AB wild type fish after
proximal-distal (PD) amputation, using in situ hybridization. Our hypothesis was that
genes related to V-ATPase should have a different expression depending on the fin
amputation plane along the proximal-distal axis, similar to what we have found and
described previously (chapter III, section 4.1) for the V-ATPase.
aldh1a2 and wnt10a expression varied with the amputation plane, in a similar
fashion: at 24 hpa they were present in both proximal and distal stumps, but the
staining seemed stronger in proximal stumps, suggesting higher amounts of the
transcripts (Fig. III.49A, D; Fig. III.50A, D). At 48 hpa, aldh1a2 and wnt10a were
expressed distal to the bone rays. The intensity of the staining looked similar at the
two amputation sites, but the expression domain was wider (along the proximo-distal
axis) in proximal regenerates than in distal ones (Fig. III.49B, E; Fig. III.50B, E). By 72
hpa, there were no longer detectable differences between proximal and distal stumps’
staining for both aldh1a2 and wnt10a (Fig. III.49C, F; Fig. III.50C, F). As for wnt5b, the
intensity of the staining was stronger in proximal stumps compared to the distal ones,
Page | 177
Chapter III - Results
at 24 and 48 hpa but not at 72 hpa, suggesting more intense wnt5b transcription at
specific time points upon proximal amputation than after distal cut (Fig. III.50D-F).
The Fgf signalling- related genes msxb and mkp3 were present in the regenerating
tissue between 24-72 hpa in both proximal and distal stumps (Fig. III.51). At 24 hpa
they localized to the region immediately above the amputation plane (Fig. III.51A, D,
G, H). At 48 and 72 hpa, transcripts for both genes became restricted to a distal region
of the regenerating tissue (Fig. III.51C-F, I-L). For the three analysed time points, the
staining for msxb and mkp3 was stronger and wider (along the PD-axis) in proximal
regenerates than in the distally cut regions of the same fin (Fig. III.50, compare A-C
with D-F for msxb; G-I with J-L for mkp3). Regarding the early osteoblast marker osx,
its expression at 24 hpa was weak and similar in both proximal and distal stumps
(Fig. III.52A, D). Nevertheless, by 48 hpa, the regenerating tissue was clearly stained
for osx. In distal regenerates, the staining was confined to a domain distal to the bone
rays (Fig. III.52E). On the contrary, in proximal stumps osx domain extended until the
amputation plane, and was stronger in two lateral regions in both sides of the
regenerating fin rays (Fig. III.52B). By 72 hpa, amputation position- dependent
differences in osx expression had faded away (Fig. III.52C, F). Finally, transcripts for
the lepidotrichia- patterning gene shh were detected at 48 and 72 h after amputation
at either proximal or distal planes (Fig. III.52G-L). shh was expressed in one single
domain or two lateral domains, distal to “old” lepidotrichia (Fig. III.52H, K, I, L). At
both time points, the expression domain in proximal regenerates was both wider
along the proximal-distal axis and stronger compared to the distally amputated
region of the fin (Fig. III.52, compare H-I with K-L).
In short, the genes tested in this section all exhibited wider and/or stronger
expression in proximal stumps than in distal regenerates, at least at one time point
during the regenerative process, somewhat resembling V-ATPase expression profile
(chapter III: section 4.1.1, 4.1.2). Therefore, the results suggest that higher amount of
transcripts and/or increased number of gene expressing- cells in proximal stumps
(compared to distal ones) are a widespread phenomenon related to positiondependent regeneration.
Page | 178
Chapter III - Results
Figure III.49 – Expression of aldh1a2 in the regenerating caudal fin after PD
amputation. In situ hybridization performed at (A, D) 24 hpa, (B, E) 48 hpa and (C, F) 72 hpa
after (A-C) proximal and (D-F) distal amputation in the same fin. hpa: hour post-amputation.
Expression of aldh1a2 was stronger and wider in proximal stumps than distal ones at 24-48
hpa (A, B versus D, E).
Figure III.50 – Expression of wnt10a and wnt5b in the regenerating caudal fin after PD
amputation. In situ hybridization for canonical and non-canonical Wnt signalling markers:
Page | 179
Chapter III - Results
(A-F) wnt10a and (G-L) wnt5b, respectively. Experiment performed at (A, D, G, J) 24 hpa (B,
E, H, K) 48 hpa and (C, F, I, L) 72 hpa after (A-C, G-I) proximal and (D-F, J-L) distal
amputation in the same fin. Expression of both genes was stronger/wider in proximal stumps
than distal ones at 24-48 hpa (wnt10a: A, B versus D, E; wnt5b: G,H versus J,K). hpa: hour
post-amputation.
Figure III.51 – Expression of msxb and mkp3 in the regenerating caudal fin after PD
amputation. In situ hybridization for downstream targets of Fgf signalling: (A-F) msxb and
(G-L) mkp3, respectively. Experiment performed at (A, D, G, J) 24 hpa (B, E, H, K) 48 hpa and
(C, F, I, L) 72 hpa after (A-C, G-I) proximal and (D-F, J-L) distal amputation in the same fin.
Expression of both genes was stronger/wider in proximal stumps than distal ones at all time
points (msxb: A-C versus D-F; mpk3: G-I versus J-L). hpa: hour post-amputation.
Page | 180
Chapter III - Results
Figure III.52 – Expression of osx and shh during caudal fin regeneration after PD
amputation. In situ hybridization for genes involved in bone formation and patterning: (A-F)
osx and (G-L) shh, respectively. Experiment performed at (A, D, G, J) 24 hpa (B, E, H, K) 48
hpa and (C, F, I, L) 72 hpa after (A-C, G-I) proximal and (D-F, J-L) distal amputation in the
same fin. Expression of both genes was stronger/wider in proximal stumps than distal ones
at 48-72 hpa (osx: B-C versus E-F; mpk3: H-I versus K-L). hpa: hour post-amputation.
4.4.4 V-ATPase is required for normal expression of aldh1a2 and mkp3
To narrow down the candidate signalling pathways that could relate to V-ATPase, we
based on our previous results that indicated V-ATPase as required for cell
proliferation in the blastema. In such a way, we selected aldh1a2, wnt10a and mkp3
which are part of signalling pathways known to control cell proliferation during
blastema formation – retinoic acid (RA), Wnt/β-catenin and Fgf, respectively (Tal et al
2010, Blum and Begemann 2012). In addition, since V-ATPase is associated to bone
resorption and formation (Henriksen et al 2012, Yang et al 2012). We also tested osx,
Page | 181
Chapter III - Results
a skeletogenesis marker The expression of these genes was assessed after V-ATPase
knockdown. For that, caudal fins from heterozygous fish carrying the recessive
mutation atp6v1e1bhi577aTg/+ were injected with atp6v1e1b vivo-MO or control vivo-
MO in opposite halves of the fin, 2 h after proximal or distal amputation. Gene
expression in both regions of the fin was compared, using in situ hybridization.
In the controls, expression of all genes at 24 and 48 hpa was similar to the previously
described, both in proximal and distal stumps. On the contrary, after V-ATPase
knockdown, aldh1a2 and mkp3 were absent at 24 hpa at either amputation planes,
demonstrating that V-ATPase affects the expression of both genes (Fig. III.53A-B, E-F,
I-J, M-N). At 48 hpa, expression of both genes was re-established, likely as a
consequence of the transient character of the atp61v11b vivo-MO effect (Fig. III.53C-
D, G-H, K-L, O-P). Expression of wnt10a and osx remained unchanged upon V-ATPase
knockdown, in proximal and distal stumps alike (Fig. III.53Q-β). These results show
that V-ATPase is required for the normal expression of at least aldh1a2 and mkp3,
establishing a molecular link between V-ATPase and two important signalling
pathways that control cell proliferation, Fgf and RA.
All genes were differentially expressed at P and D, but only some were affected by v-
atpase knockdown, demonstrating that v-atpase affects only some pathways, argues
in favour of a specific effect, not housekeeping one. Therefore, the results suggest that
higher amount of transcripts and/or increased number of gene expressing- cells in
proximal stumps (compared to distal ones) is a widespread phenomenon related to
position-dependent regeneration.
Page | 182
Chapter III - Results
Figure III.53 – atp6v1e1b knockdown affects the expression of specific genes during
regeneration. In situ hybridization for (A-H) aldh1a2, (I-P) mkp3, (Q-X) wnt10a and (Y-β)
osx, at 24 hpa (panels on the first and second columns) and 48 hpa (panels on the third and
fourth columns), in the caudal fin of atp6v1e1bhi577aTg/+ (AB) fish. The fins had been previously
Page | 183
Chapter III - Results
amputated at (A-D, I-L, Q-T, Y-Z) proximal plane or at (E-H, M-P, U-X, α-β) distal plane, and
injected with atp6v1e1b vivo-MO (panels in the first and third columns) and with controlvivo-MO (panels in the second and fourth columns) in opposite halves, at 2hpa. atp6v1e1b
knockdown impaired aldh1a2 and mkp3 expression at 24 hpa, in both proximal and distal
stumps, but did not change the expression of wnt10a or osx at any time point.
Discussion
In chapter III: Part 4, we confirmed that V-ATPase activity contributes to the
regeneration-associated H+ efflux. We found that the onset and intensity of both V-
ATPase expression and H+ efflux correlate with the different regeneration rate along
the proximal-distal axis, and confirmed that V-ATPase inhibition impairs
regeneration in adult vertebrate. Notably, the activity of this H+ pump seems to be
necessary for aldh1a2 and mkp3 expression, blastema cell proliferation and fin
innervation.
The majors findings described in this chapter III: part 4 will be integrated and
discussed in the next chapter (General Discussion), in light of the remaining results
obtained in this project. Notwithstanding, some specific aspects will now be
addressed.
Position- dependent levels of cell and molecular activation distinguish proximal
from distal stumps
If fish are maintained in similar housing conditions, they regenerate the caudal fin
always in the same time, regardless the amount of lost tissue. This implies that the
more tissue is removed, the faster the regeneration must be. Since the cellular
composition of the intact caudal fin exoskeleton is the same along the PD axis
(Becerra et al 1983, Montes et al 1982, Akimenko et al 2003), all differences between
proximal and distal regeneration rate should reflect mechanisms that are
differentially activated in similar tissues, upon amputation. In fact, some positiondependent differences have been reported and are related to regeneration rate: both
blastemal length and mitotic index are higher in proximal stumps (Lee et al 2005).
Page | 184
Chapter III - Results
Our histological analysis of regenerating fin sections confirmed the bigger blastemal
length after proximal amputation. In addition, our results suggest that the wound
epidermis (WE) in proximal stumps is wider. We could not quantify the epidermal
cells at the WE. Nevertheless, it is known that the WE cells synthesize their own
extracellular matrix (Santamaria and Becerra 1991, Campbell and Crews 2008); thus,
the increased abundance of extracellular matrix nets that we also found in proximal
stumps likely reflects an increased number of epidermal cells.
The previous disparities between proximal and distal regenerates began to
accumulate as early as 1-3 hpa, suggesting that amputation position- dependent
differences in regeneration began very early, well before a blastema is formed. In fact,
the WE is crucial for blastema formation, by secreting crucial factors to the
underlying mesenchyme (Murawala et al 2012), and the continuous crosstalk
between WE and the blastema is crucial for regeneration success (Lee et al 2009, Tal
et al 2010). Taken this, it is possible that the wider WE of proximal stumps, which
embodies the first detectable distinction between proximal and distal stumps, is at
the base of the higher regeneration rate of proximal stumps.
Specifically, the larger number of epidermal cells at proximal wounds would produce
increased amounts of the secreted molecules required for blastema formation. This
would lead to the recruitment of more cells to, and to the formation of, the larger
blastema of proximal wounds, with more proliferative cells, which is known to lead to
higher regeneration rate (Lee et al 2005). In this regard, an interesting factor to
study more deeply would be matrix metalloproteinases (MMP). These molecules are
known to be synthesized by epidermal cells upon amputation of the urodele
amphibian limb (Campbell and Crews 2008), and to promote cell dedifferentiation in
several systems (Miyazaki et al 1996, Liu et al 2010, Austin et al 2013, Li et al 2014).
In fact, the zebrafish caudal fin failed to form a blastema in the presence of a largespectrum MMP inhibitor (Bai et al 2005). Besides, even though the origin of blastema
cells is still under intense debate, recent studies confirmed that at least some cells
dedifferentiate and integrate the blastema (Sousa et al 2011, Knopf et al 2011). Thus,
MMPs could be promoting cell dedifferentiation to form the fin blastema, and this
Page | 185
Chapter III - Results
effect would be stronger in proximal stumps, due to greater amounts of MMPs
(according to described hypothesis).
Another interesting molecule is Activin-βa. This TGFβ- related ligand is up-regulated
as early as 1 hpa (for amputation at the standard, distal plane) in the mesenchymal
cells at the wound margin of the inter-rays (Jazwinska et al 2007). By promoting
epidermal cell migration during wound healing, it is responsible for the restoration of
the fin margin from the initial mechanical retraction that affects especially the inter-
ray tissue and that gives the wound margin a serrated appearance for the first 6-12
hpa. Besides, it is also necessary for the ECM remodelling and cell proliferation at the
“old” mesenchyme, and for the subsequent migration of those cells distally from the
amputation plane, to form the blastema (Jazwinska et al 2007). Interestingly, at 1 hpa,
the wound edge at distal stumps had the characteristic indented appearance, but at
proximal stumps the wound margin was aligned at ray and inter-ray, with more cells
at the amputated surface. Altogether, these data suggest that stronger actβa
expression in proximal stumps could be one very early signal involved in the
formation of a larger WE in proximal wounds.
Finally, as explained in the introductory chapter (chapter III, section 3.2.2), the most
immediate signals upon wounding seem to be the injury current and associated EF,
which are generated at the moment the tissues are disrupted. These electrical signals
seem to superimpose to any other factors guiding the wound healing, controlling cell
behaviour via its influence on gene expression and protein distribution (McCaig et al
2005, Nuccitelli 2005, Zhao 2009). Thus, it would be interesting to compare the
intensity of the injury current after proximal and distal amputation, as well as the
intensity of the underlying ion-specific fluxes. Our hypothesis is that a higher injury
current at proximal stumps could be the earliest trigger to form a wider (more cells)
WE.
H+ efflux and its putative role on regeneration
The results from parts 2 and 3 of the present chapter described a regeneration-
associated H+ efflux and suggested the V-ATPase as its molecular source. In this final
Page | 186
Chapter III - Results
part, we challenged that relationship. We found that both V-ATPase expression and
H+ efflux started earlier and was stronger upon proximal amputation than after distal
one, reinforcing a correlation. However, H+ efflux appeared to establish before V-
ATPase up-regulation at both amputation planes, arguing against a causal relation
between both. In fact, this apparent discrepancy could simply be due to the detection
limit of the in situ hybridization that could prevent the detection of smaller transcript
levels. Moreover, V-ATPase knockdown decreased H+ efflux, confirming that this H+
pump indeed contributed to the H+ efflux. Some H+ efflux persisted upon the H+ pump
knockdown, suggesting that other molecules may be involved in the generation of
that outward current.
Other important findings came from H+ efflux measurement in fins amputated at the
caudal peduncle. The presence of distinct H+ efflux patterns and intensities in regions
with different regenerative ability (exoskeleton stumps, regenerative caudal
peduncles and non-regenerating caudal peduncles) agrees with a role for H+ efflux
during regeneration. The H+ efflux at regenerative caudal peduncles was maintained
for more than twice the time than what we detected for the amputated caudal fin
exoskeleton, and there were two H+ efflux peaks instead of one. Also, in the caudal
peduncle stumps, a visible regenerating fin only appeared upon the second H+ efflux
burst, whereas major progress in the regenerative process followed the single H+
efflux peak at exoskeleton stumps. On the other hand, the efflux decreased gradually
as regeneration progressed, regardless the plane of amputation. From these results, it
seems that H+ efflux accompanies a great part of the regenerative process that follows
wound healing. Indeed, several studies, mostly focused on amphibian appendage
regeneration, have showed that epimorphosis is accompanied by an EC, and that this
bioelectrical event is not epiphenomenal, but a causal factor regulating regeneration
(Borgens et al 1977, Borgens et al 1979, Borgens et al 1981, Jenkins et al 1996, Reid
et al 2009, Levin 2007). In light of these studies, our results indicate that H+ efflux
likely contributes to the regeneration-specific EC, which is actively generated at the
cellular level and that is necessary only during specific regenerative events.
Additionally, this EC current would rely at least on V-ATPase as a molecular source.
Page | 187
Chapter III - Results
Interestingly, in non-regenerative caudal peduncles, H+ efflux seemed to remain
active indefinitely. According to the available literature, the typical EC that
accompanies regeneration is not present in non-regenerative systems (Levin 2003).
Thus, even though we did not measure total EC, the fact that H+ efflux was present at
non-regenerative caudal peduncles suggests that this structure has at least some of
the necessary endogenous tools to regenerate. In addition, these data suggests that H+
efflux is necessary, but not sufficient, to trigger regeneration, opposite to the
described for the Xenopus tadpole tail (Adams et al 2007). Accordingly, the steep
increase in the efflux intensity detected at 10 dpa and maintained at least for 90 days,
in non-regenerating caudal peduncles, could reflect the stump reinforced attempt to
activate the missing regenerative machinery. Interestingly, in Xenopus tadpole tail,
the H+ extrusion at the plasma membrane of cells in the regenerating bud was
sufficient to induce regeneration during the refractory, non-regenerative stage
(Adams et al 2007). In that study, H+ efflux was not assessed. Nevertheless, our and
Adams et al data suggest that different mechanisms operate during regeneration in
embryonic/larval stages and adults.
Page | 188
Chapter IV – General Discussion
Chapter IV
General Discussion
Page | 189
Chapter IV – General Discussion
Page | 190
Chapter IV – General Discussion
Over the last decades, regeneration research as focused mainly on identifying and
understanding the genetic cues that underlie this complex process. However, it is long
known that, alongside genetic instructions, endogenous electrical signals are
established during regeneration and required for its success (Borgens et al 1979,
Levin 2007). In this project, we set out to unveil the ionic composition of the crucial
electric currents (EC) during appendage regeneration in an adult vertebrate
(zebrafish). In addition, we investigated the ion transporters involved in the
establishment of the relevant ion fluxes, and how they affect regeneration at the
cellular and molecular levels. Our major findings are discussed next.
Adult zebrafish caudal fin regeneration is accompanied by a H+ efflux that
depends on the amputation position along the proximal-distal axis
The scanning ion- selective electrode technique (SIET) is a highly sensitive technique
that has been extensively used to measure ion-specific fluxes, mainly K+, Ca2+, H+, Na+
and Cl-, in models so diverse as plant roots (Ryan et al 1990, Zhou et al 2010), pollen
tubes (Zonia et al 2002, Certal et al 2008), insect and fish larvae (Donini and
O’Donnell 2005, Lin et al 2006), mammalian structures explants (Vieira et al 2011)
and cell culture (Molina et al 2004, Marenzanaa et al 2005). This technique avoids
the classical use of ion substitution as a means to isolate the components of the net EC
(Kunkel et al 2006), allowing a direct and non-invasive detection of the flux of single
ion species in living cells, tissues and organisms.
The accuracy of SIET relies on a signal-to-noise ratio high enough to distinguish small
endogenous electric signals in the study target from electrical noise produced by the
electrical equipment (both SIET components themselves and nearby electrical
devices) (Budai 2004). Unfortunately, it is not possible to establish standard SIET
protocols that apply to all study organisms, since several factors must be taken into
account, including the mobility, size and ionic and osmotic needs of the target
organism/cells (Boudko et al 2001, Bjornsson and Huebner 2004, Reid and Zhao
Page | 191
Chapter IV – General Discussion
2011, Kreitzer et al 2012). Thus, optimization of SIET to the study object is
fundamental. In fact, inaccurate optimization have generated in past studies
misleading results (Messerli et al 2004, Michard et al 2009). To the best of our
knowledge, SIET had never been used in adult fish. Consequently, and despite very
time-consuming, the adaptation and optimization of SIET to our working model was
an essential step towards the success of the first goal of the project: identification of
the ion components of the EC that accompany epimorphic regeneration (detailed
results and discussion in part 1 of chapter III).
In biological systems, most ECs are generated by the flow of ions (McCaig et al 2005).
One of the endogenous EC is the injury potential, an electrical signal essential for
wound healing that is established upon wounding of any tissue and lasts until the
wound is healed (McCaig et al 2005, Zhao 2009). Due to its biological relevance
during the healing process, the ionic composition of the injury current has been
investigated in several organisms (Borgens et al 1979b, Rajnicek et al 1988, Reid et al
2005). However, the first detailed and direct description of the injury current, using
SIET, was only published recently, and in rat corneal wounds (Vieira et al 2011), not
an epimorphic process. Using the optimized SIET, we found that large Na+, K+, Ca2+
and C-- specific effluxes are present during the wound healing stage but not in later
stages of zebrafish caudal fin regeneration. Therefore, we suggest that those effluxes
of ions are important contributors for the injury potential in the context of
epimorphic regeneration.
Importantly, our SIET recordings also showed that H+ efflux is specifically established
during appendage regeneration in adult zebrafish. Opposite to Na+, K+, Ca2+ and C-, H+
efflux was first detected several hours upon amputation, and it was present for at
least 5 days after wound closure. Previous reports in vertebrates including humans
have showed that regeneration is accompanied by an endogenous EC for several days
after the wound healing is complete (Borgens et al 1977, Reid et al 2009, Illingworth
and Barker 1980). Such EC is required for regeneration, and seems to be controlled
by the activity of specific ion transporters (Reid et al 2009, Vieira et al 2011). Since
the wound is already closed when H+ efflux is detected, we propose that this H+
outward current contributes to the regeneration-specific endogenous EC. Moreover,
Page | 192
Chapter IV – General Discussion
the pattern of H+ outward current was different upon amputation at the caudal
peduncle and fin exoskeleton, which have very distinct regenerative abilities,
reinforcing that it (H+ efflux) is actively modulated.
V-ATPase activity contributes to a regeneration-specific H+ efflux
The molecular source of regeneration-specific ion fluxes has only recently begun to be
unveiled: the H+ pump V-ATPase and the voltage-gated sodium channel NaV1.2 are
essential for the regeneration of Xenopus larvae tail (Adams et al 2007, Tseng et al
2010), and the H+,K+-ATPase is required for planarian head regeneration (Beane et al
2011). Nevertheless, evidence in other models for conservation of these mechanisms,
especially in adult vertebrate models, is still lacking. In this work, we combined three
independent
approaches
–
DNA
microarray,
in
situ
hybridization,
and
immunohistochemistry – to demonstrate for the first time that the V-ATPase is up-
regulated in the regenerating tissue of the adult zebrafish caudal fin.
We took advantage of the fact that different manipulations can be held on separate
parts of one single fin (eg. different amputation planes; distinct treatments using
drugs or morpholinos) to provide an extra level of control to our experiments that
could not be examined in other models such as the Xenopus larval tail (Adams et al
2007, Tseng et al 2010). We demonstrated that the onset and magnitude of V-ATPase
expression varied with the amputation plane along the PD axis and that H+ efflux
followed a similar pattern. Besides, inhibition of this H+ pump after either proximal or
distal amputation decreased H+ efflux (during early blastema formation). Thus, VATPase contributes to the regeneration-specific H+ efflux in the adult zebrafish caudal
fin.
In the atp6v1e1b knocked down fins, the H+ efflux decreased at 24 hpa but increased
from 48 hpa onwards compared to the control. This phenotype reversal probably
reflects the decreasing inhibitory effect of the MO with time (Bill et al 2009). Two
interesting facts were that the efflux increase at 48 and 72 hpa closely resembled the
control efflux level at 24 and 48 hpa respectively, and for each time point, efflux
intensity was always smaller in distal stumps than in proximal ones. Taken together,
Page | 193
Chapter IV – General Discussion
our data shows that during regeneration V-ATPase activity and the consequent H+
efflux are tightly controlled at the genetic level in order to reach a specific intensity
that depends on the amputation position. These observations suggest that the V-
ATPase H+ pump has an active role in regeneration and is involved in the formation of
position-dependent cues, as will be further discussed later on this chapter.
V-ATPase is required for blastema cell proliferation, adequate nerve supply and
correlates with RA and Fgf signalling
V-ATPase is ubiquitously expressed in eukaryotic cells and is required for several
housekeeping functions that depend on pH or membrane potential. Additionally, it is
strongly up-regulated in particular cell types where it is necessary for specific
processes such as bone formation and resorption and renal acidification (Marshansky
et al 2014). Here, we showed that in the amputated adult zebrafish caudal fin, V-
ATPase is up-regulated in the regenerating tissue during blastema formation and
early regenerative outgrowth, and its inhibitions impair regeneration. Therefore, V-
ATPase seems to be required for the regenerative process in some role other than
housekeeping functions.
In the Xenopus tadpole tail, the V-ATPase-mediated H+ extrusion is necessary for cell
proliferation in the blastema-like regeneration bud (Adams et al 2007). Here, we
found that V-ATPase knockdown impairs regeneration by decreasing proliferation in
the mature blastema, by 48 hpa. Nevertheless, V-ATPase knockdown decreased the
area of regenerated tissue as soon as 24 hpa, when cell proliferation was still not
affected. Taking into consideration that the blastema arises from intra-ray cells that
proliferate and migrate distally (Poleo et al 2001, Nechiporuk and Keating 2002,
Nakatani et al 2008), the impaired regeneration at 24 hpa could reflect a contribution
of the V-ATPase for the migration of those cells into the blastema-forming region
above the amputation plane. Indeed, regulation of extracellular, cytosolic and vesicle
pH by the V-ATPase is required for the migration of tumour and endothelial cells
(Rojas et al 2006, Sennoune and Martinez-Zaguilan 2007, Nishisho et al 2011,
Wiedmann et al 2012, Rath et al 2013). However, we did not detect V-ATPase in the
“old” fin tissue where the migrating cells are. Alternatively, V-ATPase activity could
Page | 194
Chapter IV – General Discussion
be guiding cell migration towards the blastema via electrotaxis (Zhao 2009).
Specifically, even though ion fluxes do not necessarily induce an EF, the localized V-
ATPase-mediated H+ efflux in the blastema but not in the intact, “old” tissue, could
contribute to the establishment of a regeneration-associated EC and an associated EF,
that had the regenerating region as target. In fact, such a scenario was suggested by
our H+ flux measurements, as discussed in previous sections of this work. Also, PI3K,
which is a key molecule in the transduction of EF into cell migration (Zhao et al 2006),
was already showed to be necessary for mesenchymal cell migration to form the
blastema, during caudal fin regeneration in medaka fish (Nakatani et al 2008).
As mentioned, we found that V-ATPase knockdown decreased cell proliferation in the
mature blastema. In fact, V-ATPase has been associated to proliferation in other
contexts, but the underlying mechanisms may not be coincident in all of them (Adams
et al 2007, Nuckels et al 2009, Rath et al 2013). For instance, in endothelial cells, V-
ATPase is required for proliferation by controlling vesicle pH, endocytic trafficking
and membrane recycling, which affect Rac-1, Notch and VEGF signalling (Rath et al
2013). On the other hand, in the regenerating larval Xenopus tail the H+ pumping
activity of the V-ATPase affects proliferation through modulation of membrane
potential. Specifically, in that system the crucial effect of V-ATPase activity is the
generation of a hyperpolarization domain that is critical for cell proliferation and
innervation in the regenerating tissue (Adams et al 2007). In that study, the
molecular effects of the hyperpolarization were not investigated. Here, we showed
that V-ATPase knockdown inhibited the expression of both mkp3, a downstream
target of Fgf signalling, and aldh1a2, which is required for RA synthesis. Interestingly,
both of these pathways are known to be involved in blastemal cell proliferation (Poss
et al 2000b, Blum and Begemann 2012). Thus, V-ATPase seems to affect proliferation
by affecting the two signalling pathways.
In the zebrafish caudal fin, cell survival in the mature blastema but not during
blastema formation seems to be mediated by RA signalling-induced expression of the
anti-apoptotic factor bcl2 (Blum and Begemann 2012). Here, we demonstrated that V-
ATPase also affected cell proliferation only in the mature blastema. In addition,
another study, using human lung carcinoma cells, have demonstrated that V-ATPase
Page | 195
Chapter IV – General Discussion
also mediate cell survival by up-regulating bcl2 expression (Sasazawa et al 2009).
Therefore, it would be interesting to investigate if aldh1a2 and V-ATPase act as part
of a single, common pathway.
Regarding mkp3, it is a downstream target of Fgf signalling, and therefore its
inhibition upon V-ATPase knockdown strongly implicated Fgf signalling. In fact, upon
binding to the appropriate receptor, Fgf1 can act via endocytosis and translocation
across the vesicle membrane to reach the cytosol and finally the nucleus (Wiedłocha
and Sørensen 2004). Noticeably, Fgf1 translocation to the cytosol depends on the
vesicle membrane potential generated by the V-ATPase (Małecki et al 2002, Małecki
et al 2004), and it has been implicated in blastemal cell proliferation in urodele
amphibian limb regeneration (Zenjari et al 1996, Zenjari et al 1997, Dungan et al
2002). However, a role for Fgf1 in zebrafish caudal fin regeneration has not been
described so far. Besides, V-ATPase doesn’t seem to be up-regulated in the same cells
that Fgfr, where the Fgf ligand acts (Monteiro et al 2014, Poss et al 2000b), arguing
against an intracellular effect of V-ATPase on Fgf signalling.
Another hypothesis for the relation between V-ATPase and mkp3 arose from a study
concerning the early kidney development in Xenopus. There, mkp3 up-regulation
depended on an interaction between RA and FGF that specifically affected mkp3
transcription (Le Bouffant et al 2012). Thus, it is possible that the absence of mkp3
upon V-ATPase knockdown was a consequence of the H+ pump inhibitory effect on
aldh1a2 and consequently on RA synthesis. In fact, the relation between Fgf and RA
signalling during regeneration still needs further investigation. Not very long ago, it
has been suggested that RA and Fgf signalling, together with Wnt/β-catenin, regulate
each other in a positive reciprocal manner to modulate the overall rate of
regeneration (Blum and Begemann 2012). More recently, new evidence reinforced an
older study that indicated that Wnt is actually upstream of Fgf and RA (Stoick-Cooper
et al 2007b, Wehner et al 2014). Either way, a correlation between the three
pathways seems obvious. Noteworthy, V-ATPase- mediated acidification of
endosomes is required for the phosphorylation of canonical Wnt receptor LRP6 into
their active form, downstream of the cell surface ligand binding (Cruciat et al 2010,
Vaccari et al 2010). Taken that, we cannot exclude an effect of V-ATPase activity on
Page | 196
Chapter IV – General Discussion
Wnt during appendage regeneration: even though wnt10a expression was not
affected by V-ATPase knockdown, the pump’s activity seems to be required
downstream of the Wnt ligand, which was not investigated here (Cruciat et al 2010).
However, V-ATPase doesn’t seem to be expressed in the same cells where Wnt
signalling is active (Monteiro et al 2014, Wehner et al 2014), suggesting that VATPase effect on mkp3 and aldh1a2, is not due to Wnt signalling impairment.
Novel roles have recently emerged for V-ATPase-mediated pH regulation in the
modulation of signalling pathways, particularly Notch (Yan et al 2009) and non-
canonical Wnt (Hermle et al 2010, Buechling et al 2010), which have already been
implicated in blastema cell proliferation during regeneration (Münch et al 2013,
Stoick-Cooper et al 2007b), and also IGF-1R and Jnk (Marshansky et al 2014, Petzoldt
et al 2013). Moreover, V-ATPase H+ extrusion activity can encode electrical signals,
either in the form of localized changes in the membrane potential of cells, or as ECs
and associated EFs, all of which can activate signalling pathways and facilitate the
uptake or exit of different molecules (for extended review, see chapter I, section 3.3
and 3.5). More specific functions may be found, since only recently the field of
bioelectricity began to be revisited with the emergence of new molecular tools.
Taking that into account, it is possible that V-ATPase is affecting mkp3 and aldh1a2
expression and blastema cell proliferation by affecting some still unidentified
molecule or process.
An interesting hypothesis previously discussed in part 3 of chapter III is the relation
between Cx43 and V-ATPase. In light of the results described in that section of the
thesis, we proposed that both molecules could be involved in cell differentiation,
specifically at the bone segment joints. Here, we add the fact that cx43 is also
expressed in the PB, where it has been proposed to contribute to the establishment or
maintenance of proliferation in the blastema (Hoptak-Solga et al 2008). A similar
function was also found here for the V-ATPase, reinforcing a possible correlation.
Importantly, it was recently demonstrated that, as predicted for a long time, Cx43
influences cell proliferation and patterning by promoting the activation of
independent signalling pathways (Sema3d and Hapln1a) (Ton and Iovine 2012,
Govindan ad Iovine 2014). Thus, Cx43 seems to be a general regulator of signalling
Page | 197
Chapter IV – General Discussion
pathways, rather than a component of a single, specific one. Taken all, we suggest
that, similar to what has been proposed for the establishment of left-right asymmetry
during vertebrate embryonic development (Levin and Mertola 1999, Adams et al
2006, Hatler et al 2009, Vandenberg et al 2013a, Vandenberg et al 2013b), localized
function of V-ATPase in the blastema could be required during regeneration to
generate a bioelectrical gradient that drives the electrophoretic transport of different
factors towards the correct location, via Cx43 gap junctions. Given the crucial and
constant crosstalk between blastema and basal epidermal layer (BEL) (Lee et al
2009), this would be a tempting hypothesis to explain the fast diffusion of relevant
factors between the two regions. Particularly, it would explain the how V-ATPase
activity, which is comprised to the blastema, affects mkp3 and aldh1a2, which are
confined to the BEL and the distal blastema.
Blockage of V-ATPase subunit E transcription also seemed to decrease the amount of
axons in the fin and impaired axonal growth into the regenerating tissue. In that
regard, it is known that endogenous ECs and associated EFs control the amount of
nerve sprouting and the direction of axonal growth into the regenerating region in
other models (Song et al 2004). Besides, we have proposed previously in this work
that the H+ efflux detected, which is mediated at least in part by the V-ATPase,
contributes to a regeneration-specific EC. Based on this, it is possible that the
hindered innervation was a direct result of the decrease of V-ATPase-mediated H+
efflux.
In such scenario, the decreased expression of mkp3 upon V-ATPase knockdown could
be due to a decrease in nerve-dependent Fgf signalling, since several studies, mostly
done on amphibians, indicate that Fgfs are crucial neurotrophic factors released by
nerves into the regenerating tissue (Mullen et a 1996, Mildred et al 2012, Makanae et
al 2013). Adding to this, other studies, also focused on amphibian limb regeneration,
have showed that nerve supply is not necessary for blastema formation but is
required for its outgrowth, by controlling cell proliferation, cell survival and
expression of Fgf signalling genes (Suzuki et al 2005, Stocum 2011). Again, that
agrees with our results, which demonstrated V-ATPase requirement for correct Fgf
signalling and for blastema cell proliferation after its formation.
Page | 198
Chapter IV – General Discussion
On the other hand, the blastema seems to contain several neurotrophic factors that
stimulate and orient axonal growth into the regenerating tissue, including Fgfs, RA,
and possibly other still not identified factors (Tonge and Leclere 2000, Wang et al
2009, Arrieta et al 2005, Palencia et al 2014). If so, decreased innervation could be
due to V-ATPase inhibitory effect on mkp3 and aldh1a2, that would prevent
downstream stimulation of axonal outgrowth.
Taken all, V-ATPase effect on blastema outgrowth may be mediated by nerve supply,
though independent routes for V-ATPase and nerve supply effects cannot be
excluded.
V-ATPase and its putative role in regeneration events that depend on a
blastema with specific proliferative function
Although larval fin fold of atp6v1e1bhi577atg-/- zebrafish regenerated normally in the
absence of V-ATPase activity, our results clearly show that V-ATPase is required for
regeneration in adult fish appendages. In fact, despite the reported conservation of
molecular events during regeneration of adult fins and larval fin fold (Kawakami et al
2004, Yoshinari et al 2009), recent in vivo cell tracing experiments have showed that
the fin fold blastema does not have a specific function for proliferation, and in that
way it is not a classical blastema as observed in the adult system (Mateus et al 2012).
Thus, regeneration of the adult and larval caudal appendages in zebrafish are distinct
processes. On the other hand, some remarkable parallels have been observed
between regeneration of the adult zebrafish caudal fin and Xenopus tadpole limb and
tail buds (Lin and Slack 2008), including conserved molecular pathways and
dependence on blastema-restricted cell proliferation. Particularly, our work and
others (Adams et al 2007) demonstrate that, in both models, V-ATPase is required for
adequate nerve supply and cell proliferation in the blastema. Taken all, we propose
that the V-ATPase has a conserved role in regeneration events that depend on a
blastema with specific proliferative function.
Page | 199
Chapter IV – General Discussion
V-ATPase: a novel factor controlling position-dependent regeneration rate
One important property of the blastema is positional memory, a term often used to
refer to the blastema’s ability to define the types and amounts of tissues that need to
regenerate as well as their correct patterning, according to the amputation position
on the proximal-distal axis (Kumar et al 2007a). In the urodele limb, some key
molecules were already identified as instructors of positional cell identity: RA,
Prod1/CD49 and Meis1/2. The three factors can drive re-specification of distal
blastemal cells to more proximal positional identities (Niazi and Saxena 1978, Maden
1983, da Silva et al 2002, Maden and Hind 2003, Echeverri and Tanaka 2005,
Mercader et al 2005, Kumar et al 2007). In the zebrafish appendages, RA role as an
instructor of positional information has long been investigated but has proven
difficult to assess (Brulfert et al 1998, Ferretti and Géraudie 1995, Géraudie et al
1995, Blum and Begemann 2012). However, the first position-instructor signal in the
zebrafish was confirmed recently and is related to RA: hand2, is a transcription factor
with a region-specific expression along the anterior-posterior axis of the pectoral fin,
that participates in the anterior-posterior (AP) bone patterning during regeneration
by controlling the regional levels of RA along that fin axis (Nachtrab et al 2013).
Another prominent component of the positional memory properties of the blastema
is the regulation of regenerative growth rate (Brockes and Kumar 2005, Lee et al
2005). This control ensures that regeneration is completed in the same time period
regardless the amount of tissue removed. Despite the potential advantages of this
property for the regenerative medicine field, it has received little interest from the
research community so far. In the zebrafish caudal fin, position-dependent
regeneration rate is regulated by the level of Fgf signalling, which has enhanced
proximal expression compared to distally amputated fins (Lee et al 2005). In such
way, Fgf signalling controls mitotic index and blastemal length and ultimately the rate
of regenerative outgrowth (Lee et al 2005). Here, our results showed that V-ATPase
and H+ efflux also follow a position-dependent pattern with increased proximal
expression. Furthermore, V-ATPase knockdown decreased proliferation in the
blastema and inhibited mkp3 expression, a downstream target of Fgf signalling.
Together, these data strongly suggest a relation between the V-ATPase activity and
Fgf signalling in the regulation of position-dependent regeneration rate. The H+ pump
Page | 200
Chapter IV – General Discussion
knockdown also inhibited the expression of aldh1a2. As explained before, Aldh1a2 is
crucial for RA synthesis, and RA seems to have a role as instructor of positiondependent cell behaviour. Altogether, these data agree for a role of the V-ATPase in
position-dependent regeneration rate by affecting blastema proliferation through the
modulation of at least two essential signalling pathways, Fgf and RA.
To further investigate the role of V-ATPase in position-dependent regeneration rate,
in the present study we knocked down atp6v1e1b at different time points after
proximal and distal amputation. The most dramatic regeneration reduction was
obtained when the gene knockdown approximated the different onset of H+ efflux at
proximal and distal positions, around 3 and 12 hpa, respectively. In addition, the
decrease in the regenerate area was more pronounced proximally, demonstrating
that regions of higher regeneration rate have stronger dependence on V-ATPase
activity. This suggests that H+ efflux triggers some important mechanism that needs
to be activated earlier in the highly proliferating proximal wounds.
Working model
Overall, our results suggest that V-ATPase H+ pumping activity is part of the signals
that translate position into adequate cell behaviour, including position-dependent
proliferation rate. We propose that some unknown position-instructor signal
upstream of V-ATPase sets the level of expression for this H+ pump according to the
level of amputation along the PD axis. Then, localized V-ATPase H+ pumping activity
in the blastema generates pH and/or voltage domains within the regenerating tissue
that will act, directly or indirectly (for example, via inhibition of nerve supply), as
positive regulators of RA and Fgf signalling, ultimately affecting cell proliferation in
the blastema. As V-ATPase expression (and H+ efflux) is activated earlier and more
strongly in proximal stumps than in distal ones, its activity would exert a stronger
influence on gene expression in proximal stumps than in distal ones, including
Retinoic acid and Fgf signalling, ultimately setting a higher regeneration rate in
proximal amputated fins.
Page | 201
Chapter IV – General Discussion
Fig. IV.1 – V-ATPase H+ pumping activity is required during adult zebrafish caudal fin
regeneration: Working model.
Final Remarks
This project successfully addressed several relevant questions that have long been
holding, regarding the role of bioelectric signals during regeneration. Part of the work
of this thesis was published in an international, peer-reviewed journal: Monteiro et al
(2014). Most of the goals initially proposed were accomplished, as follows:
• To describe the ion composition of electric currents associated with the
regeneration of amputated caudal fins. We generated a profile of ion-fluxes
throughout regeneration. The ion nature of electric current during regeneration
changed with the regeneration stage: K+, Na+, Ca2+ and Cl- effluxes seem to be
components of the injury potential that occurs during the wound healing. On the
other hand, H+ efflux was established and maintained during blastema formation
and early regenerative outgrowth.
• To unveil the molecular basis of the ion dynamics associated with regeneration. The
H+ pump V-ATPase is specifically up-regulated in the regenerating tissue, and it is
responsible, at least in part, for the proton efflux detected.
Page | 202
Chapter IV – General Discussion
• To understand the role of specific ion transporters in the regeneration mechanism.
V-ATPase is required for regeneration, by affecting cell proliferation in the
blastema and fin innervation. V-ATPase H+ pumping activity seems to be involved
in the control of position-dependent regeneration rate: upon amputation at the
proximal plane, where regeneration rate is higher than after distal amputation, VATPase and H+ efflux must be activated earlier and reach stronger levels than
upon distal cut; also, knocking down the H+ pump impaired regeneration more
dramatically at proximal stumps than at distal ones.
• To establish a link between ion dynamics and known molecular pathways involved
in the regeneration process. V-ATPase is required for the expression of aldh1a2
and mkp3 expression in the regenerating tissue. Therefore, it interferes with RA
and Fgf signalling.
The results described in this study support that the V-ATPase is important to adult
vertebrate regeneration. Particularly, our results indicate that the V-ATPase H+
pumping activity orchestrates with major molecular signalling pathways to control
position-dependent regeneration rate. The comprehension of this and other ion-
driven mechanisms underlying adult regeneration may open way for new therapeutic
strategies, both in regenerative and developmental medicine and in cancer therapy.
Page | 203
Chapter IV – General Discussion
Page | 204
Chapter V - References
Chapter V
References
Page | 205
Chapter V - References
Page | 206
Chapter V - References
Achenbach TV, Brunner B, Heermeier K (2003) Oligonucleotide-based knockdown
technologies: antisense versus RNA interference. Chembiochem 4(10):928-935.
Adams DS, Masi A, Levin M (2007) H+ pump-dependent changes in membrane voltage
are an early mechanism necessary and sufficient to induce Xenopus tail regeneration.
Development 134(7): 1323-1335.
Adams DS, Robinson KR, Fukumoto T, Yuan S, Albertson RC, Yelick P, Kuo
L, McSweeney M, Levin M (2006) Early, H+-V-ATPase-dependent proton flux is
necessary for consistent left-right patterning of non-mammalian vertebrates.
Development 133(9):1657-1671.
Adijanto J, Philp NJ (2012) The SLC16A family of monocarboxylate transporters
(MCTs)-physiology and function in cellular metabolism, pH homeostasis, and fluid
transport. Curr Top Membr 70: 275-311.
Adijanto J, Philp NJ (2012) The SLC16A family of monocarboxylate transporters
(MCTs) -physiology and function in cellular metabolism, pH homeostasis, and fluid
transport. Curr Top Membr 70:275-311
Agata H, Saito Y, Nakajima E (2007) Unifying principles of regeneration I:
Epimorphosis versus morphallaxis. Develop Growth Differ 49(2): 73–78.
Akimenko MA, Johnson SL, Westerfield M, Ekker M (1995) Differential induction of
four msx homeobox genes during fin development and regeneration in zebrafish.
Development 121(2): 347–357.
Akimenko MA, Mari-Beffa M, Becerra J, Geraudie J (2003). Old questions, new tools,
and some answers to the mystery of fin regeneration. Dev Dyn 226(2): 190–201.
Albrieux M, Villaz M (2000) Bilateral asymmetry of the inositol triphosphatemediated calcium signaling in two-cell ascidian embryos. Biol Cell 92: 277–284.
Aldrich FA, Aldrich MM (1968) On regeneration of the tentacular arm of the giant
squid Architeuthis dux Steenstrup (Decapoda, Architeuthidae). Can J Zool 46(5): 845847.
Altizer AM, Moriarty LJ, Bell SM, Schreiner CM, Scott WJ, Borgens RB (2001)
Endogenous electric current is associated with normal development of the vertebrate
limb. Dev Dyn 221(4): 391-401.
Amsterdam A, Burgess S, Golling G, Chen W, Sun Z, Townsend K, Farrington S, Haldi
M, Hopkins N (1999) A large-scale insertional mutagenesis screen in zebrafish. Genes
Dev 13(20): 2713-2724.
Anderson JS, Reisz RR, Scott D, Frobisch NB, Sumida SS (2008) A stem batrachian
from the Early Permian of Texas and the origin of frogs and salamanders. Nature
453(7194): 515–18.
Angelotti ML, Ronconi E, Ballerini L, Peired A, Mazzinghi B, Sagrinati C, Parente E,
Gacci M, Carini M, Rotondi M, Fogo AB, Lazzeri E, Lasagni L, Romagnani P (2012)
Page | 207
Chapter V - References
Characterization of renal progenitors committed toward tubular lineage and their
regenerative potential in renal tubular injury. Stem Cells 30(8): 1714-1725.
Aoi T, Yae K, Nakagawa M, Ichisaka T, Okita K, Takahashi K, Chiba T, Yamanaka S
(2008) Generation of pluripotent stem cells from adult mouse liver and stomach cells.
Science 321(5889): 699-702.
Arai H, Terres G, Pink S, Forgac M (1988) Topography and subunit stoichiometry of
the coated vesicle proton pump. J Biol Chem 263(18): 8796–8802.
Arcangeli A, Rosati B, Cherubini A, Crociani O, Fontana L, Ziller C, Wanke E, Olivotto M
(1997) HERGand IRK-like inward rectifier currents are sequentially expressed during
neuronal development of neural crest cells and their derivatives. Eur J Neurosci 9(12):
2596-2604.
Arrieta O, García-Navarrete R, Zúñiga S, Ordóñez G, Ortiz A, Palencia G, MoralesEspinosa D, Hernández-Pedro N, Sotelo J (2005) Retinoic acid increases tissue and
plasma contents of nerve growth factor and prevents neuropathy in diabetic mice.
Eur J Clin Invest 35(3):201-207.
Austin KM, Nguyen N, Javid G, Covic L, Kuliopulos A (2013) Noncanonical
matrix metallo-protease-1-protease-activated receptor-1 signaling triggers vascular
smooth
muscle
cell
dedifferentiation and
arterial
stenosis.
J
Biol
Chem 288(32):23105-15.
Avaron
F, Hoffman
L, Guay
D, Akimenko
MA
(2006)
Characterization of two new zebrafish members of the hedgehog family: atypical
expression of a zebrafish indian hedgehog gene in skeletal elements of both
endochondral and dermal origins. Dev Dyn 235(2): 478-489.
Aw S, Levin M (2009) Is left-right asymmetry a form of planar cell polarity?
Development 136(3): 355–366.
Axon Instruments Inc (1993). The Axon Guide for Electrophysiology & Biophysics
Laboratory Techniques. Foster City, USA: Axon Instruments, Inc.
Azevedo AS, Grotek B, Jacinto A, Weidinger G, Saúde L (2011) The Regenerative
Capacity of the Zebrafish Caudal Fin Is Not Affected by Repeated Amputations. PLoS
ONE 6(7): e22820.
Azevedo AS, Sousa S, Jacinto A, Saúde L (2012) An amputation resets positional
information to a proximal identity in the regenerating zebrafish caudal fin. BMC Dev
Biol 12:24.
Bai S, Thummel R, Godwin AR, Nagase H, Itoh Y, Li L, Evans R, McDermott J, Seiki
M, Sarras
MP
Jr
(2005)
Matrix metalloproteinase expression and function during fin regeneration in
zebrafish: analysis of MT1-MMP, MMP2 and TIMP2. Matrix Biol 24(4): 247-260.
Page | 208
Chapter V - References
Barbosa-Sabanero K, Hoffmann A, Judge C, Lightcap N, Tsonis PA, Del Rio-Tsonis K
(2012) Lens and retina regeneration: new perspectives from model organisms.
Biochem J 447(3): 321-334.
Barker AT, Jaffe LF, Vanable JW Jr (1982) The glabrous epidermis of cavies contains a
powerful battery. Am J Physiol 242(3): R358-366.
Basak S, Lim J, Manimekalai MS, Balakrishna AM, Grüber G (2013) Crystal and NMR
structures give insights into the role and dynamics of subunit F of the eukaryotic VATPase from Saccharomyces cerevisiae. J Biol Chem 288(17): 11930-11939.
Baxendale S, Chen C-K, Tang H, Davison C, Hateren LV, Croning MDR, Humphray SJ,
Hubbard SJ, Ingham PW (2009) Expression screening and annotation of a zebrafish
myoblast cDNA library. Gene Expr Patterns 9(2): 73–82.
Bayliss PE, Bellavance KL, Whitehead GG, Abrams JM, Aegerter S, Robbins HS, Cowan
DB, Keating MT, O’Reilly T, Wood JM, Roberts TM, Chan J (2006) Chemical modulation
of receptor signaling inhibits regenerative angiogenesis in adult zebrafish. Nat Chem
Biol 2(5): 265-273.
Beane WS, Morokuma J, Adams DS, Levin M (2011) A chemical genetics approach
reveals
H,K-ATPase-mediated membrane
voltage is required for planarian head
regeneration. Chem Biol 18(1): 77-89.
Beane WS, Morokuma J, Lemire JM, Levin M (2013) Bioelectric signaling regulates
head and organ size during planarian regeneration. Development 140(2): 313-322.
Becerra J, Junqueira LCU Bechara IJ, Montes GS (1996) Regeneration of fin rays in
teleosts: a histochemical, radioautographic, and ultrastructural study. Arch Histol
Cytol 59(1): 15-35.
Becerra J, Montes GS, Bexiga SRR, Junqueira LCU (1983) Structure of the tail fin in
teleosts. Cell Tissue Res 230(1): 127-137.
Becker RO (1972) Stimulation of partial limb regeneration in rats. Nature 235: 109–
111.
Becker T, Wullimann MF, Becker CG, Bernhardt RR, Schachner M (1997) Axonal
regrowth after spinal cord transection in adult zebrafish. J Comp Neurol 377(4): 577595.
Bely AE (2006) Distribution of segment regeneration ability in the Annelida. Integr
Comp Biol 46(4): 508-518.
Bely AE (2012) Evolutionary Loss of Animal Regeneration: Pattern and Process.
Integr Comp Biol, 50(4): 515–527.
Bely AE (2013) Distribution of segment regeneration ability in the Annelida. Wiley
Interdiscip Rev Dev Biol 2(3): 301-326.
Page | 209
Chapter V - References
Bely AE, Sikes JM (2010) Latent regeneration abilities persist following recent
evolutionary loss in asexual annelids. Proc Natl Acad Sci USA 107(4): 1464–1469.
Bernhardt RR, Tongiorgi E, Anzini P, SchachnerM (1996) Increased expression of
specific recognition molecules by retinal ganglion cells and by optic pathway glia
accompanies the successful regeneration of retinal axons in adult zebrafish. J Comp
Neurol 376(2): 253–264.
Bijlenga P, Liu JH, Espinos E, Haenggeli CA, Fischer-Lougheed J, Bader CR, Bernheim L
(2000) T-type α1H Ca2+ channels are involved in Ca2+ signaling during terminal
differentiation (fusion) of human myoblasts. Proc Natl Acad Sci USA 97(13): 76277632.
Bill BR, Petzold AM, Clark KJ, Schimmenti LA, Ekker SC (2009) A primer for
morpholino use in zebrafish. Zebrafish 6(1): 69-77.
Bjornsson CS, Huebner E (2004) Extracellular H+ dynamics during oogenesis in
Rhodnius prolixus ovarioles. J Exp Biol 207(Pt 16):2835-2844.
Blackiston DJ, McLaughlin
KA, Levin
M
(2009)
Bioelectric controls of cell
proliferation: ion channels, membrane voltage and the cell cycle. Cell Cycle 8(21):
3519-3528.
Block ML, Moody WJ (1990) A voltage-dependent chloride current linked to the cell
cycle in ascidian embryos. Science 247: 1090-1092.
Blum N, Begemann G (2012) Retinoic acid signaling controls the formation,
proliferation and survival of the blastema during adult zebrafish fin regeneration.
Development 139(1): 107-16.
Böckelmann PK, Bechara IJ (2009) The regeneration of the tail fin actinotrichia of
carp (Cyprinus carpio, Linnaeus, 1758) under the action of naproxen. Braz J
Biol 69(4): 1165-1172.
Boedtkjer E, Aalkjaer C (2012) Intracellular pH in the resistance vasculature:
regulation and functional implications. J Vasc Res 49(6): 479-496.
Boesch ST, Eller B, Pelster B (2003) Expression of two isoforms of the vacuolar-type
ATPase subunit B in the zebrafish Danio rerio. J Exp Biol 206(Pt 11): 1907-1915.
Borgens RB, Callahan L, Rouleau M (1987) Anatomy of axolotl flank integument
during limb bud development with special reference to a transcutaneous current
predicting limb formation. J Exp Zool 244: 203–214.
Borgens RB, Jaffe LF, Cohen MJ (1980) Large and persistent electrical currents enter
the transected lamprey spinal cord. Proc Natl Acad Sci USA 77(2): 1209-1213.
Borgens RB, Rouleau MF, DeLanney LE (1983) A steady efflux of ionic current
predicts hind limb development in the axolotl. J Exp Zool 228: 491–503.
Page | 210
Chapter V - References
Borgens RB, Shi R (1995) Uncoupling histogenesis from morphogenesis in the
vertebrate embryo by collapse of the transneural tube potential. Dev Dyn 203: 456–
467.
Borgens RB, Vanable JW Jr, Jaffe LF (1977) Bioelectricity and regeneration: large
currents leave the stumps of regenerating newt limbs. Proc Natl Acad Sci USA 74(10):
4528-4532.
Borgens RB, Vanable JW Jr, Jaffe LF (1979a) Role of subdermal current shunts in the
failure of frogs to regenerate. J Exp Zool 209: 49–56.
Borgens RB, Vanable JW Jr, Jaffe LF (1979b) Bioelectricity and regeneration. I.
Initiation of frog limb regeneration by minute currents. J Exp Zool 200: 403–416.
Borgens RB, Vanable JW Jr, Jaffe LF (1979c) Small artificial currents enhance Xenopus
limb regeneration. J. Exp. Zool. 207: 217–226.
Borgens RB, Vanable JW Jr, Jaffe LF (1979d) Reduction of sodium dependent stump
currents disturbs urodele limb regeneration. J Exp Zool 209(3): 377-386.
Boron WF (2004) Regulation of intracellular pH. Adv Physiol Educ 28(1-4): 160-179.
Bosse F (2012) Extrinsic cellular and molecular mediators of peripheral axonal
regeneration. Cell Tissue Res 349(1): 5-14.
Boudko DY, Moroz LL, Linser PJ, Trimarchi JR, Smith PJ, Harvey WR (2001) In situ
analysis of pH gradients in mosquito larvae using non-invasive, self-referencing, pHsensitive microelectrodes. J Exp Biol 204(Pt 4): 691-699.
Bowman
EJ, Graham
LA, Stevens
TH, Bowman
BJ
(2004)
The
bafilomycin/concanamycin binding site in subunit c of the V-ATPases from
Neurospora crassa and Saccharomyces cerevisiae. J Biol Chem 279(32):33131-33138.
Bowman BJ, Bowman EJ (2002) Mutations in subunit C of the vacuolar ATPase
confer resistance to bafilomycin and identify a conserved antibiotic binding site. J Biol
Chem 277(6):3965-72.
Bowman EJ, Bowman BJ (2005) V-ATPases as drug targets. J Bioenerg Biomembr
37(6):431-435.
Bowman EJ, O'Neill FJ, Bowman BJ (1997) Mutations of pma-1, the gene encoding the
plasma membrane H+-ATPase of Neurospora crassa, suppressinhibition of growth by
concanamycin A, a specific inhibitor of vacuolar ATPases. J Biol Chem 272(23): 1477614786.
Brittijn SA, Duivesteijn SJ, Belmamoune M, Bertens LF, Bitter W, de Bruijn
JD, Champagne DL, Cuppen E, Flik G, Vandenbroucke-Grauls CM, Janssen RA, de Jong
IM, de Kloet ER, Kros A, Meijer AH, Metz JR, van der Sar AM, Schaaf MJ, SchulteMerker S, Spaink HP, Tak PP, Verbeek FJ, Vervoordeldonk MJ, Vonk FJ,Witte F, Yuan
H, Richardson MK (2009) Zebrafish development and regeneration: new tools for
biomedical research. Int J Dev Biol 53(5-6): 835-850.
Page | 211
Chapter V - References
Brockes JP (1997) Amphibian limb regeneration: rebuilding a complex structure.
Science 276(5309): 81-87.
Brockes JP, Kumar A (2008) Comparative aspects of animal regeneration. Annu Rev
Cell Dev Biol 24: 525–549.
Brockes JP, Kumar A, Velloso CP (2001) Regeneration as an evolutionary variable. J
Anat 199: 3–11.
Brown AM, Fisher S, Iovine MK (2009) Osteoblast maturation occurs in overlapping
proximal-distal compartments during fin regeneration in zebrafish. Dev Dyn 238(11):
2922-2928.
Brulfert A, Monnot MJ, Géraudie J (1998) Expression of two even-skipped genes eve1
and evx2 during zebrafish fin morphogenesis and their regulation by retinoic acid. Int
J Dev Biol 42(8):1117-1124.
Budai D (2004) Ultralow-noise headstage and main amplifiers for extracellular spike
recording. Acta Biologica Szegediensis 48(1-4):13-17.
Buechling T, Bartscherer K, Ohkawara B, Chaudhary V, Spirohn K, Niehrs C, Boutros M
(2010) Wnt/Frizzled signaling requires dPRR, the Drosophila homolog of the
prorenin receptor. Curr Biol 20(14):1263-1268.
Burr HS (1942) Electrical correlates of growth in corn roots. Yale J Biol Med 14: 581–
588.
Burr HS, Nelson O (1946) Growth correlates of electromotive forces in maize seeds.
Proc Natl Acad Sci USA 32: 73–84.
Cameron DA (2000) Cellular proliferation and neurogenesis in the injured retina of
adult zebrafish. Vis Neurosci 17(5): 789-797.
Campbell LJ, Crews CM (2008) Wound epidermis formation and function in urodele
amphibian limb regeneration. Cell Mol Life Sci 65(1):73-79.
Candia OA, Zadunaisky JA, Bajandas F (1968) Electrical potential profile of the
isolated frog cornea. Invest Ophthalmol 7(4): 405-415.
Cano-Martínez A, Vargas-González A, Guarner-Lans V, Prado-Zayago E, León-Oleda M,
Nieto-Lima B (2010) Functional and structural regeneration in the axolotl heart
(Ambystoma mexicanum) after partial ventricular amputation. Arch Cardiol Mex
80(2): 79-86.
Carlson BM (2007) Principles of regenerative biology. Burlington (MA): Academic
Press.
Page | 212
Chapter V - References
Casey JR, Grinstein S, Orlowski J (2010) Sensors and regulators of intracellular pH.
Nat Rev Mol Cell Biol 11(1):50-61.
Cerda GA, Thomas JE, Allende ML, Karlstrom RO, Palma V (2006) Electroporation of
DNA, RNA, and morpholinos into zebrafish embryos. Methods 39(3): 207-211.
Certal AC, Almeida RB, Carvalho LM, Wong E, Moreno N, Michard E, Carneiro J,
Rodriguéz-Léon J, Wu H-M, Cheung AY, Feijó, JÁ (2008) Exclusion of a Proton ATPase
from the Apical Membrane Is Associated with Cell Polarity and Tip Growth in
Nicotiana tabacum Pollen Tubes. The Plant Cell 20: 614–634.
Chablais F, Jazwinska A (2010) IGF signaling between blastema and wound epidermis
is required for fin regeneration. Development 137(6): 871-879.
Chakraborty
C,
Roy
SS,
Hsu
MJ,
Agoramoorthy
G
(2014)
Network analysis of transcription factors for nuclear reprogramming into induced
pluripotent stem cell using bioinformatics. Cell J 15(4): 332-9.
Chargé SB, Rudnicki MA (2004) Cellular and molecular regulation of muscle
regeneration. Physiol Rev 84(1): 209-238.
Chen et al (2006) Control of muscle regeneration in the Xenopus tad Pole tail by pax7.
Development 133(12): 2303-2313.
Chera S, Ghila L, Dobretz K, Wenger Y, Bauer C, Buzgariu W, Martinou JC, Galliot B
(2009) Apoptotic cells provide an unexpected source of Wnt3 signaling to drive hydra
head regeneration. Dev Cell 17(2): 279-289.
Cheung A, Dantzig JA, Hollingworth S, Baylor SM, Goldman YE, Mitchison TJ, Straight
AF (2002) A small-molecule inhibitor of skeletal muscle myosin II. Nat Cell Biol
4(1):83-8.
Chhabra P, Brayman KL (2013) Stem cell therapy to cure type 1 diabetes: from hype
to hope. Stem Cells Transl Med 2(5):328-36.
Chiabrera A, Hinsenkamp M, Pilla AA, Ryaby J, Ponta D, Belmont A, Beltrame
F, Grattarola M, Nicolini C (1979) Cytofluorometry of electromagnetically controlled
cell dedifferentiation. J Histochem Cytochem 27(1): 375-381.
Chiang M, Cragoe EJ Jr, Vanable JW (1989) Electrical Fields in the Vicinity of Small
Wounds in Notophthalmus viridescens Skin. Biol Bull 176(S): 179-183.
Chiang M, Cragoe EJ Jr, Vanable JW (1991) Intrinsic electric fields promote
epithelialization of wounds in the newt, Notophthalmus viridescens. Dev Biol 146:
377–385.
Chung AY, Kim MJ, Kim D, Bang S, Hwang SW, Lim CS, Lee S, Park HC, Huh TL (2010)
Neuron-specific expression of atp6v0c2 in zebrafish CNS. Dev Dyn 239(9):2501-2508.
Page | 213
Chapter V - References
Cipriano DJ, Wang Y, Bond S, Hinton A, Jefferies KC, Qi J, Forgac M (2008)
Structure and regulation of the vacuolar ATPases. Biochim Biophys Acta 1777(7-8):
599-604.
Clement DL, Mally S, Stock C, Lethan M, Satir P, Schwab A, Pedersen SF, Christensen
ST (2013) PDGFRα signaling in the primary cilium regulates NHE1-dependent
fibroblast migration via coordinated differential activity of MEK1/2-ERK1/2-p90RSK
and AKT signaling pathways. J Cell Sci 126: 953-965.
Codina M, Li J, Gutiérrez J, Kao JP, Du SJ (2010) Loss of Smyhc1 or Hsp90alpha1
function results in different effects on myofibril organization in skeletal muscles of
zebrafish embryos. PLoS One 5(1):e8416.
Compton MA, Graham LA, Stevens TH (2006) Vma9p (subunit e) is an integral
membrane V0 subunit of the yeast V-ATPase. J Biol Chem 281(22): 15312-15319.
Cone CD Jr, Tongier M Jr (1971) Control of somatic cell mitosis by simulated changes
in the transmembrane potential level. Oncology 25: 168-182.
Cone CD, Cone CM (1976) Induction of mitosis in mature neurons in central nervous
system by sustained depolarization. Science 192: 155-158.
Cruciat CM, Ohkawara B, Acebron SP, Karaulanov E, Reinhard C, Ingelfinger
D, Boutros M, Niehrs C (2010) Requirement of Prorenin Receptor and Vacuolar H+ATPase–Mediated Acidification for Wnt Signaling. Science 327(5964): 459-463.
Cullen KD, Martin RJ (1982) Dissimilar influences of some injectable anaesthetics on
the responses of reticulo-spinal neurones to inhibitorytransmitters in the lamprey. Br
J Pharmacol 77(3):493-504.
Czepán M, Rakonczay Z Jr, Varró A, Steele I, Dimaline R, Lertkowit N, Lonovics
J, Schnúr A, Biczó G, Geisz A, Lázár G, Simonka Z, Venglovecz V, Wittmann T,Hegyi P
(2012). NHE1 activity contributes to migration and is necessary for proliferation of
human gastric myofibroblasts. Pflugers Arch 463(3):459-75.
da Silva SM, Gates PB, Brockes JP (2002) The newt ortholog of CD59 is implicated in
proximodistal identity during amphibian limb regeneration. Dev Cell 3(4): 547-555.
Dahlem TJ, Hoshijima K, Jurynec MJ, Gunther D, Starker CG, Locke AS, Weis
AM, Voytas DF, Grunwald DJ (2012) Simple methods for generating and detecting
locus-specific mutations induced with TALENs in the zebrafish genome. PLoS Genet
8(8):e1002861.
Das S, Durica DS (2013) Ecdysteroid receptor signaling disruption obstructs
blastemal cell proliferation during limb regeneration in the fiddler crab, Uca
pugilator. Mol Cell Endocrinol 365(2): 249-259.
Day ML, Pickering SJ, Johnson MH, Cook DI (1993) Cell cycle control of a largeconductance K+ channel in mouse early embryos. Nature 365: 560-562.
Page | 214
Chapter V - References
Decoursey
TE
(2003)
Voltagegated proton channels and other proton transfer pathways. Physiol Rev 83(2): 475579.
Dettmer J, Liu TY, Schumacher K (2010) Functional analysis of Arabidopsis VATPase subunit VHA-E isoforms. Eur J Cell Biol 89(2-3): 152-156.
Diepholz M, Börsch M, Böttcher B (2008) Structural organization of the V-ATPase and
its implications for regulatory assembly and disassembly. Biochem Soc Trans 36(Pt 5):
1027-1031.
Dingerkus G, Santoro ED (1981) Cornea regeneration in the Pacific giant octopus,
octopus dofleini, and the common octopus, O. vulgaris. Experientia 37(4): 368-369.
Dinsmore CE, Goss RJ, Skinner DM, Cook JS, Lenhoff HM, Lenhoff SG, Benson KR,
Singer M, Géraudie J, Churchill FB, Maienschein J, Vanable Jr JW, Liversage RA,
Wolpert L (1991) A History of regeneration research – Milestones in the evolution of a
Science. Cambridge: Cambridge University Press.
Domgall I, Venzke D, Lüttge U, Ratajczak R, Böttcher B. (2002) Three-dimensional
map of a plant V-ATPase based on electron microscopy. J Biol Chem 277(15): 1311513121.
Donini A, O'Donnell MJ. (2005) Analysis of Na+, Cl-, K+, H+ and NH 4 + concentration
gradients adjacent to the surface of anal papillae of the mosquito Aedes aegypti:
application of self-referencing ion-selective microelectrodes. J Exp Biol 208(Pt 4):
603-610.
Dröse S, Bindseil KU, Bowman EJ, Siebers A, Zeeck A, Altendorf K (1993) Inhibitory
effect of modified bafilomycins and concanamycins on P- and V-type
adenosinetriphosphatases. Biochemistry 32(15):3902-3906.
Dröse S, Altendorf K (1997) Bafilomycins and concanamycins as inhibitors of VATPases and P-ATPases. J Exp Biol 200(Pt 1):1-8.
Du Bois-Reymond E (1843) Vorläufiger Abriss einer Untersuchung uber den
sogenannten Froschstrom und die electomotorischen Fische. Ann Phys Chem 58: 1–
30.
Dungan KM, Wei TY, Nace JD, Poulin ML, Chiu IM, Lang JC, Tassava RA (2002)
Expression and biological effect of urodele fibroblast growth factor 1: relationship to
limb regeneration. J Exp Zool 292(6):540-544.
Duprey-Díaz MV, Blagburn JM, Blanco RE (2012) Changes in fibroblast growth factor2 and FGF receptors in the frog visual system during optic nerve regeneration. J Chem
Neuroanat 46(1-2):35-44.
Echeverri K, Tanaka EM (2002) Mechanisms of muscle dedifferentiation during
regeneration. Semin Cell Dev Biol 13(5): 353–360.
Page | 215
Chapter V - References
Echeverri K, Clarke JD, Tanaka EM (2001) In vivo imaging indicates muscle fiber
dedifferentiation is a major contributor to the regenerating tail blastema. Dev Biol
236(1):151-164.
Echeverri K, Tanaka EM (2005) Proximodistal patterning during limb regeneration.
Dev Biol 279(2): 391-401.
Eisen JS, Smith JC (2008) Controlling morpholino experiments: don’t stop making
Antisense. Development 135(10): 1735-43.
Eisen JS. (1996) Zebrafish make a big splash. Cell 87(6): 969-977.
Elliott SA, Sánchez Alvarado A (2013) The history and enduring contributions
of planarians to the study of animal regeneration. Wiley Interdiscip Rev Dev Biol 2(3):
301-326.
Eming SA,
Krieg
T,
Davidson
JM
(2007)
Inflammation
in wound
repair: molecular and cellular mechanisms. J Invest Dermatol 127(3):514-525.
Ensembl
Project
Zv9
(2014).
http://www.ensembl.org/Danio_rerio/Info/Index
Retrieved
from
Esser AT, Smith KC, Weaver JC, Levin M (2006) Mathematical model of morphogen
electrophoresis through gap junctions. Dev Dyn 235(8): 2144–2159.
Fang KS, Ionides E, Oster G, Nuccitelli R, Isseroff RR (1999) Epidermal growth factor
receptor relocalization and kinase activity are necessary for directional migration of
keratinocytes in DC electric fields. J Cell Sci 112(Pt 12): 1967–78.
Feijó JA, Sainhas J, Holdaway-Clarke T, Cordeiro MS, Kunkel JG, Hepler PK (2001)
Cellular oscillations and the regulation of growth: The pollen tube paradigm.
Bioessays 23: 86–94.
Felle HH (2001) pH: signal amd messenger in plant cells. Plant Biology 3: 577-591.
Ferretti P, Géraudie J (1995) Retinoic acid- induced cell death in the wound epidermis
of the regenerating zebrafish fins. Dev Dyn 202(3): 271-83.
Féthière J, Venzke D, Madden DR, Böttcher B (2005) Peripheral Stator of the Yeast VATPase: Stoichiometry and Specificity of Interaction between the EG Complex and
Subunits C and H. Biochemistry 44: 15906-15914.
Fischer AH, Jacobson KA, Rose J, Zeller R (2008) Hematoxylin and eosin staining of
tissue and cell sections. CSH Protoc pdb.prot4986.
Fischer-Lougheed J, Liu JH, Espinos E, Mordasini D, Bader CR, Belin D, Bernheim L
(2001) Human myoblast fusion requires expression of functional inward rectifier
Kir2.1 channels. J Cell Biol 153(4): 677-686.
Page | 216
Chapter V - References
Flanagan LA, Lu J,Wang L, Marchenko SA, Jeon NL, Lee AP, Monuki ES (2008). Unique
dielectric properties distinguish stem cells and their differentiated progeny. Stem
Cells 26(3): 656–665
flux. Commun Integr Biol 4(5): 524-527.
Forgac M (2007)
Vacuolar ATPases: rotary proton pumps in physiology and
pathophysio-logy. Nat Rev Mol Cell Biol 8(11): 917-929.
Foulds IS, Barker AT (1983) Human skin battery potentials and their possible role in
wound healing. Br J Dermatol 109(5): 515-522.
Foury F (1990) The 31-kDa polypeptide is an essential subunit of the vacuolar
ATPase in Saccharomyces cerevisiae. Journal of Biological Chemistry 265 (30): 1855418560.
Fraser SP, Diss JK, Chioni AM, Mycielska ME, Pan H, Yamaci RF, Pani F, Siwy
Z, Krasowska M, Grzywna Z, Brackenbury WJ, Theodorou D, Koyutürk M, Kaya
H,Battaloglu E, De Bella MT, Slade MJ, Tolhurst R, Palmieri C, Jiang J, Latchman
DS, Coombes RC, Djamgoz MB (2005) Voltage-gated sodium channel expression and
potentiation of human breast cancer metastasis. Clin Cancer Res 11(15): 5381-5389.
Fukumoto T, Kema IP, Levin M (2005) Serotonin signaling is a very early step in
patterning of the left-right axis in chick and frog embryos. Curr Biol 15(9): 794–803.
Galis
F, Wagner
GP, Jockusch
EL
(2003)
Why is limb regeneration possible in amphibians but not in reptiles, birds, and
mammals? Evol Dev 5(2): 208-220.
Gallagher SM, Castorino JJ, Philp NJ (2009) Interaction of monocarboxylate
transporter 4 with β1-integrin and its role in cell migration. Am J Physiol Cell Physiol
296: C414–C421.
Gallagher SM, Castorino JJ, Wang D, Philp NJ (2007) Monocarboxylate transporter 4
regulates maturation and trafficking of CD147 to the plasma membrane in the
metastatic breast cancer cell line MDA-MB-231. Cancer Res 1;67(9): 4182-4189.
Gallagher-Colombo S, Maminishkis A, Tate S, Grunwald BJ, Philp NJ (2010)
Modulation of MCT3 Expression during Wound Healing of the Retinal Pigment
Epithelium. Invest Ophthalmol Vis Sci 51: 5343–5350.
Galliot B (2012) Hydra, a fruitful model system for 270 years. Int J Dev Biol 56(6-8):
411-423.
Galliot B, Chera S (2010) The Hydra model: disclosing an apoptosis-driven generator
of Wnt-based regeneration. Trends Cell Biol 20(9): 514-523.
Gargioli C, Slack JM (2004) Cell lineage tracing during Xenopus tail regeneration.
Development 131(11): 2669-2679.
Page | 217
Chapter V - References
Garza-Garcia AA, Driscoll PC, Brockes JP (2010) Evidence for the local evolution of
mechanisms underlying limb regeneration in salamanders. Integr Comp Biol 50(4):
528-535.
Geddes LA, Hoff HE (1971) The discovery of bioelectricity and current electricity. The
Galvani-Volta controversy. IEEE Spectrum 8: 38–46.
GeneChip® Zebrafish Genome Array Daya sheet (2004). Retrieved from
http://www.affymetrix.com/support/technical/byproduct.affx?product=zebrafish
Géraudie J (1980) Mitotic activity in the pseudoapical ridge of the trout pelvic fin bud,
Salmo gairdnieri. J Exp Zool 214(3): 311–316.
Géraudie J, Monnot MJ, Brulfert A, Ferretti P (1995) Caudal fin regeneration in wild
type and long-fin mutant zebrafish is affected by retinoic acid. Int J Dev Biol 39(2):
373-381.
Géraudie J, Singer M (1977) Relation between nerve fiber number and pectoral fin
regeneration in the teleost. J Exp Zool 199(1): 1-8.
Ghanawi J, Monzer S, Saoud IP (2013) Anaesthetic efficacy of clove oil,
benzocaine,2-phenoxyethanol and tricaine methanesulfonatein juvenile
marbled spinefoot (Siganus rivulatus). Aquaculture Research 44: 359- 366.
Golling G, Amsterdam A, Sun Z, Antonelli M, Maldonado E, Chen W, Burgess S, Haldi
M, Artzt K, Farrington S, Lin SY, Nissen RM, Hopkins N (2002) Insertional
mutagenesis in zebrafish rapidly identifies genes essential for early vertebrate develo
pment. Nat Genet 31(2):135-140.
Goss RJ (1969) Principles of Regeneration. New York: Academic Press.
Goss RJ (1991) The natural history (and mistery) of regeneration. A History of
regeneration research – Milestones in the evolution of a Science (pp. 1-24) Cambridge:
Cambridge University Press.
Govindan
J, Iovine
dependent growth and
One 9(2):e88574.
MK
(2014)
patterning in the
Hapln1a is required for connexin43regenerating fin skeleton. PLoS
Guidelines of the Canadian Council on Animal Care (2004) The Canadian council on
animal welfare. Retrieved from: http://www.ccac.ca/en_/standards/guidelines
Gurdon JB (1962) Adult frogs derived from the nuclei of single somatic cells. Dev
Biol 4: 256-273.
Gurdon JB, Byrne JA, Simonsson S (2003) Nuclear reprogramming and stem cell
creation. Proc Natl Acad Sci USA 100 Suppl 1: 11819-11822.
Gurdon JB, Melton DA (2008) Nuclear reprogramming in cells. Science 322(5909):
1811-1815.
Page | 218
Chapter V - References
Haas, HJ (1962) Studies on mechanisms of joint and bone formation in the skeleton
rays of fish fins. Dev Biol 5: 1– 34.
Habela CW, Olsen ML, Sontheimer H (2008) ClC3 is a critical regulator of the cell cycle
in normal and malignant glial cells. J Neurosci 28: 9205-9217.
Hall BK (2005) Bones and Cartilage: Developmental and Evolutionary Skeletal Biology.
London: Elsevier Academic Press.
Halpern ME, Rhee J, Goll MG, Akitake CM, Parsons M, Leach SD (2008) Gal4/UAS
transgenic tools and their application to zebrafish. Zebrafish 5(2):97-110.
Hamann M, Widmer H, Baroffio A, Aubry JP, Krause RM, Kaelin A, Bader CR (1994)
Sodium and potassium currents in freshly isolated and in proliferating human muscle
satellite cells. J Physiol 475(2): 305-317.
Han M, Yang X, Lee J, Allan CH, Muneoka K (2008) Development and regeneration of
the neonatal digit tip in mice. Dev Biol 315: 125–135.
Hans S, Freudenreich D, Geffarth M, Kaslin J, Machate A, Brand M (2011) Generation
of
a non-leaky heat shockinducible Cre line for conditional Cre/lox strategies in zebrafish. Dev Dyn 240(1): 108115.
Harrington DB, Becker RO (1973) Electrical stimulation of RNA and protein synthesis
in the frog erythrocyte. Exp Cell Res 76(1): 95-98.
Hatler JM, Essner JJ, Johnson RG (2009) A gap junction connexin is required in the
vertebrate left-right organizer. Dev Biol 336(2):183-191.
Hayashi K, Sun-Wada GH, Wada Y, Nakanishi-Matsui M, Futai M (2008) Defective
assembly of a hybrid vacuolar H(+)-ATPase containing the mouse testis-specific E1
isoform and yeast subunits. Biochim Biophys Acta 1777(10): 1370-1377.
Hedrich R (2012) Ion channels in plants. Physiol Rev 92(4): 1777-1811.
Hedrick MS, Winmill RE (2003) Excitatory and inhibitory effects of tricaine (MS-222)
on fictive breathing in isolated bullfrog brain stem. Am J Physiol Regul Integr Comp
Physiol 284(2):R405-12.
Heming TA, Bidani A (2003) Intracellular pH regulation in U937 human monocytes:
roles of V-ATPase and Na+/H+ exchange. Immunobiology 207(2): 141-148
Henriksen K, Andreassen KV, Thudium CS, Gudmann KN, Moscatelli I, Crüger-Hansen
CE, Schulz AS, Dziegiel MH, Richter J, Karsdal MA, Neutzsky-Wulff AV (2012) A
specific subtype of osteoclasts secretes factors inducing nodule formation by
osteoblasts. Bone 51(3):353-361.
Hermle T, Saltukoglu D, Grünewald J, Walz G, Simons M (2010) Regulation of Frizzleddependent planar polarity signaling by a V-ATPase subunit. Curr Biol 20(14):12691276.
Page | 219
Chapter V - References
Hernroth B, Farahani F, Brunborg G, Dupont S, Dejmek A, Sköld HN (2010) Possibility
of mixed progenitor cells in sea star arm regeneration. J Exp Zool B Mol Dev
Evol 314(6): 457-468.
Hille C, Walz B (2007) A vacuolar-type H+-ATPase and a Na+/H+ exchanger contribute
to intracellular to intracellular pH regulation in cockroach salivary ducts. J Exp Biol
210: 1463-1471.
Hinton A, Bond
S, Forgac
M
(2009)
VATPase functions in normal and disease processes. Pflugers Arch 457(3): 589-598.
Hinton A, Sennoune SR, Bond S, Fang M, Reuveni M, Sahagian GG, Jay D, MartinezZaguilan R, Forgac M. (2009) Function of a subunit isoforms of the V-ATPase in pH
homeostasis and in vitro invasion of MDA-MB231 humanbreast cancer cells. J Biol
Chem 284(24): 16400-16408.
Ho MN, Hirata R, Umemoto N, Ohya Y, Takatsuki A, Stevens TH, Anraku Y (1993)
VMA13 encodes a 54-kDa vacuolar H(+)-ATPase subunit required for activity but not
assembly of the enzyme complex in Saccharomyces cerevisiae. J Biol Chem 268(24):
18286-18292.
Holliday
LS, Bubb
MR, Jiang
J, Hurst
IR, Zuo
J
(2005)
Interactions between vacuolar H+-ATPases and microfilaments in osteoclasts.
J
Bioenerg Biomembr 37(6): 419-423.
Holliday LS, Lu M, Lee BS, Nelson RD, Solivan S, Zhang L, Gluck SL (2000) The aminoterminal domain of the B subunit of vacuolar H+-ATPase contains a filamentous actin
binding site. J Biol Chem 275(41): 32331-32337.
Holstein TW, Hobmayer E, David CN (1991) Pattern of epithelial cell cycling in Hydra.
Dev Biol 148(2): 602–611.
Hoptak-Solga AD, Klein KA, DeRosa AM, White TW, Iovine MK (2007) Zebrafish short
fin mutations in connexin43 lead to aberrant gap junctional intercellular
communication. FEBS Lett 581(17): 3297-3302.
Hoptak-Solga AD, Nielsen S, Jain I, Thummel R, Hyde DR, Iovine MK (2008)
Connexin43
(GJA1)
is required in
the population of dividing cells during fin regeneration. Dev Biol 317(2): 541-548.
Hotary KB, Robinson KR (1990) Endogenous electrical currents and the resultant
voltage gradients in the chick embryo. Dev Biol 140: 149–160.
Hotary KB, Robinson KR (1991) The neural tube of the Xenopus embryo maintains a
potential difference across itself. Brain Research. Development and Brain Research
59(1): 65.
Hotary KB, Robinson KR (1992) Evidence of a role for endogenous electrical fields in
chick embryo development. Development 114: 985–996.
Page | 220
Chapter V - References
Hotary KB, Robinson KR (1994) Endogenous electrical currents and voltage gradients
in Xenopus embryos and the consequences of their disruption. Dev Biol 166: 789–800.
Huss M, Ingenhorst G, König S, Gassel M, Dröse S, Zeeck A, Altendorf K, Wieczorek H
(2002) Concanamycin A, the specific inhibitor of V-ATPases, binds to the V(o) subunit
c. J Biol Chem 277(43): 40544-40548.
Huss M, Wieczorek H (2009) Inhibitors of V-ATPases: old and new players. J Exp Biol
201(Pt 3):341-346.
Hyde DR, Godwin AR, Thummel R (2012) In vivo electroporation of morpholinos into
the regenerating adult zebrafish tail fin. J Vis Exp 29: (61).
Illingworth CM (1974) Trapped fingers and amputated finger tips in children. J
Pediatr Surg 9: 853–858.
Illingworth CM, Barker AT (1980) Measurement of electrical currents emerging
during the regeneration of amputated finger tips in children. Clin Phys Physiol
Meas 1:87
Imamura H, Funamoto S, Yoshida M, Yokoyama K (2006) Reconstituition in vitro of
V1 complex of Thermus thermophilus V-ATPase revealed that ATP binding to the A
subunit is crucial for V1 formation. J Biol Chem 281(50): 38582-38591.
Imokawa Y, Yoshizato K (1997) Expression of Sonic hedgehog gene in regenerating
newt limb blastemas recapitulates that in developing limb buds. Proc Natl Acad Sci
USA 94(17): 9159±9164.
Iovine MK (2007) Conserved mechanisms regulate outgrowth in zebrafish fins. Nat
Chem Biol 3(10): 613-618.
Ishida
T, Nakajima
T, Kudo
A, Kawakami
A
(2010)
Phosphorylation of Junb family proteins by the Jun N-terminal kinase supports tissue
regeneration in zebrafish. Dev Biol 340(2): 468-479.
Ivics Z, Izsvák Z, Hackett PB (1993) Enhanced incorporation of transgenic DNA into
zebrafish chromosomes by a retroviral integration protein. Mol Mar Biol
Biotechnol 2(3): 162-173.
Iwasaki H, Murata Y, Kim Y, Hossain MI, Worby CA, Dixon JE, McCormack T, Sasaki
T, Okamura Y (2008) A voltage-sensing phosphatase, Ci-VSP, which shares sequence
identity with PTEN, dephosphorylates phosphatidylinositol 4,5-bisphosphate. Proc
Natl Acad Sci USA 105(23): 7970-7975.
Jaffe LF (1977) Electrophoresis along cell membranes. Nature 265(5595): 600–602.
Jaźwińska A, Badakov R, Keating MT (2007) Acivin-betaA signaling is required for
zebrafish fin regeneration. Curr Biol 17(16):1390-1395.
Jaźwińska A, Badakov R, Keating MT (2007) Activin-betaA signalig is required for
zebrafish fin regeneration. Curr Biol 17(16):1390-5.
Page | 221
Chapter V - References
Jefferies KC, Forgac M (2008) Subunit H of the vacuolar (H+) ATPase inhibits ATP
hydrolysis by the free V1 domain by interaction with the rotary subunit F. J Biol
Chem 283(8): 4512-4519.
Jefferies KC, Cipriano DJ, Forgac M (2008) Function, structure and regulation of
the vacuolar (H+)-ATPases. Arch Biochem Biophys 476(1): 33-42.
Jenkins LS, Duerstock BS, Borgens RB (1996) Reduction of the current of injury
leaving the amputation inhibits limb regeneration in the red spotted newt. Dev Biol
178(2): 251-262.
Johnson SL, Bennett P (1999) Growth control in the ontogenetic and regenerating
zebrafish fin. Methods Cell Biol 59: 301-311.
Johnson SL, Weston JA (1995) Temperature-sensitive mutations that cause stagespecific defects in Zebrafish fin regeneration. Genetics 141(4): 1583-195.
Jopling C, Boue S, Izpisua Belmonte JC (2011) Dedifferentiation, transdifferentiation
and reprogramming: three routes to regeneration. Nat Rev Mol Cell Biol 12(2): 79-89.
Kagami T, Chen S, Memar P, Choi M, Foster LJ, Numata M (2008) Identification and
biochemical characterization of the SLC9A7 interactome. Mol Membr Biol 25(5): 436447.
Kagami T, Chen S, Memar P, Choi M, Foster LJ, Numata M (2008) Identification and
biochemical characterization of the SLC9A7 interactome. Mol Membr Biol 25(5): 436447.
Kamachi F, Yanai M, Ban HS, Ishihara K, Hong J, Ohuchi K, Hirasawa N (2007)
Involvement of Na+/H+ exchangers in induction of cyclooxygenase-2 by vacuolar-type
(H+)-ATPase inhibitors in RAW 264 cells. FEBS Lett 581(24): 4633- 4638.
Kamachi Y, Okuda Y, Kondoh H (2008) Quantitative assessment of the knockdown
efficiency of morpholino antisense oligonucleotides in zebrafish embryos using a
luciferase assay. Genesis 46(1):1-7.
Kane PM (1995) Disassembly and reassembly of the yeast vacuolar H(+)-ATPase in
vivo. J Biol Chem 270: 17025–17032.
Kane PM (2006) The where, when, and how of organelle acidification by the yeast
vacuolar H+-ATPase. Microbiol Mol Biol Rev 70(1): 177-191.
Kane PM (2012) Targeting reversible disassembly as a mechanism of controlling VATPase activity. Curr Protein Pept Sci 13(2): 117-123.
Kawakami A (2010) Stem cell system in tissue regeneration in fish. Dev Growth Differ
52(1): 77-87.
Kawakami A, Fukazawa T, Takeda H (2004) Early fin primordia of zebrafish larvae
regenerate by a similar growth control mechanism with adult regeneration. Dev
Dyn 231(4):693-699.
Page | 222
Chapter V - References
Kawakami Y, Rodriguez Esteban C, Raya M, Kawakami H, Martí M, Dubova I, Izpisúa
Belmonte JC (2006) Wnt/beta-catenin signaling regulates vertebrate limb
regeneration. Genes Dev 20(23): 3232-3237.
Kawasaki-Nishi S, Nishi T, Forgac M (2001) Arg-735 of the 100-kDa subunit a of the
yeast V-ATPase is essential for proton translocation. Proc Natl Acad Sci USA 98 (2001)
12397–12402.
Keefe D, Pepperell J, Rinaudo P, Kunkel J, Smith P (1995) Identification of calcium flux
in single preimplantation mouse embryos with the calcium-sensitive vibrating probe.
Biol Bull 189:200.
Khalturin K, Hemmrich G, Fraune S, Augustin R, Bosch TC (2009) More than
just orphans: are taxonomically- restricted genes important in evolution? Trends
Genet 25(9): 404-413.
Kitagawa N, Mazon H, Heck AJ, Wilkens S (2008) Stoichiometry of the peripheral stalk
subunits E and G of yeast V1-ATPase determined by mass spectrometry. J Biol Chem
283(6): 3329-3337.
Kizil C, Otto GW, Geisler R, Nüsslein-Volhard C, Antos CL (2009) Simplet controls cell
proliferation and gene transcription during zebrafish caudal fin regeneration. Dev Biol
325(2): 329-340.
Klimatcheva E, Wonderlin WF (1999) An ATP-sensitive K+ current that regulates
progression through early G1 phase of the cell cycle in MCF-7 human breast cancer
cells. J Membr Biol 171(1): 35–46.
Knopf F, Hammond C, Chekuru A, Kurth T, Hans S, Weber CW, Mahatma G, Fisher
S, Brand M, Schulte-Merker S, Weidinger G (2011) Bone regenerates via
dedifferentiation of osteoblasts in the zebrafish fin. Dev Cell 20(5): 713-724.
Kong SK, Suen YK, Choy YM, Fung KP, Lee CY (1991) Membrane depolarization was
required to induce DNA synthesis in murine macrophage cell line PU5-1.8.
Immunopharmacol Immunotoxicol 13: 329-339.
Konig S, Hinard V, Arnaudeau S, Holzer N, Potter G, Bader CR, Bernheim L (2004)
Membrane hyperpolarization triggers myogenin and myocyte enhancer factor-2
expression during human myoblast differentiation. J Biol Chem 279(27): 2818728196.
Koudstaal S, Jansen Of Lorkeers SJ, Gaetani R, Gho JM, van Slochteren FJ, Sluijter
JP, Doevendans
PA, Ellison
GM, Chamuleau
SA
(2013)
Concise review:
heart regeneration and the role of cardiac stem cells. Stem Cells Transl Med 2(6): 434443.
Kragl M, Knapp D, Nacu E, Khattak S, Maden M, Epperlein HH, Tanaka EM (2009)
Cells keep a memory of their tissue origin during axolotl limb regeneration. Nature
460(7251): 60-65.
Page | 223
Chapter V - References
Kreitzer MA, Jacoby J, Naylor E, Baker A, Grable T, Tran E, Booth SE, Qian H, Malchow
RP (2012) Distinctive patterns of alterations in proton efflux from goldfish retinal
horizontal cells monitored with self-referencing H⁺-selective electrodes. Eur J
Neurosci 36(8): 3040-3050.
Kumar A, Gates PB, Brockes JP (2007) Positional identity of adult stem cells in
salamander limb regeneration. C R Biol 330(6-7): 485-490.
Kumar A, Velloso CP, Imokawa Y, Brockes JP (2000) Plasticity of retrovirus-labelled
myotubes in the newt limb regeneration blastema. Dev Biol 218(2): 125-136.
Kunkel JG, Cordeiro S, Xu YJ, Shipley AM, Feijó JÁ (2006) The use of non-invasive ionselective microelectrode techniques for the study of plant development. Plant
Electrophysiology – Theory and Methods. Berlin: Springer-Verlag.
Kunkel JG, Lin LY, Xu Y, Prado AMM, Feijó JA, Hwang PP, Hepler PK (2001). The
strategic use of Good buffers to measure proton gradients around growing pollen
tubes. In: Cell biology of plant and fungal tip growth. Amsterdam: IOS Press.
Kunzelmann K (2005) Ion channels and cancer. J Membr Biol 205(3): 159-173.
Kurreck J (2003) Antisense technologies. Improvement through novel chemical
modifications. Eur J Biochem 270(8):1628-1644.
Kurtz I, Schrank AR (1955) Bioelectrical properties of intact and regenerating
earthworms Eisenia foetida. Physiol Zool 28: 322–330.
Laforest L, Brown CW, Poleo G, Géraudie J, Tada M, Ekker M, Akimenko MA (1998)
Involvement of the sonic hedgehog, patched 1 and bmp2 genes in patterning of the
zebrafish dermal fin rays. Development 125(21): 4175-4184.
Lafourcade C, Sobo K, Kieffer-Jaquinod S, Garin J, van der Goot FG (2008)
Regulation of the V-ATPase along the endocytic pathway occurs through reversible
subunit association and membrane localization. PLoS One 3(7): e2758.
Lang F, Föller M, Lang KS, Lang PA, Ritter M, Gulbins E, Vereninov A, Huber SM (2005)
Ion channels in cell proliferation and apoptotic cell death. J Membr Biol 205(3): 147157.
Lauritzen I, Zanzouri M, Honoré E, Duprat F, Ehrengruber MU, Lazdunski M, Patel AJ
(2003) K+-dependent cerebellar granule neuron apoptosis. Role of task leak K+
channels. J. Biol. Chem 278(34): 32068–32076.
Le Bouffant R1, Wang JH, Futel M, Buisson I, Umbhauer M, Riou JF (2012)
Retinoic acid-dependent control of MAP kinase phosphatase-3 is necessary for early
kidney development in Xenopus. Biol Cell 104(9):516-532.
LeClair EE, Topczewski J (2010) Development and regeneration of the zebrafish
maxillary barbel: a novel study system for vertebrate tissue growth and repair. PLoS
One 5(1): e8737.
Page | 224
Chapter V - References
Lee
Y, Grill
S, Sanchez
A, Murphy-Ryan
M, Poss
KD
Fgf signaling instructs positiondependent growth rate during zebrafish fin regeneration. Development
5173-5183.
(2005)
132(23):
Lee Y, Hami D, De Val S, Kagermeier-Schenk B, Wills AA, Black BL, Weidinger G, Poss
KD (2009) Maintenance of blastemal proliferation by functionally diverse epidermis
in regenerating zebrafish fins. Dev Biol 331(2): 270-280.
Leslie NR, Yang X, Downes CP, Weijer CJ (2007) PtdIns(3,4,5)P(3)-dependent and independent roles for PTEN in the control of cell migration. Curr Biol 17(2): 115–125.
Levin M (2009a) Bioelectric mechanisms in regeneration: Unique aspects and future
perspectives. Semin Cell Dev Biol 20(5): 543-556.
Levin M (2012) Molecular bioelectricity in developmental biology: new toolsand
recent discoveries: control of cell behavior and pattern formation by transmembrane
potential gradients Bioessays 34(3): 205-217.
Levin M, Buznikov GA, Lauder JM (2006) Of minds and embryos: Left-right
asymmetry and the serotonergic controls of pre-neural morphogenesis. Dev Neurosci
28(3): 171–185.
Levin M, Mercola M (1998) Gap junctions are involved in the early generation of leftright asymmetry. Dev Biol 203: 90–105.
Levin M, Mercola M (1999) Gap junction-mediated transfer of left-right patterning
signals in the early chick blastoderm is upstream of Shh asymmetry in the node.
Development 126: 4703–4714.
Levin M, Thorlin T, Robinson KR, Nogi T, Mercola M (2002) Asymmetries in H+/K+ATPase and cell membrane potentials comprise a very early step in left-right
patterning. Cell 111: 77–89.
Levin M, Stevenson CG (2012) Regulation of cell behaviour and tissue patterning by
bioelectrical signals: challenges and opportunities forbiomedical engineering. Annu
Rev Biomed Eng 14: 295-323.
Levin M (2003) Bioelectromagnetics in morphogenesis. Bioelectromagnetics 24(5):
295-315.
Levin M (2007) Large-scale biophysics: ion flows and regeneration. Trends Cell Biol
17(6): 261-270.
Levin M, Mercola M (1999) Gap junction-mediated transfer of left-right patterning
signals in the early chick blastoderm is upstream of Shh asymmetry in the node.
Development 126(21):4703-4714.
Levin M, Stevenson CG (2012) Regulation of cell behavior and tissue patterning by
bioelec- trical signals: challenges and opportunities forbiomedical engineering. Annu
Rev Biomed Eng 14: 295-323.
Page | 225
Chapter V - References
Lheureux E (1983) The origin of tissues in the X-irradiated regenerating limb of the
newt Pleurodeles waltlii. Prog Clin Biol Res 110: 455–465.
Li C, Hung Wong W (2001) Model-based analysis of oligonucleotide arrays: model
validation, design issues and standard error application. Genome Biol 2:
RESEARCH0032
Li L, Yan B, Shi YQ, Zhang WQ, Wen ZL (2012) Live imaging reveals different roles of
macrophages and neutrophils during zebrafish tail fin regeneration.
J
Biol
Chem 287(30): 25353-25260.
Li SY, Huang PH, Yang AH, Tarng DC, Yang WC, Lin CC, Chen JW, Schmid-Schönbein
G, Lin SJ (2014) Matrix metalloproteinase-9 deficiency attenuates diabetic
nephropathy by modulation of podocyte functions and dedifferentiation. Kidney Int
Mar 26. doi: 10.1038/ki.2014.67. [Epub ahead of print]
Lin G, Slack JM (2008) Requirement for Wnt and FGF signaling in Xenopus tadpole tail
regeneration. Dev Biol 316(2):323-335.
Lin LY, Horng JL, Kunkel JG, Hwang PP (2006) Proton pump-rich cell secretes acid in
skin of zebrafish larvae. Am J Physiol Cell Physiol 290(2): C371-8.
Lin PJ, Williams WP, Luu Y, Molday RS, Orlowski J, Numata M (2005)
Secretory carrier membrane
proteins interact and regulate trafficking of
the
organellar (Na+,K+)/H+ exchanger NHE7. Journal of Cell Science 118: 1885-1897.
Lin PJ, Williams WP, Kobiljski J, Numata M (2007) Caveolins bind to (Na+, K+)/H+
exchanger NHE7 by a novel binding module. Cell Signal 19(5): 978-988.
Liu H, Kim Y, Chattopadhyay S, Shubayev I, Dolkas J, Shubayev VI (2010) Matrix
metalloproteinase inhibition enhances the rate of nerve regeneration in vivo by
promoting dedifferentiation and mitosis of supporting schwann cells. J Neuropathol
Exp Neurol 69(4):386-95.
Liu Q, Leng XH, Newman PR, Vasilyeva E, Kane PM, Forgac M (1997) Site-directed
mutagenesis of the yeast V-ATPase A subunit. J Biol Chem 272: 11750–11756.
Lo DC, Allen F, Brockes JP (1993) Reversal of muscle differentiation during urodele
limb regeneration. Proc Natl Acad Sci USA 90(15): 7230-7234.
Lodish H, Berk A, Matsudaira P, Kaiser CA, Krieger M, Scott MP, Zipursky L, Darnell J
(2004) Molecular Cell Biology (4th ed). New York: W.H. Freeman and Company.
Lopez-Schier H, Hudspeth AJ (2006) A two-step mechanism underlies the planar
polarization of regenerating sensory hair cells. Proc Natl Acad Sci USA 103(49):
18615–18620.
Lu M, Sautin YY, Holliday LS, Gluck SL (2004) The glycolytic enzyme aldolase
mediates assembly, expression, and activity of vacuolar H+-ATPase. J Biol Chem 279:
8732–8739.
Page | 226
Chapter V - References
Lu M, Holliday LS, Zhang L, Dunn WA Jr, Gluck SL (2001) Interaction between aldolase
and vacuolar H+-ATPase: evidence for direct coupling of glycolysis to the ATPhydrolyzing proton pump. J Biol Chem 276(32):30407-30413.
Lu M, Vergara S, Zhang L, Holliday LS, Aris J, Gluck SL (2002) The amino-terminal
domain of the E subunit of vacuolar H(+)-ATPase (V-ATPase) interacts with the H
subunit and is required for V-ATPase function. J Biol Chem 277(41): 38409-38415.
Ludwig FT, Schwab A, Stock C (2013) The Na+ /H+ -exchanger (NHE1) generates pH
nanodomains at focal adhesions. J Cell Physiol 228(6): 1351-1358.
Ma B, Xiang Y, An L (2011) Structural bases of physiological functions and roles of the
vacuolar H(+)-ATPase. Cell Signal 23(8): 1244-1256.
MacFarlane SN, Sontheimer H (2000) Changes in ion channel expression accompany
cell cycle progression of spinal cord astrocytes. GLIA 30: 39–48.
Maden M (1982) Vitamin A and pattern formation in the regenerating limb. Nature
295: 672–675
Maden M (1983) The effect of vitamin A on the regenerating axolotl limb. J Embryol
Exp Morphol 77: 273-295.
Maden M, Hind M (2003) Retinoic acid, a regeneration-inducing molecule. Dev Dyn
226: 237-244.
Maher MJ, Akimoto S, Iwata M, Nagata K, Hori Y, Yoshida M, Yokoyama S, Iwata
S, Yokoyama K (2009) Crystal structure of A3B3 complex of V-ATPase from Thermus
thermophilus. EMBO J 28(23): 3771-3779.
Makanae A, Hirata A, Honjo Y, Mitogawa K, Satoh A (2013) Nerve independent limb
induction in axolotls. Dev Biol 381(1):213-226.
Maki N, Martinson J, Nishimura O, Tarui H, Meller J, Tsonis PA, Agata K (2010)
Expression profiles during dedifferentiation in newt lens regeneration revealed by
expressed sequence tags. Mol Vis 16:72-78.
Małecki J, Wesche J, Skjerpen CS, Wiedłocha A, Olsnes S (2004) Translocation of FGF1 and FGF-2 across vesicular membranes occurs during G1-phase by a common
mechanism. Mol Biol Cell 15(2):801-814.
Małecki J, Wiedłocha A, Wesche J, Olsnes S (2002) Vesicle transmembrane potential is
required for translocation to the cytosol of externally added FGF-1. EMBO
J 21(17):4480-4490.
Mamangkey NGF, Southgate PC (2009) Regeneration of excised mantle tissue by the
silver-lip pearl oyster, Pinctada maxima (Jameson). Fish Shellfish Immunology 27(2):
164–174.
Page | 227
Chapter V - References
Marenzana M, Shipley AM, Squitiero P, Kunkel JG, Rubinacci A (2005) Bone as
an ion exchange organ: evidence for instantaneous cell-dependent calcium efflux from
bone not due to resorption. Bone 37(4): 545-554.
Mari-Beffa M, Mateos I, Palmqvist P, Becerra J (1996) Cell to cell interactions during
teleosts fin regeneration. Int J Dev Biol Suppl 1: 179S–180S.
Marshansky V, Rubinstein JL, Grüber G (2014) Eukaryotic V-ATPase: Novel structural
findings and functional insights. Biochim Biophys Acta 1837(6): 857-879.
Martin P, Leibovich SJ (2005) Inflammatory cells during wound repair: the good, the
bad and the ugly. Trends Cell Biol 15(11):599-607. Epub 2005 Oct 3.
Martorana ML, Tawk M, Lapointe T, Barre N, Imboden M, Joulie C, Géraudie J, Vriz S
(2001) Zebrafish keratin 8 is expressed at high levels in the epidermis of regenerating
caudal fin. Int J Dev Biol 45(2): 449-452.
Mateus R, Pereira T, Sousa S, de Lima JE, Pascoal S, et al. (2012) In Vivo Cell and
Tissue Dynamics Underlying Zebrafish Fin Fold Regeneration. PLoS ONE 7(12):
e51766.
Mathew LK, Sengupta S, Franzosa JA, Perry J, La Du J, Andreasen EA, Tanguay RL
(2009)
Comparative expression profiling reveals an essential role for raldh2 in epimorphic re
generation J Biol Chem 284(48): 33642-33653.
Mathew LK, Sengupta S, Kawakami A, Andreasen EA, Löhr CV, Loynes CA, Renshaw
SA, Peterson RT, Tanguay RL (2007) Unraveling tissue regeneration pathways using
chemical genetics. J Biol Chem 282(48): 35202-35210.
Matsuo R, Ito E (2011) Spontaneous regeneration of the central nervous system in
gastropods. Biol. Bull 221(1):35-42.
McCaig CD, Rajnicek AM, Song B, Zhao M (2005) Controlling cell behavior electrically:
current views and future potential. Physiol Rev 85(3): 943-978.
McEwan J, Lynch J, Beck CW (2011) Expression of key retinoic acid modulating genes
suggests active regulation during development and regeneration of the amphibian
limb. Dev Dyn 240(5): 1259-1270.
McLaughlin S, Poo MM (1981) The role of electroosmosis in the electric field-induced
movement of charged macromolecules on the surfaces of cells. Biophys J 34(1): 85–
93.
McLean
KE, Vickaryous
MK
(2011)
A novel amniote model
of epimorphic regeneration: the leopard gecko, Eublepharis macularius. BMC Dev
Biol 11:50.
McMullan D (1995) Scanning electron microscopy 1928–1965. Scanning 17: 175–
185.
Page | 228
Chapter V - References
Medina C, Royo JL (2013) Zebrafish as a model organism to study host-pathogen
interactions. Methods pii: S1046-2023(13)00116-3.
Mercader N, Tanaka EM, Torres M (2005) Proximodistal identity during vertebrate
limb regeneration is regulated by Meis homeodomain proteins. Development 132(18):
4131-4142.
Mescher AL (1996) The cellular basis of limb regeneration in urodeles. Int J Dev Biol
40(4): 785-795.
Messenger EA, Warner AE (1979) The function of the sodium pump during
differentiation of amphibian embryonic neurones. J Physiol 292: 85–105.
Messerli M, Robinson KR (1997) Tip localized Ca2þ pulses are coincident with peak
pulsatile growth rates in pollen tubes of Lilium longiflorum. J Cell Sci 110: 1269–1278.
Messerli M, Robinson KR (1998) Cytoplasmic acidification pulses and current influx
follow growth pulses of Lilium longiflorum pollen tubes. Plant J 16: 87–93.
Messerli MA, Danuser G, Robinson KR (1999) Pulsatile influxes of Hþ, Kþ and Ca2þ lag
growth pulses of Lilium longiflorum pollen tubes. J Cell Sci 112: 1497–1509.
Messerli
MA, Smith
PJ, Lewis
RC, Robinson
KR.
(2004)
Chloride fluxes in lily pollen tubes: a critical reevaluation. Plant J 40(5): 799-812.
Messerli MA, Graham DM (2011) Extracellular electrical fields direct wound healing
and regeneration. Biol Bull 221(1): 79-92.
Metcalf MEM, Borgens RB (1994b) Weak applied voltages interfere with amphibian
morphogenesis and pattern. J Exp Zool 268: 323–338.
Metcalf MEM, Shi RY, Borgens RB (1994a) Endogenous ionic currents and voltages in
amphibian embryos. J Exp Zool 268: 307–322.
Michalopoulos GK, DeFrances MC (1997) Liver regeneration. Science 276(5309): 6066
Michard E, Alves F, Feijó JA (2009) The role of ion fluxes i polarized cell growth and
morphogenesis: the pollen tube as an experimental paradigm. Int J Dev Biol 53(8-10):
1609-1622.
Midwood KS, Williams LV, Schwarzbauer JE (2004) Tissue repair and the dynamics of
the extracellular matrix. Int J Biochem Cell Biol 36(6):1031-1037.
Miki T, Iwanaga T, Nagashima K, Ihara Y, Seino S (2001) Roles of ATP-sensitive K+
channels in cell survival and differentiation in the endocrine pancreas. Diabetes 50
(Suppl. 1): S48–51.
Miller JP, Yeh N, Vidal A, Koff A (2007) Interweaving the cell cycle machinery with cell
differentiation. Cell Cycle 6(23): 2932–2938.
Page | 229
Chapter V - References
Miyazaki K, Uchiyama K, Imokawa Y, Yoshizato K (1996) Cloning and characterization
of cDNAs for matrix metalloproteinases of regenerating newt limbs. Proc Natl Acad
Sci U S A 93(13):6819-6824.
Moens CB, Donn TM, Wolf-Saxon ER, Ma TP (2008) Reverse genetics in zebrafish by
TILLING. Brief Funct Genomic Proteomic 7(6): 454-459.
Molina AJ, Verzi MP, Birnbaum AD, Yamoah EN, Hammar K, Smith PJ, Malchow RP
(2004) Neurotransmitter modulation of extracellular H+ fluxes from isolated retinal
horizontal cells of the skate. J Physiol 560(Pt 3): 639-657.
Moment GB (1949) On the relation between growth in length, the formation of new
segments, and electric potential in an earthworm. J Exp Zool 112: 1–12.
Monnot MJ, Babin PJ, Poleo G, Andre M, Laforest L, Ballagny C, Akimenko MA (1999)
Epidermal expression of apolipoprotein E gene during fin and scale development and
fin regeneration in zebrafish. Dev Dyn 214(3):207-215.
Monteiro J, Aires R, Becker JD, Jacinto A, Certal AC, Rodríguez-León J (2014) VATPase Proton Pumping Activity Is Required for Adult Zebrafish Appendage
Regeneration. PLoS One 9(3):e92594.
Montes GS, Becerra J, Toledo OM, Gordilho MA, Junqueira LC (1982) Fine structure
and histochemistry of the tail fin ray in teleosts. Histochemistry 75(3):363-376.
Morcos PA, Li Y, Jiang S (2008) Vivo-Morpholinos: A non-peptide transporter delivers
Morpholinos into a wide array of mouse tissues. Biotechniques 45(6): 613-4, 616, 618
passim.
Morgan TH (1901) Regeneration. New York: The Macmillan Company.
Morrison JI, Loof S, He P, Simon A (2006) Salamander limb regeneration involves the
activation of a multipotent skeletal muscle satellite cell population. J Cell Biol 172(3):
433–440.
Moss JB, Koustubhan P, Greenman M, Parsons MJ, Walter I, Moss LG (2009)
Regeneration of the pancreas in adult zebrafish. Diabetes 58(8): 1844-1851.
Moulton JD, Jiang S (2009) Gene Knockdowns in Adult Animals: PPMOs and VivoMorpholinos. Molecules 14(3):1304-23.
MS222 (Tricaine methane sulphonate) (2001) Alpharma Technical Bulletin 5/2001
Alpharma Animal Health Limited, Hampshire, UK.
Münch J, González-Rajal A, de la Pompa JL (2013) Notch regulates blastema
proliferation and prevents differentiation during adult zebrafish fin regeneration.
Development 140(7): 1402-1411.
Mullen LM, Bryant SV, Torok MA, Blumberg B, Gardiner DM (1996) Nerve
dependency of regeneration: the role of Distal-less and FGF signaling in amphibian
limb regeneration. Development 122(11):3487-3497.
Page | 230
Chapter V - References
Murata Y, Okamura Y (2007) Depolarization activates the phosphoinositide
phosphatase Ci-VSP, as detected in Xenopus oocytes coexpressing sensors of PIP2. J
Phys 583(Pt3): 875–889.
Murata Y, Iwasaki H, Sasaki M, Inaba K, Okamura Y (2005) Phosphoinositide
phosphatase activity coupled to an intrinsic voltage sensor. Nature 435(7046): 12391243.
Murawala
P, Tanaka
EM, Currie
JD
(2012)
Regeneration:
the ultimate example of wound healing. Semin Cell Dev Biol 23(9):954-962.
Murciano C, Fernández TD, Durán I, Maseda D, Ruiz-Sánchez J, Becerra J, Akimenko
A, Marí-Beffa M (2002) Ray-interray interactions during fin regeneration of Danio
rerio. Dev Biol 252(2): 214-224.
Murciano C, Pérez-Claros J, Smith A, Avaron F, Fernández TD, Durán I, Ruiz-Sánchez
J, García F, Becerra J, Akimenko MA, Marí-Beffa M (2007) Position dependence of
hemiray morphogenesis during tail fin regeneration in Danio rerio. Dev Biol 312(1):
272-283.
Musshoff U, Madeja M, Binding N, Witting U, Speckmann EJ (1999) Effects of 2phenoxyethanol on N-methyl-D-aspartate (NMDA) receptor-mediated ion currents.
Arch Toxicol 73(1):55-59.
Nakamura T, Mito T, Miyawaki K, Ohuchi H, Noji S (2008) EGFR signalling is required
for restablishing the proximodistal axis during distal leg regeneration in the cricket
Gryllus bimaculatus nymph. Dev Biol 319(1): 46-55.
Nakatani Y, Nishidate M, Fujita M, Kawakami A, Kudo A (2008) Migration of
mesenchymal cell fated to blastema is necessary for fish fin regeneration. Dev Growth
Differ 50(2):71-83.
Nechiporuk A, Keating MT (2002) A proliferation gradient between proximal and
msxb-expressing
distal
blastema
directs
zebrafish
fin
regeneration.
Development 129(11): 2607-2617.
Nelson N (1992) Evolution of organellar proton-ATPases. Biochim Biophys Acta 1100:
109-124.
Newman IA (2001) Ion transport in roots: measurement of fluxes using ion-selective
microelectrodes to characterize transporter function. Plant Cell Environ 24(1):1-14.
Nguyen
H, Donini
A
(2010)
Larvae of
the midge Chironomus riparius possess two distinct mechanisms for ionoregulation
in response to ion-poor conditions. Am J Physiol Regul Integr Comp Physiol 299(3):
R762-773.
Niazi IA, Saxena S (1978) Abnormal hind limb regeneration in tadpoles of the toad,
Bufo andersoni, exposed to excess vitamin A. Folia Biol. (Krakow) 26: 3-8.
Page | 231
Chapter V - References
Nishisho T, Hata K, Nakanishi M, Morita Y, Sun-Wada GH, Wada Y, Yasui N, Yoneda T
(2011) The a3 isoform vacuolar type H⁺-ATPase promotes distant metastasis in the
mouse B16 melanoma cells. Mol Cancer Res 9(7): 845-855.
Norris A, Streit A (2013) Morpholinos: Studying gene function in the chick. Methods
31. pii: S1046-2023(13)00405-2.
Novak B, Sirnoval C (1975) Inhibition of regeneration of Acetabularia mediterranea
enucleated posterior stalk segments by electrical isolation. Plant Sci Lett 5: 183–188.
Nuccitelli R (1992) Endogenous ionic currents and DC electric fields in multicellular
animal tissues. Bioelectromagnetics (1): 147.
Nuccitelli R (2003) Endogenous electric fields in embryos during development,
regeneration and wound healing. Radiat Prot Dosimetry 106(4): 375-383.
Nuckels RJ, Ng A, Darland T, Gross JM (2009) The Vacuolar-ATPase Complex
Regulates Retinoblast Proliferation and Survival, Photoreceptor Morphogenesis, and
Pigmentation in the Zebrafish Eye. Invest Ophthalmol Vis Sci 50(2): 893-905.
Numata M, Orlowski J (2001) Molecular cloning and characterization of a novel
(Na+,K+)/H+ exchanger localized to
the trans-Golgi
network.
J
Biol
Chem 276(20):17387-17394.
Odelberg SJ (2002) Inducing cellular dedifferentiation: A potential method for
enhancing endogenous regeneration in mammals. Semin Cell Dev Biol 13(5): 335–343.
Ohira M, Smardon AM, Charsky CM, Liu J, Tarsio M, Kane PM (2006) the E and G
subunits of the yeast V-ATPase interact tightly and are both present at more than one
copy per V1complex. J Biol Chem 281(32): 22752-22760.
Okada Y, Maeno E (2001) Apoptosis, cell volume regulation and volume-regulatory
chloride channels. Comp Biochem Physiol A Mol Integr Physiol 130(3): 377-383.
Okamoto M, Takemori H, Katoh Y (2004) Salt-inducible kinase in steroidogenesis and
adipogenesis. Trends Endocrinol Metab 15(1): 21-26.
Oliveira RF, Silva JF, Simões JM (2011) Fighting zebrafish: characterization of
agressive behavior and winner-loser effects. Zebrafish 8(2): 73-81.
Ozkucur N, Perike S, Sharma P, Funk RH (2011) Persistent directional cell migration
requires ion transport proteins as direction sensors and membrane potential
differences in order to maintain directedness. BMC Cell Biol 22: 12:4.
Padhi BK, Joly L, Tellis P, Smith A, Nanjappa P, Chevrette M, Ekker M, Akimenko MA
(2004)
Screen for genes differentially expressed during regeneration of
the zebrafish caudal fin. Dev Dyn 231(3):527-541.
Palencia G, Hernández-Pedro N, Saavedra-Perez D, Peña-Curiel O, Ortiz-Plata
A, Ordoñez G, Flores-Estrada D, Sotelo J, Arrieta O (2014) Retinoic acid reduces
Page | 232
Chapter V - References
solvent-induced neuropathy and promotes neural regeneration in mice. J Neurosci
Res Mar 20. doi: 10.1002/jnr.23376. [Epub ahead of print]
Park HD, Ortmeyer AB, Blankenbaker DP (1970) Cell division during regeneration in
Hydra. Nature 227(5258): 617-619.
Pennekamp P, Karcher C, Fischer A, Schweickert A, Skryabin B, Horst J, Blum M,
Dworniczak B (2002) The ion channel polycystin-2 is required for left-right axis
determination in mice. Curr Biol 12: 938–943.
Perona R, Serrano R (1988) Increased pH and tumorigenicity of fibroblasts
expressing a yeast proton pump. Nature 334: 438-440.
Petzoldt AG, Gleixner EM, Fumagalli A, Vaccari T, Simons M (2013) Elevated
expression of the V-ATPase C subunit triggers JNK-dependent cell invasion and
overgrowth in a Drosophila epithelium. Dis Model Mech 6(3): 689-700
Poleo G, Brown CW, Laforest L, Akimenko MA (2001) Cell proliferation and
movement during early fin regeneration in zebrafish. Dev Dyn 221(4): 380-390.
Poo MM, Robinson KR (1977) Electrophoresis of concanavalin A receptors in the
embryonic muscle cell membrane. Nature 265(5595): 602–605.
Poss KD (2010) Advances in understanding tissue regenerative capacity and
mechanisms in animals. Nat Rev Genet 11(10): 710-722.
Poss
KD,
Shen
J,
Keating
MT
(2000a)
Induction of lef1 during zebrafish fin regeneration. Dev Dyn 219(2): 282-286.
Poss KD, Shen J, Nechiporuk A, McMahon G, Thisse B, Thisse C, Keating MT (2000b)
Roles for Fgf signaling during zebrafish fin regeneration. Dev Biol 222(2): 347-358.
Poss KD, Wilson LG, Keating MT (2002) Heart regeneration in zebrafish. Science
298(5601): 2188–2190
Poss KD, Keating MT, Nechiporuk A (2003) Tales of regeneration in zebrafish. Dev
Dyn 226(2): 202-210.
Poss KD, Nechiporuk A, Hillam AM, Johnson SL, Keating MT (2002) Mps1 defines a
proximal blastemal proliferative compartment essential for zebrafish fin
regeneration. Development 129(22): 5141-5149.
Powell B, Graham LA, Stevens TH (2000) Molecular characterization of the yeast
vacuolar H+-ATPase proton pore. J Biol Chem 275: 23654–23660.
Qi J, Wang Y, Forgac M (2007) The vacuolar (H+)-ATPase: subunit arrangement and in
vivo regulation. J Bioenerg Biomembr 39(5-6): 423-426.
Quint E, Smith A, Avaron F, Laforest L, Miles J, Gaffield W, Akimenko MA (2002) Bone
patterning
is altered in
Page | 233
Chapter V - References
the regenerating zebrafish caudal fin after ectopic expression of sonic hedgehog and
bmp2b or exposure to cyclopamine. Proc Natl Acad Sci USA 99(13): 8713-8718.
Rahman S, Yamato I, Saijo S, Mizutani K, Ishizuka-Katsura Y, Ohsawa N, Terada
T, Shirouzu M, Yokoyama S, Iwata S, Murata T (2013) Biochemical and biophysical
properties of interactions between subunits of the peripheral stalk region of human
V-ATPase. PLoS One 8(2): e55704.
Rajnicek AM, Stump RF, Robinson KR (1988) An endogenous sodium current may
mediate wound healing in Xenopus neurulae. Dev. Biol 128(2): 290–299.
Rajnicek AM, Stump RF, Robinson KR (1988) An endogenous sodium current may
mediate wound healing in Xenopus neurulae. Dev Biol 128: 290-299.
Ramsden CM, Powner MB, Carr AJ, Smart MJ, da Cruz L, Coffey PJ (2013) Stem cells in
retinal regeneration: past, present and future. Development 140(12): 2576-2585.
Randall DJ, Burggren WW, French K (1997) Eckert Animal physiology: mechanisms and
adaptations (4th ed). New York: W.H. Freeman and Company.
Rath S, Liebl J, Fürst R, Vollmar AM, Zahler S (2013) Regulation of endothelial
signalling and migration by v-ATPase. Angiogenesis doi: 10.1007/s10456-013-9408-z
Rawls JF, Johnson SL (2000) Zebrafish kit mutation reveals primary and secondary
regulation of melanocyte development during fin stripe regeneration. Development
127(17): 3715–3724.
Rawls JF, Johnson SL (2001) Requirements for the kit receptor tyrosine kinase during
regeneration of zebrafish fin melanocytes. Development 128(11): 1943–1949.
Reddien PW, Sánchez Alvarado A (2004) Fundamentals of planarian regeneration.
Annu Rev Cell Dev Biol 20:725-757.
Reddien PW (2013) Specialized progenitors and regeneration. Development 140(5):
951-957.
Reid B, Song B, Zhao M (2009) Electric currents in Xenopus tadpole tail regeneration.
Dev Biol 335(1): 198-207.
Reid B, Graue-Hernandez EO, Mannis MJ, Zhao M (2011a) Modulating endogenous
electric currents in human corneal wounds--a novel approach of bioelectric
stimulation without electrodes. Cornea 30(3): 338-343.
Reid B, Song B, McCaig CD, Zhao M (2005) Wound healing in rat cornea: the role of
electric currents. FASEB J 19(3): 379-386.
Reid B, Vieira AC, Cao L, Mannis MJ, Schwab IR, Zhao M (2011) Specific ion fluxes
generate cornea wound electric currents. Commun Integr Biol 4(4): 462-465.
Reid
B, Zhao
M
(2011)
Ion-selective selfreferencing probes for measuring specific ion flux. Commun Integr Biol 4(5):524-527.
Page | 234
Chapter V - References
Renshaw SA, Trede NS (2012) A model 450 million years in the making: zebrafish and
vertebrate immunity. Dis Model Mech 5(1): 38-47.
Reuss L (2005) Ion Transport Across Nonexcitable Membranes. eLS.
Rinkevich Y, Paz G, Rinkevich B, Reshef R (2007) Systemic bud induction and retinoic
acid signaling underlie whole body regeneration in the urochordate Botrylloides
leachi. PLoS Biol 5(4): e71.
Rishikesan S, Thaker YR, Priya R, Gayen S, Manimekalai MS, Hunke C, Gruber G (2008)
Spectroscopical identification of residues of subunit G of the yeast V-ATPase in its
connection with subunit E. Mol Membr Biol 25(5): 400-410.
Robinson AJ, Snyder-Mackler L (2008) Clinical Electrophysiology: Electrotherapy and
Electrophysiologic Testing (3rd ed). Philadelphia: Lippincott Williams & Wilkins.
Robinson KR (1983) Endogenous electrical current leaves the limb and prelimb
region of the Xenopus embryo. Dev Biol 97: 203–211.
Robinson KR and Messerli MA (1996) Electric embryos: the embryonic epithelium as
a generator of developmental information. Nerve Growth and Nerve Guidance (pp 131141). London: Portland Press.
Rojas JD, Sennoune SR, Maiti D, Bakunts K, Reuveni M, Sanka SC, Martinez GM, Seftor
EA, Meininger CJ, Wu G, Wesson DE, Hendrix MJ, Martínez-Zaguilán R (2006)
Vacuolar-type H+-ATPases at the plasma membrane regulate pH and cell migration in
microvascular endothelial cells. Am J Physiol Heart Circ Physiol 291(3):H1147-57.
Rosen JN, Sweeney MF, Mably JD (2009) Microinjection of Zebrafish Embryos to
Analyze Gene Function. J Vis Exp (25), e1115.
Ryan PR, Newman IA, Shields B (1990) Ion fluxes in corn roots measured by
microelectrodes with ion-specific liquid membranes. J Memb Sci 53: 59-69.
Sadler KC, Krahn KN, Gaur NA, Ukomadu C (2007) Liver growth in the embryo and
during liver regeneration in zebrafish requires the cell cycle regulator, uhrf1. Proc
Natl Acad Sci USA 104(5): 1570–1575.
Sambade M, Kane PM (2004) The yeast vacuolar proton-transocating ATPase
contains a subunit homologous to the Manduca sexta and bovine e subunits that is
essential for function. J Biol Chem 279(17): 17361-17365.
Sánchez Alvarado A (2000) Regeneration in the metazoans: why does it happen?
Bioessays 22(6): 578-590.
Sánchez Alvarado A, Tsonis PA (2006) Bridging the regeneration gap: genetic insights
from diverse animal models. Nat Rev Genet 7(11): 873-884.
Sandbichler AM, Pelster B (2004) Acid–base regulation in isolated gill cells of the
goldfish (Carassius auratus). J Comp Physiol B 174: 601–610
Page | 235
Chapter V - References
Santamaria JA, Becerra, J (1991) Tail fin regeneration in teleosts: Cell-Extracellular
matrix interaction in blastema differentiation. J Anal 176: 9-21.
Santamaría JA, Marí-Beffa M, Becerra J (1992) Interactions of the lepidotrichial matrix
components during tail fin regeneration in teleosts. Differentiation 49(3): 143-150.
Santos-Ruiz L, Santamaría JA, Ruiz-Sánchez J, Becerra J (2002) Cell proliferation
during blastema formation in the regenerating teleost fin. Dev Dyn 223(2): 262-272.
Saroussi S, Nelson N (2009) The little we know on the structure and machinery of VATPase. J Exp Biol 212(Pt 11): 1604-1610.
Sasazawa Y, Futamura Y, Tashiro E, Imoto M (2009) Vacuolar H+-ATPase inhibitors
overcome Bcl-xL-mediated chemoresistance through restoration of
a caspaseindependent apoptotic pathway. Cancer Sci 100(8):1460-1467.
Saunders JW JR (1948) The proximodistal sequence of the origin of the parts of the
chick wing and the role of the ectoderm. J Exp Zool 108(3): 363-403.
Schebesta M, Lien CL, Engel FB, Keating MT (2006) Transcriptional profiling of caudal
fin regeneration in zebrafish. ScientificWorldJournal 6 Suppl 1: 38-54.
Sennoune SR, Martinez-Zaguilan R (2007) Plasmalemmal vacuolar H+-ATPAses in
angiogenesis, diabetes and cancer. J Bioenerg Biomembr 39(5-6): 427-433.
Sensch O, Vierling W, Brandt W, Reiter M (2000) Effects of inhibition of calcium and
potassium currents in guinea-pig cardiac contraction: comparison of betacaryophyllene oxide, eugenol, and nifedipine. Br J Pharmacol 131(6):1089-1096.
Shabala L,
Ross
T,
McMeekin
T, Shabala S
(2006)
Noninvasive microelectrode ion flux measurements to study adaptive responses of
microorganisms to the environment. FEMS Microbiol Rev 30(3): 472-486.
Shao E, Forgac M (2004) Involvement of the nonhomologous region of subunit A of
the yeast V-ATPase in coupling and in vivo dissociation. J Biol Chem 279: 48663–
48670.
Shao J, Qian X, Zhang C, Xu Z (2009) Fin regeneration from tail segments with
musculature, endoskeleton, and scales. J Exp Zool B Mol Dev Evol 312(7): 762-769.
Sharma KK, Niazi IA (1990) Restoration of limb regeneration ability in frog tadpoles
by electrical stimulation. Indian J Exp Biol 28: 733–738.
Shi R, Borgens R (1994) Embryonic neuroepithelial sodium transport, the resulting
physiological potential, and cranial development. Dev Biol 165: 105–116.
Shipley AM and Feijó JA (1999) The use of the vibrating probe technique to study 18
steady extracellular currents during pollen germination and tube growth. In:
Fertilization in Higher Plants: Molecular and 20 Cytological Aspects. Heidelberg, Berlin:
Springer-Verlag.
Page | 236
Chapter V - References
Shirihai O, Attali B, Dagan D, Merchav S (1998) Expression of two inward rectifier
potassium channels is essential for differentiation of primitive human hematopoietic
progenitor cells. J Cell Physiol 177(2): 197–205.
Shu L, Zien K, Gutjahr G, Oberholzer J, Pattou F, Kerr-Conte J, Maedler K (2012)
TCF7L2 promotes beta cell regeneration in human and mouse pancreas. Diabetologia
55(12): 3296-3307.
Shubin N, Tabin C, Carroll S (2009) Deep homology and the origins of evolutionary
novelty. Nature 457(7231): 818-823.
Sieb JP, Milone M, Engel AG (1996) Effects of the quinoline derivatives quinine,
quinidine, and chloroquine on neuromuscular transmission. Brain Res 712(2):179189.
Simon H, Kittappa R, Khan P, Tsilfidis C, Liversage R, Oppenheimer S (1997) A novel
family of T-box genes in urodele amphibian limb development and regeneration:
candidate genes involved in vertebrate forelimb/hindlimb patterning. Development
124:1355±1366.
Sims
K
Jr, Eble
DM, Iovine
MK
(2009)
Connexin43 regulates joint location in zebrafish fins. Dev Biol 327(2): 410-418.
Singer M, Weckesser EC, Geraudie J, Maier CE, Singer J (1987) Open finger tip healing
and replacement after distal amputation in rhesus monkey with comparison to limb
regeneration in lower vertebrates. Anat Embryol (Berl) 177(1): 29–36.
Sîrbulescu RF, Zupanc GK (2011) Spinal cord repair in regenerationcompetent vertebrates: adult teleost fish as a model system. Brain Res Rev 67(1-2):
73-93.
Sire JY, Girondot M, Babiar O (2000) Marking zebrafish, Danio rerio (cyprinidae),
using scale regeneration. J Exp Zool 286(3): 297-304.
Sisken BF, Fowler I (1981) Induction of limb regeneration in the chick-embryo. Anat
Rec 199: A238–A239.
Slack JM (2003) Regeneration research today. Dev Dyn 226(2): 162-166.
Smardon AM, Tarsio M, Kane PM (2002) The RAVE complex is essential for stable
assembly of the yeast V‑ATPase. J Biol Chem 277, 13831–13839.
Smith A, Zhang J, Guay D, Quint E, Johnson A, Akimenko MA (2008) Gene expression
analysis on sections of zebrafish regenerating fins reveals limitations in the wholemount in situ hybridization method. Dev. Dyn 237: 417-425.
Smith A, Avaron F, Guay D, Padhi BK, Akimenko MA (2006) Inhibition of BMP
signalling during zebrafish fin regeneration disrupts fin growth and
scleroblasts
differentiation and function. Dev Biol 299(2): 438-454.
Page | 237
Chapter V - References
Smith PJ, Hammar K, Porterfield DM, Sanger RH, Trimarchi JR (1999) Self-referencing,
non-invasive, ion-selective electrode for single cell detection of trans-plasma
membrane calcium flux. Microsc Res Tech 46(6): 398-417.
Smith SD (1967) Induction of partial limb regeneration in Rana pipiens by galvanic
stimulation. Anat Rec 158: 89–97.
Smith SD (1974) Effects of electrode placement on stimulation of adult frog limb
regeneration. Ann NY Acad Sci 238: 500–507.
Smith SD (1981) The role of electrode position in the electrical induction of limb
regeneration in subadult rats. Bioelectrochem Bioenerg 8: 661–670.
Somorjai IM, Somorjai RL, Garcia-Fernàndez J, Escrivà H (2012) Vertebrate-like
regeneration in the invertebrate chordate amphioxus. Proc Natl Acad Sci USA 109(2):
517-522.
Song B, Zhao M, Forrester JV, McCaig CD (2002) Electrical cues regulate the
orientation and frequency of cell division and the rate of wound healing in vivo. Proc
Natl Acad Sci USA 99: 13577–13582.
Song B, Zhao M, Forrester JV, McCaig CD (2004) Nerve regeneration and wound
healing are stimulated and directed by an endogenous electrical field in vivo. J Cell Sci
117: 4681–4690.
Sousa S, Afonso N, Bensimon-Brito A, Fonseca M, Simões M, Leon J, Roehl H, Cancela
ML, Jacinto A (2011) Differentiated skeletal cells contribute to blastema formation
during zebrafish fin regeneration. Development 138(18): 3897-3905.
Sta Iglesia DD, Cragoe EJ Jr, Vanable JW Jr (1996) Electric field strength and
epithelization in the newt (Notophthalmus iridescens). J Exp Zool 274(1): 56-62.
Sta Iglesia DD, Vanable JW Jr (1998) Endogenous lateral electric fields around bovine
corneal lesions are necessary for and can enhance normal rates of wound healing.
Wound Repair Regen 6: 531–542.
Stern CD (1982) Experimental reversal of polarity in chick embryo epiblast sheets in
vitro. Exp Cell Res 140: 468–471.
Stewart S, Rojas-Muñoz A, Izpisúa Belmonte JC (2007) Bioelectricity and epimorphic
regeneration. Bioessays 29(11): 1133-1137.
Stillwell EF, Cone CM, Cone CD (1973) Stimulation of DNA synthesis in CNS neurones
by sustained depolarisation. Nat New Biol 246:110-111.
Stocum DL (1984) The urodele limb regeneration blastema. Determination and
organization of the morphogenetic field. Differentiation 27: 13– 28.
Stocum DL (2011) The role of peripheral nerves in urodele limb regeneration. Eur J
Neurosci 34(6):908-916.
Page | 238
Chapter V - References
Stoick-Cooper CL, Moon RT, Weidinger G (2007a) Advances in signaling in vertebrate
regeneration as a prelude to regenerative medicine. Genes Dev 21(11): 1292-1315.
Stoick-Cooper CL, Weidinger G, Riehle KJ, Hubbert C, Major MB, Fausto N, Moon RT
(2007b).
Distinct Wnt signaling pathways have opposing roles in appendage regeneration.
Development 134(3): 479-489.
Stump RF, Robinson KR (1986) Ionic currents in Xenopus embryos during neurulation
and wound healing. Prog Clin Biol Res 210: 223–230.
Stump RF, Robinson KR, Harold RL, Harold FM (1980) Endogenous electrical currents
in the water mold Blastocladiella emersonii during growth and sporulation. Proc Natl
Acad Sci USA 77(11): 6673-6677.
Sumner JP, Dow JA, Earley FG, Klein U, Jäger D, Wieczorek H (1995)
Regulation of plasma
membrane VATPase activity by dissociation of peripheral subunits. J Biol Chem 270(10): 56495653.
Sun W, Buzanska L, Domanska-Janik K, Salvi RJ, Stachowiak MK (2005) Voltagesensitive and ligand-gated channels in differentiating neural stem-like cells derived
from the nonhematopoietic fraction of human umbilical cord blood. Stem Cells 23:
931–945.
Sundelacruz S, Levin M, Kaplan DL (2008) Membrane potential controls adipogenic
and osteogenic differentiation of mesenchymal stem cells. PLoS ONE 3: e3737.
Sundelacruz S, Levin M, Kaplan DL (2009) Role of membrane potential in the
regulation of cell proliferation and differentiation. Stem Cell Rev 5(3): 231-246.
Sunderland ME (2010) Regeneration: Thomas Hunt Morgan's window into
development. J Hist Biol 43(2):325-361.
Suzuki M, Satoh A, Ide H, Tamura K (2005) Nerve-dependent and -independent
events in blastema formation during Xenopus froglet limb regeneration. Dev Biol
286(1): 361-375.
Takahashi K, Okita K, Nakagawa M, Yamanaka S (2007) Induction of pluripotent stem
cells from fibroblast cultures. Nat Protoc 2(12): 3081-3089.
Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse
embryonic and adult fibroblast cultures by defined factors. Cell 126(4): 663-676.
Tal TL, Franzosa JA, Tanguay RL (2010) Molecular signaling networks that
choreograph epimorphic fin regeneration in zebrafish - a mini-review. Gerontology
56(2): 231-240.
Talebi G, Torkaman G, Firoozabadi M, Shariat S (2008) Effect of anodal and cathodal
microamperage direct current electrical stimulation on injury potential and wound
size in guinea pigs. J Rehabil Res Dev 45(1): 153-159.
Page | 239
Chapter V - References
Tanaka E, Galliot B (2009) Triggering the regeneration and tissue repair programs.
Development 136(3): 349-353.
Tanaka EM, Reddien PW (2011) The cellular basis for animal regeneration. Dev Cell
21(1): 172-185.
Tawk M, Tuil D, Torrente Y, Vriz S, Paulin D (2002) High-efficiency gene transfer into
adult fish: a new tool to study fin regeneration. Genesis 32(1): 27-31.
Thummel R, Ju M, Sarras MP Jr, Godwin AR (2007) Both Hoxc13 orthologs are
functionally important for zebrafish tail fin regeneration. Dev Genes Evol 217(6): 413420.
Thummel R, Bai S, Sarras MP Jr, Song P, McDermott J, Brewer J, Perry M, Zhang
X, Hyde DR, Godwin AR (2006) Inhibition of zebrafish fin regeneration using in vivo
electroporation of morpholinos against fgfr1 and msxb. Dev Dyn 235(2): 336-346.
Toei M, Saum R, Forgac M (2010) Regulation and isoform function of the V-ATPases.
Biochemistry 49(23): 4715-4723.
Ton C, Stamatiou D, Dzau VJ, Liew CC (2002) Construction of a zebrafish cDNA
microarray: gene expression profiling of the zebrafish during development. Biochem
Biophys Res Commun 296(5): 1134-1142.
Ton QV, Kathryn Iovine M (2012) Semaphorin3d mediates Cx43- dependente
phenotypes during fin regeneration. Dev Biol 366(2):195-203.
Tonge DA, Leclere PG (2000) Directed axonal growth towards axolotl limb blastemas
in vitro. Neuroscience 100(1):201-211.
Tseng AS, Beane WS, Lemire JM, Masi A, Levin M (2010) Induction of Vertebrate
Regeneration by a Transient Sodium Current. J Neurosci 30(39): 13192-13200.
Tseng AS, Adams DS, Qiu D, Koustubhan P, Levin M (2007) Apoptosis is required
during early stages of tail regeneration in Xenopus laevis. Dev Biol 301(1): 62-69.
Tsonis PA (2000) Regeneration in vertebrates. Dev Biol 221(2): 273-284.
Tu
S, Johnson
SL
(2011)
Fate restriction in
the growing and regenerating zebrafish fin. Dev Cell 20(5): 725-732.
Tweedell KS (2010) The urodele limb regeneration blastema: the cell potential.
ScientificWorldJournal 10: 954-971.
Vaccari T, Duchi S, Cortese K, Tacchetti C, Bilder D (2010) The vacuolar ATPase is
required for physiological as well as pathological activation of the Notch receptor.
Development 137(11): 1825-1832.
van Kempen M, van Ginneken A, de Grijs I, Mutsaers N, Opthof T, Jongsma H, van der
Heyden M (2003) Expression of the electrophysiological system during murine
embryonic stem cell cardiac differentiation. Cell Physiol Biochem 13(5): 263–270.
Page | 240
Chapter V - References
Vandenberg LN, Lemire JM, Levin M (2013) It's never too early to get it Right: A
conserved role for the cytoskeleton in left-right asymmetry. Commun Integr Biol
6(6):e27155.
Vandenberg LN, Lemire JM, Levin M (2013) Serotonin has early, cilia-independent
roles in Xenopus left-right patterning. Dis Model Mech 6(1):261-268.
Venzke D, Domgall I, Köcher T, Féthière J, Fischer S, Böttcher B (2005) Elucidation of
the stator organization in the V-ATPase of Neurospora crassa. J Mol Biol 349(3): 659669.
Vieira AC, Reid B, Cao L, Mannis MJ, Schwab IR, Zhao M (2011) Ionic components of
electric current at rat corneal wounds. PLoS One 6(2):e17411.
Vierbuchen T, Wernig M (2012) Molecular roadblocks for cellular reprogramming.
Mol Cell 47(6): 827-838.
Vitavska O, Wieczorek H, Merzendorfer H (2003) A novel role for subunit C in
mediating binding of the H+‑V‑ATPase to the actin cytoskeleton. J Biol Chem 278:
18499–18505.
Wagner DE, Wang IE, Reddien PW (2011) Clonogenic neoblasts are pluripotent adult
stem cells that underlie planarian regeneration. Science 332(6031): 811-816.
Wang E, Yin Y, Zhao M, Forrester JV, McCaig CD (2003) Physiological electric fields
control the G1/S phase cell cycle checkpoint to inhibit endothelial cell proliferation.
FASEB J 17: 458-460.
Wang E, Zhao M, Forrester JV, McCaig CD (2003a) Bi-directional migration of lens
epithelial cells in a physiological electrical field. Exp Eye Res 76(1): 29-37.
Wang GK, Quan C, Wang S (1998) A common local anesthetic receptor for benzocaine
and etidocaine in voltage-gated mu1 Na+ channels. Pflugers Arch 435(2):293-302.
Wang L, Zhou P, Craig RW, Lu L (1999) Protection from cell death by mcl-1 is
mediated by membrane hyperpolarization induced by K+ channel activation. J Membr
Biol 172(2): 113–120.
Wang
Y, Cipriano
DJ, Forgac
M
(2007)
Arrangement of subunits in
the proteolipid ring of the V-ATPase. J Biol Chem 282(47): 34058-34065.
Wang Y, Inoue T, Forgac M (2004) TM2 but not TM4 of subunit c'' interacts with TM7
of subunit a of the yeast V-ATPase as defined by disulfide-mediated cross-linking. J
Biol Chem 279(43): 44628-44638.
Wang Y, Jiang X, Liu Y, Gu X, Huan Y, Ren L, Ding F, Gu X (2009) Molecular cloning and
altered expression of Pbx4 in the spinal cord during tail regeneration of Gekko
japonicus. Brain Res Bull 80(6):414-421.
Wang Y, Wang R, Jiang S, Zhou W, Liu Y, Wang Y, Gu Q, Gu Y, Dong Y, Liu M, Gu X, Ding
F, Gu
X
(2011)
Page | 241
Chapter V - References
Gecko CD59 is implicated in proximodistal identity during tail regeneration.
One 6(3): e17878.
PLoS
Washington TA, Brown L, Smith DA, Davis G, Baum J, Bottje W (2013)
Monocarboxylate transporter expression at the onset of skeletal muscle regeneration.
Physiol Rep 1 (4): e00075.
Watanabe N, Kato M, Suzuki N, Inoue C, Fedorova S, Hashimoto H, Maruyama
S, Matsuo S, Wakamatsu Y (2009) Kidney regeneration through nephron neogenesis
in medaka. Dev Growth Differ 51(2): 135-143.
Wehner D, Cizelsky W, Vasudevaro MD, Ozhan G, Haase C, Kagermeier-Schenk
B, Röder A, Dorsky RI, Moro E, Argenton F, Kühl M, Weidinger G (2014) Wnt/βcatenin signaling defines organizing centers that orchestrate growth and
differentiation of the regenerating zebrafish caudal fin. Cell Rep 6(3):467-481.
Weintraub H, Tapscott SJ, Davis RL, Thayer MJ, Adam MA, Lassar AB, Miller AD (1989)
Activation of muscle-specific genes in pigment, nerve, fat, liver, and fibroblast cell
lines by forced expression of MyoD. Proc Natl Acad Sci USA 86: 5434–5438.
Wenemoser D, Reddien PW (2010) Planarian regeneration involves distinct stem cell
responses to wounds and tissue absence. Dev Biol 344(2): 979-991.
Westerfield M (1995) The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish
(Danio rerio) (3rd Ed). Eugene (OR): University of Oregon Press.
Whitehead GG, Makino S, Lien CL, Keating MT (2005) fgf20 is essential for initiating
zebrafish fin regeneration. Science 310(5756): 1957-1960.
Wieczorek H, Brown D, Grinstein S, Ehrenfeld J, Harvey WR (1999) Animal plasma
membrane energization by proton-motive V-ATPases. Bioessays 21(8): 637-648.
Wiedłocha A, Sørensen V (2004) Signaling, internalization, and intracellular activity
of fibroblast growth factor. Curr Top Microbiol Immunol 286:45-79.
Wiedmann RM1, von Schwarzenberg K, Palamidessi A, Schreiner L, Kubisch R, Liebl
J, Schempp C, Trauner D, Vereb G, Zahler S, Wagner E, Müller R, Scita G, Vollmar AM
(2012) The V-ATPase-inhibitor archazolid abrogates tumor metastasis via inhibition
of endocytic activation of the Rho-GTPase Rac1. Cancer Res 72(22):5976-5987.
Wilkens S, Vasilyeva E, Forgac M (1999) Structure of the vacuolar ATPase by electron
microscopy. J Biol Chem 274(45): 31804-31810.
Wilkens S, Inoue T, Forgac M (2004) Three-dimensional structure of the vacuolar
ATPase. Localization of subunit H by difference imaging andchemical cross-linking. J
Biol Chem 279(40): 41942-41949.
Wolpert L (1994) The evolutionary origin of development: cycles, patterning,
privilege and continuity. Development Supplement: 79±84.
Page | 242
Chapter V - References
Wolpert L, Smith J, Jessell T, Lawrence P, Robertson E, Meyerowitz E (2007) Principles
of development (3rd ed). Oxford: Oxford University Press.
Wulff J (2010) Regeneration of sponges in ecological context: is regeneration an
integral part of life history and morphological strategies? Integr Comp Biol 50(4):
494-505.
Xu T, Vasilyeva E, Forgac M (1999) Subunit interactions in the clathrin-coated vesicle
vacuolar (H(+))-ATPase complex. J Biol Chem 274(41): 28909-28915.
Yamanaka S, Blau HM (2010) Nuclear reprogramming to a pluripotent state by three
approaches. Nature 465(7299): 704-712.
Yan Y, Denef N, Schüpbach T (2009) The vacuolar proton pump, V-ATPase, is required
for notch signaling and endosomal trafficking in Drosophila. Dev Cell 17(3):387-402.
Yan Y, Denef N, Schüpbach T (2009) The vacuolar proton pump, V-ATPase, is required
for notch signaling and endosomal trafficking in Drosophila. Dev Cell 17(3):387-402.
Yang DQ, Feng S, Chen W, Zhao H, Paulson C, Li YP (2012) V-ATPase subunit ATP6AP1
(Ac45) regulates osteoclast differentiation, extracellular acidification, lysosomal
trafficking, and protease exocytosis in osteoclast-mediated bone resorption. J Bone
Miner Res 27(8):1695-1707.
Yatime L, Buch-Pedersen MJ, Musgaard M, Morth JP, Lund Winther AM, Pedersen
BP, Olesen
C, Andersen
JP, Vilsen
B, Schiøtt
B, Palmgren
MG, Møller
JV,Nissen P, Fedosova N (2009) P-type ATPases as drug targets: tools for medicine
and science. Biochim Biophys Acta 1787(4): 207-220.
Yin VP, Thomson JM, Thummel R, Hyde DR, Hammond SM, Poss KD (2008) Fgfdependent depletion of microRNA-133 promotes appendage regeneration
in zebrafish. Genes Dev 22(6):728-33.
Yoshinari N, Ishida T, Kudo A, Kawakami A (2009) Gene expression and functional
analysis of zebrafish larval fin fold regeneration. Dev Biol 325(1): 71-81.
Zenjari C, Boilly B, Hondermarck H, Boilly-Marer Y (1997) Nerve-blastema
interactions induce fibroblast growth factor-1 release during limb regeneration in
Pleurodeles waltl. Dev Growth Differ 39(1):15-22.
Zenjari C, Boilly-Marer Y, Desbiens X, Oudghir M, Hondermarck H, Boilly B (1996)
Experimental evidence for FGF-1 control of blastema cell proliferation during limb
regeneration of the amphibian Pleurodeles waltl. Int J Dev Biol 40(5):965-971.
Zhang F, Vannucci SJ, Philp NJ, Simpson IA (2005) Monocarboxylate Transporter
Expression in the Spontaneous Hypertensive Rat: Effect of Stroke. Journal of
Neuroscience Research 79: 139–145.
Zhang JW, Parra KJ, Liu J, Kane PM (1998) Characterization of a temperature-sensitive
yeast vacuolar ATPase mutant with defects in actin distribution andbud morphology.
J Biol Chem 273(29): 18470-18480.
Page | 243
Chapter V - References
Zhang Z, Inoue T, Forgac M, Wilkens S (2006) Localization of subunit C (Vma5p) in
the yeast vacuolar ATPase by immuno electron microscopy. FEBS Lett 580(8): 20062010.
Zhang Z, Zheng Y, Mazon H, Milgrom E, Kitagawa N, Kish-Trier E, Heck AJ, Kane
PM, Wilkens S (2008) Structure of the yeast vacuolar ATPase. J Biol Chem 283(51):
35983-35995.
Zhao M, Agius-Fernandez A, Forrester JV, McCaig CD (1996) Orientation and directed
migration of cultured corneal epithelial cells in small electric fields are serum
dependent. J Cell Sci 109: 1405–1414.
Zhao M, Dick A, Forrester JV, McCaig CD (1999) Electric field-directed cell motility
involves up-regulated expression and asymmetric redistribution of the epidermal
growth factor receptors and is enhanced by fibronectin and laminin. Mol Biol Cell
10(4): 1259–1276.
Zhao M, John FV, McCaig CD (1999) A small, physiological electric field orients cell
division. Proc Natl Acad Sci USA 96 (9): 4942.
Zhao M, Pu J, Forrester JV, McCaig CD (2002) Membrane lipids, EGF receptors, and
intracellular signals colocalize and are polarized in epithelial cells moving
directionally in a physiological electric field. FASEB J 16: 857–859.
Zhao M, Song B, Pu J, Wada T, Reid B, Tai G, Wang F, Guo A, Walczysko P, Gu Y, Sasaki
T, Suzuki A, Forrester JV, Bourne HR, Devreotes PN, McCaig CD,Penninger JM (2006)
Electrical signals control wound healing through phosphatidylinositol-3-OH kinasegamma and PTEN. Nature 442(7101): 457-460.
Zhao M (2009) Electrical fields in wound healing-An overriding signal that directs cell
migration. Semin Cell Dev Biol 20(6): 674-682.
Zhao M, Chalmers L, Cao L, Vieira AC, Mannis M, Reid B (2012) Electrical signalling in
control of ocular cell behaviors. Prog Retin Eye Res 31(1):65-88.
Zhou Q, Brown J, Kanarek A, Rajagopal J, Melton DA (2008) In vivo reprogramming of
adult pancreatic exocrine cells to beta-cells. Nature 455(7213): 627-632.
Zhou Q, Wang L, Cai X, Wang D, Hua X, Qu L, Lin J, Chen T (2011) Net sodium fluxes
change significantly at anatomically distinct root zones of rice (Oryza sativa L.)
seedlings. J Plant Physiol 168(11): 1249-1255.
Zhu J, Wu Y-N, Zhang W, Zhang X-M, Ding X, Li H-Q, Geng M, Xie Z-Q, Wu H-M (2014)
Monocarboxylate Transporter 4 Facilitates Cell Proliferation and Migration and Is
Associated with Poor Prognosis in Oral Squamous Cell Carcinoma Patients. PLoS ONE
9(1): e87904.
Zonia L, Cordeiro S, Tupý J, Feijó JA (2002) Oscillatory chloride efflux at
the pollen tube apex has a role in growth and cell volume regulation and is targeted
by inositol 3,4,5,6-tetrakisphosphate. Plant Cell 14(9): 2233-2249.
Page | 244
Chapter V - References
Zukor KA, Kent DT, Odelberg SJ (2011) Meningeal cells and glia establish a permissive
environment for axon regeneration after spinal cord injury in newts. Neural Dev
6(1):1.
Page | 245
Chapter V - References
Page | 246
Chapter VI - Appendixes
Chapter VI
Appendixes
Page | 247
Chapter VI – Appendixes
Appendix 1 – Detailed protocols
A1.1. Ion-specific Sampling Rules
Update bath
Time
(sec)
H+
A/D and
D/A
conversion
Wait 0.3,
Average
for 0.5
Na+ Wait 0.5,
K+
D/A channel
0; A/D
channel 1;
Wait 0.3, beggining of
Average path
for 0.3
Average
for 0.5
Ca2+ Wait 0.5,
Cl-
Average
for 0.5
Wait 0.3,
Average
for 0.5
Path
Path Origin
-X (x, y, z,
w)
Time
(sec)
Origin -X:
(0, 0, 0, 0) (70, 0, 0,0)
Wait 0.3,
Average
for 0.5
Origin -X:
(0, 0, 0, 0) (50, 0, 0,0)
Origin -X:
(0, 0, 0, 0) (50, 0, 0,0)
Origin -X:
(0, 0, 0, 0) (60, 0, 0,0)
Origin -X:
(0, 0, 0, 0) (70, 0, 0,0)
Wait 0.3,
Average
for 0.7
Wait 0.3,
Average
for 0.7
Wait 0.3,
Average
for 1
A/D and
D/A
conversion
A/D
channel 0,
gain 1000x;
Add D/A
channel 0,
gain 10x
Notes
Coordinate
system:
absolute.
Move type:
tracking.
Repetition: 1
Rotation: 0
Tilt: 0
Wait 0.3,
Average
for 0.5
A1.2. Quantitative real-time PCR (qRT-PCR)
1. Each qRT-PCR reaction was prepared:
Reagents
cDNA 10ng/µL
Fw Primer 10pmol/µL
Rv Primer 10pmol/µL
PerfeCta® SYBR® Green FastMix®,
RoxTM (Quanta BioSciencesTM
#95073-012)
Water
Total volume
Volume per reaction (µL)
1
0.4
0.4
5
3.2
10
2. Reactions were plated into the 386-well plate and qRT-PCR was run in the Applied
Biosystems 7900HT Fast Real-Time PCR System. Forty amplification cycles were performed,
under the following cycling conditions:
Page | 248
Chapter VI - Appendixes
Stage 1 Stage 2
T (°C)
50
Time
(minutes:seconds)
02:00
95
06:00
Stage 3
Stage 4
step 1 step 2 step 3
step 1 step 2 step 3
95
65
72
95
00:15 00:30 00:30
60
95
00:15 00:15 00:15
A1.3. Polymerase Chain Reaction (PCR) for target gene amplification
1. PCR reaction was prepared:
Reagents
cDNA 100ng/µL
Volume per reaction (µL)
1
Fw Primer 10pmol/µL
Rv Primer 10pmol/µL
4
4
dNTPs 25mM (Fermentas #R1121)
2
MgCl2 25mM (Fermentas #R0971)
5
10x Taq DNA polimerase buffer
(with (NH4)2 SO4, without MgCl2)
(Fermentas #EP0402)
Taq DNA polymerase (5U/µlL)
(Fermentas #EP0402)
Water
Total volume
5
1
28
50
2. The previous reaction was subjected to a PCR on a thermocycler, using the following cycle
conditions:
Step
1
2
Temperature
(°C)
96
Time
(min)
4
72
1,5
94
3
primers specific*
6
4
4
5
72
1
1,5
30
-
Nº of
cycles
30x
-
* the temperature used for each gene-specific primers pair is described in Table II.5.
3. The specificity of the PCR product was analyzed by the size of the fragment (Table II.5)
after electrophoresis in 0.8% agarose/ 1x TAE gel.
Page | 249
Chapter VI – Appendixes
A1.4. Plasmid dephosphorylation and digestion
1. Prepare the following reaction in a 1.5 mL tube:
Reagents
Amount
Vector (pBluescript® II KS+)
2 μg
CIP (Promega #P4978)
Restriction enzyme (RE) (EcoRI and XhoI)
(New England Biolabs (NEB) #R0101 and
#R0146)
RE buffer 10x (supplied with the RE)
1 μL
1 μL
each
2.5 μL
Water
Total volume
q.s
10 μL
2. Incubate for 3 hours at 37°C.
3. Run 1μL of the reaction product in a 0.8% agarose/ TAE 1x gel electrophoresis and confirm
the plasmid linearization by analysis of the band size.
4. Store at -20°C or continue with the ligation protocol.
A1.5. Ligation of PCR product into pBluescript® II KS+
1. Calculate the amount of insert (PCR product) to use in the reaction, according to the
formula:
(80ng of pBluescript® II KS+) x (size (kb) of the insert) x proportion of insert: vector
3kb pBluescript® II KS+
2. For a insert:vector proportion of 3:1, prepare the following ligation reaction:
Reagents
Insert DNA
Vector (pBluescript® II KS+
T4 ligase (Roche
#10481220001)
Ligation buffer 10X (Roche
#10481220001)
Water
Total volume
Volume
3X
1X
1μL
2μL
q.s
20 μL
3. Incubate overnight (O/N) at 16°C, and perform bacterial transformation.
Page | 250
Chapter VI - Appendixes
A1.6. Bacterial transformation
1. Gently add an appropriate volume of DNA (corresponding to 10-15 ng of recombinant
DNA) to 50 μL of E. Coli DH5α competent cells in a sterile 1.5 mL tube, on ice.
2. Incubate for 30 minutes on ice.
3. For a heat-shock, incubate the cells at 42°C for 45-60 seconds, and then incubate for 2
minutes on ice.
4. Add 700 μL of liquid LB Medium and incubate for 45- 60 minutes at 37°C, rocking
(300rpm).
5. Plate in LB medium/ 5% ampicilin/1% agar plates and incubate at 37°C O/N.
6. Store at 4°C.
A1.7. Restriction analysis
1. Add the following reagents in a 1.5 mL tube:
Reagents
DNA
Volume
1 μg
Restriction enzyme (RE)*
0.5 μL
Total volume
20 μL
RE specific- buffer 10X
Water
2 μL
q.s.
* RE depend on the cloned gene and the plasmid vector used, and are described in Table II.6.
All REs and the corresponding buffers were adquired from New England Biolabs (NEB).
2. Incubate 3 hours at 37°C.
3. Run 1μL of the reaction product in a 0.8% agarose/TAE 1x gel electrophoresis.
4. Analyse the size of the bands.
A1.8. DNA Sequencing
1. Prepare the following reaction in a 1.5 mL tube and spin briefly:
Reagents
DNA
Sequencing buffer 5X (Applied Biosystems #4337449)
Reaction Mix (Applied Biosystems #4337449)
Primer (T3, T7 ou SP6) (Fermentas #SO119, #SO118, #SO116)
Water
Total volume
Amount
300-500ng
2μL
2μL
3,2 pmol
q.s
10μl
Page | 251
Chapter VI – Appendixes
2. Run the previous mix in a thermocycler, with the following conditions:
Nº of
cycles
Step Temperature (°C) Time
1
96
4
60
2
3
96
10 sec
4
2h
50
5
1 min
5 sec
25x
4 min
3. Transfer the previous reaction into a new 1.5 mL tube containing 10 μL of water, 2 μL 3M
Sodium Acetate pH 4.6 and 50 μL 100% Ethanol.
4. Incubate for 30 minutes at room temperature (RT).
5. Centrifuge for 30 minutes at 4°C and a speed of 14000 rpm.
6. Remove the supernatant and add 250μL 70% Ethanol.
7. Centrifuge for 15 minutes at 4°C and a speed of 14000 rpm.
8. Remove the supernatant, air dry the pellet at RT and sequence in the 3130xl Genetic
Analyzer®.
A1.9. DNA digestion and precipitation
1. Prepare the following reaction in a 1.5 mL tube:
Reagentes
Amount
DNA
10 μg
RE *
10 μL
Total volume
100 μL
RE specific- buffer 10X
Water
10 μL
q.s.
* RE depend on the cloned gene and the plasmid vector used, and are described in Table II.6.
All REs and the corresponding buffers were adquired from New England Biolabs (NEB).
2. Incubate for 3 hours at 37°C.
3. Run 1μL of the reaction product in a 0.8% agarose/TAE 1x gel electrophoresis and analyse
the size of the bands (note that there should be only one band).
4. For the remaining reaction product, add equal volume of Phenol:Chloroform:Isoamilic
Alcohol (25:24:1) (100 µL) and vortex.
5. Centrifuge for 10 minutes at RT and at 14000 rpm.
Page | 252
Chapter VI - Appendixes
6. Carefully transfer the upper phase to a new tube, and add 1/10 of the volume (10 µL) of 3M
Sodium Acetate pH 4.6 and 2.5 volumes (250 µL) of 100% Ethanol.
7. Incubate for 30 minutes at -80°C or O/N at -20°C.
8. Centrifuge for 30 minutes at 4°C and a speed of 1400 rpm.
9. Remove the supernatant and add 500 μL of 70% Ethanol.
10. Centrifuge for 15 minutes at 4°C and a speed of 14000 rpm.
11. Remove the supernatant and air dry the pellet at RT.
12. Resuspend in 20 µL water and store at -20°C or proceed to transcription.
A1.10. In vitro transcription and precipitation (for RNA probe synthesis)
1. Prepare the reaction in a tube:
Reagents
Linearized DNA
Transcription buffer 5X (Promega #P118B)
Digoxigenin labelled ribonucleotides mix 10X
(Roche #11277073910)
RNAse inhibitor (RNAsin) (Promega
#N2111)
RNA-polymerase T3, T7 or SP6 (Promega
#P208C, #P207B, #P108B)
Water
Total volume
2. Incubate for 4 hours at 37°C.
Amount
1 μg
4 μL
2 μL
0.5 μL
1 μL
q.s
20 μL
3. Run 1μL of the reaction product in a 0.8% agarose/ 1x TAE gel electrophoresis and analyze
the size of the bands (there should be one band for the vector and one band for the
transcribed RNA, which of a size described in Table II.5).
4. Add 2 μL of 4M Lithium Chloride and 50 μL of 100% Ethanol.
5. Incubate for 30 minutes at -80°C or O/N at -20°C.
6. Centrifuge for 30 minutes at 4°C and a speed of 1400 rpm.
7. Remove the supernatant and add 500 μL of 70% Ethanol.
8. Centrifuge for 15 minutes at 4°C and a speed of 14000 rpm.
9. Remove the supernatant and air dry the pellet at RT.
10. Resuspend in 20 µL water and store at -20°C until use.
Page | 253
Chapter VI – Appendixes
A1.11. Whole mount in situ hybridization on adult zebrafish caudal fin
First day (hybridization)
1. Rehydrate the fin samples in decreasing concentrations of methanol (MetOH): 100%
MetOH, 75%, 50%, 25% MetOH (all diluted in PBT), 5 minutes each, rocking.
2. Wash in PBT, for 2x 5 minutes rocking at RT.
3. Wash in Hydrogen Peroxide (6% in PBT) for 1hr at RT (protect from light).
4. Wash 3x 5 minutes in PBT at RT.
5. Digest with Proteinase K (10μg/mL in PBT) (Roche #03115836001), for 30 minutes at RT.
6. Wash with Glycine (2 mg/mL in PBT), prepared fresh.
7. Pos-fixate in 0.2% Glutaraldehyde/4% PFA for 20 minutes at RT.
8. Wash 2x 5 minutes in PBT at RT.
9. Pre-hybridize in Hybridization mix for at least 3 hours at 70°C.
10. Hybridize with digoxigenin-labelled RNA probe dissolved in Hybridization mix (20μL of
transcription (Appendix 1: A1.10) in 2 mL of Hybridization mix), ON, at 70°C.
Second day (washes and antibody)
1. Wash 2x 60 min in 50% formamide/5x SSC pH 4.5/0.2% Tween-20/PBS (pre-heated at
hybridization temperature).
2. Wash 2x 30 minutes in 50% formamide/2x SSC pH 4.5/PBS (pre-heated at hybridization
temperature).
3. Wash 2x 5 minutes in MABT.
4. Block with the following blocking solution: 10% Heat Inactivated Sheep Serum (Chemicon
#S22-100mL/2% blocking reagent (Roche #1096176001)/MABT for at least 3 hours at RT.
5. Incubate ON, rocking, at 4°C with anti-digoxigenin-AP, Fab Fragments (Roche
#11093274910) diluted to 1:2000 in blocking solution (step 4).
Third day (washes and staining)
1. Wash 2x 5 min in 2mM levamisole/MABT and then every other hour at RT.
2. Wash 2x 10 min with NTMT solution, freshly prepared.
3. Add BM Purple AP Substrate (Roche #11442074001), and monitor under a dissecting
scope.
4. Stop reaction with PBT (2 x 10 min) and fixate ON with 4% PFA/PBS at 4°C.
5. Wash in PBT.
6. Store in a solution of 1% Sodium Azide/PBT at 4°C.
Page | 254
Chapter VI - Appendixes
A1.12. Whole mount in situ hybridization on zebrafish embryos and larvae
First day (hybridization)
1. Rehydrate the fin samples in decreasing concentrations of methanol (MetOH): 100%
MetOH, 75%, 50%, 25% MetOH/ PBT, 5 minutes each, rocking.
2. Wash in PBT, for 2x 5 minutes rocking at RT.
3. Dechorion using sharp forceps (if necessary, depending on embryo stage).
4. Refix in 4% PFA/PBS, for 20 minutes, on ice.
5. Wash in PBT, for 2x 5 minutes rocking at RT.
6. Incubate with Proteinase K (10μg/mL in PBT). Incubation time varied with the
developmental stage, as follow:
Hours posIncubation
fertlization (hpf) time (minutes)
24
2
44
4
29
33
48
56
72
2
3
4
6
8
7. Wash in PBT, for 2x 5 minutes rocking at RT.
8. Refix in 4% PFA/PBS, for 20 minutes on ice.
9. Wash in PBT, for 2x 5 minutes rocking at RT.
10. Rinse with sterile water.
11. Incubate in 0.1M Acetic Anhidride/ 26mM Triethanolamine mix, for 10 minutes without
rocking. Prepare mix just before use.
12. Rinse with sterile water.
13. Wash in PBT, for 2x 5 minutes rocking at RT.
14. Pre-hybridize embryos in Hybridization mix for at least 1 hour at 70°C.
15. Remove the Hybridization mix and hybridize with digoxigenin-labelled RNA probe (20μL
of transcription in 2 mL of Hybridization mix), ON, at 70°C.
Second day (washes and antibody)
1. Wash briefly with 5x SSC pH 6.0/ 0.1% Tween-20/ 50% Formamide at 70°C.
2. Wash for 30 minutes with 5x SSC pH 6.0/ 0.1% Tween-20/ 50% Formamide at 70°C.
Page | 255
Chapter VI – Appendixes
3. Wash for 30 minutes with 2x SSC pH 6.0/ 0.1% Tween-20/ 50% Formamide at 70°C.
4. Wash for 30 minutes with 2xSSC pH 6.0/ 0.1% Tween-20/ 25% Formamide at 70°C.
5. Wash for 2x 30 minutes with 2x SSC 0.1% pH 6.0/ Tween-20 at 70°C.
6. Wash in PBT, for 2x 5 minutes rocking at RT.
7. Incubate with blocking solution (5% Heat Inactivated Sheep Serum/PBT) for at least 1
hour.
8. Incubate ON with anti-digoxigenin-AP antibody 1:8000 in blocking solution (see step 7),
gently rocking at 4°C.
Third day (washes and staining)
1. Remove the anti-digoxigenin-AP antibody solution.
2. Wash in PBT, very briefly,
3. Wash in PBT 6x 15 minutes.
4. Wash with NTMT solution 2x 10 minutes.
5. Incubate embryos in BM Purple AP Substrate at RT in the dark and monitor.
6. Stop reaction with PBT.
7. Fix ON in 4% PFA/PBS.
8. Wash in PBT, for 2x 5 minutes rocking at RT.
9. Store embryos in a solution of 1% Sodium Azide in PBT, at 4°C.
A1.13. Immunohistochemistry for adult zebrafish caudal fin
First day
1. (If Phalloindin is used, jump to 2.) Rehydrate the tissues in decreasing concentrations of
MetOH/ TPBS (TPBS= PBS 1x + 0.3% Triton-X): 100% MetOH, 75%, 50%, 25% MetOH, 5
minutes each, rocking.
2. Wash in TPBS, rocking at RT for 5 minutes x2.
3. (If Phalloidin is used, jump to 5.) Permeabilize in 100% Acetone (cooled to -20°C) for 30
minutes at -20°C.
4. Incubate in TPBS, rocking at RT for 10 minutes x3.
5. (If Phalloidin is NOT used, jump to 6.) Permeabilize in 0.5% Triton-X/PBS for 2-3 hours.
6. Block in blocking solution (TPBS + 1% BSA + 10% animal serum heat inactivated + 1%
DMSO) for at least 2 hours, rocking.
7. Incubate with primary antibody diluted in blocking solution (step 6), O/N at 4°C, rocking.
Page | 256
Chapter VI - Appendixes
Second day
1. Wash in TPBS at least 3x 5 minutes and then 5x 10 minutes.
2. Rinse with blocking solution.
3. Incubate overnight at 4°C with the secondary antibody, protected from the light.
Third day
1. Wash in TPBS at least 3x 5 minutes and then 5x 10 minutes.
2. Rinse with PBS.
3. Incubate with DAPI/PBS 1:10000 for 10 minutes, or TO-PRO III®/PBS 1:1000 for 15
minutes, at RT.
4. Wash 3x 5 minutes in PBS.
5. Pos-fixate in 4% PFA for 30 minutes at RT.
6. Wash 3x 5 minutes in PBS.
7. Mount on a fluorescent mounting medium and store at 4°C until observation under a
confocal microscope (in the same day is preferable).
A1.14. Immunohistochemistry for zebrafish embryos and larvae
First day
1. Wash embryos and larvae in 1x PBS and if necessary (depending on the developmental
stage), dechorinate, using sharp forceps.
2. Wash in 0.05% Triton-X/PBS, 2x 5 minutes.
3. Rinse with distilled water.
4. Permeabilize in 100% Acetone (previously cooled to -20°C), 7 minutes at -20°C.
5. Block in blocking solution PBDX (10 µg/mL BSA/ 1% DMSO/ 0.05% Triton-X/PBS) with
1.5% heat inactivated goat serum.
6. Wash 3x 15 minutes in PBDX/ 1.5% heat inactivated goat serum.
7. Dilute the primary antibody in PBDX/1.5% heat inactivated goat serum and incubate O/N
at 4°C, rocking slowly.
Second day
1. Wash 4x 30 minutes in PBDX.
2. Dilute the secondary antibody in PBDX/1.5% heat inactivated goat serum and incubate
O/N at 4°C, rocking slowly.
Page | 257
Chapter VI – Appendixes
Third day
1. Wash 2x 10 minutes in PBDX.
2. Wash for 30 minutes in PBS.
3. Incubate with DAPI/PBS 1:10000 for 10 minutes, RT
4. Wash 3x 5 minutes in PBS.
5. Pos-fixate in 4% PFA for 5 minutes, RT.
6. Wash 3x 5 minutes in PBS.
7. Mount on fluorescent mounting medium and store at 4°C until observation under a
confocal microscope (in the same day is preferable).
A1.15. Secondary Antibodies and other fluorescent molecular dyes
Secondary Antibody
Species
reactivity
Dye
Alexa Fluor® 488 Goat
Anti-Rabbit IgG (H+L)
Rabbit
Alexa
488
Alexa Fluor® 488 Donkey
Anti-Goat IgG (H+L)
Molecular
Dye
Rhodamine phalloidin
DAPI
TO-PRO III
Goat
Alexa
488
Produced
Company
Dilution
in
- ref
Goat
Donkey
1:500
1:500
Target
Dilution
Company - ref
F-actin
1:100
Invitrogen R415
Nucleic acids
1:1000
Nucleic acids 1:10000
Invitrogen
A11034
Invitrogen
A11055
Invitrogen
D1306
Invitrogen
T3605
A1.16. Microinjection into one-cell stage zebrafish embryos
The following protocol is described in “The Zebrafish Book”, Westerfield 1995:
1. Prepare furrowed agarose chambers:
a) Pour approximately 20 ml of hot 1.5% agarose in embryo medium into a Petri dish on a
level surface. Wait until completely solidified.
b) Add an additional 20 ml of the 1.5% agarose to the dish. Set the plastic mold (teeth
down) into the liquid agarose overlay, tapping to eliminate any bubbles.
Page | 258
Chapter VI - Appendixes
c) After the agarose sets, add a small amount of embryo medium, wrap the Petri dish in
parafilm, and store at 4°C. Warm it to RT 15 minutes before microinjection.
2. Prepare and calibrate the injection needle:
a) Pull needles out of glass capillaries (World Precision Instruments (WPI) #1B100-6) in a
P-97 Flaming/Brown pipette puller (Sutter Instrument, Co.).
b) Pipette 1-2 µL of injection fluid into back of the needle and place it into the
micromanipulator holder.
c) Under a stereoscope, carefully break off tip of the needle, using forceps.
d) Position the tip of needle inside oil drop and press pedal to release one drop of injection
fluid.
e) Assess drop size using a calibrated micro-scale and adjust drop size by changing
injection pressure and time, until the volume of the drop sphere is 1.4 nL per injection unit
(each time we press the injection pedal).
3. Remove the plastic mold from the agarose plate (step 1) and transfer embryos into the
agarose furrows. Use forceps to position the embryos in a single line and all in the same
orientation.
4. Remove nearly all the embryo medium before injection.
3. Using the micromanipulator, carefully force the needle through the chorion and the yolk
until it enters the embryonic cell. Press the injection pedal one time to release one injection
fluid unit.
4. Remove the needle carefully out of the chorion.
7. Transfer the embryos to a new petri dish with fresh embryo medium and maintain at
28.5°C for further development
A1.17. Microinjection into adult zebrafish caudal fin
1. Prepare an agarose bed:
a) Prepare 30ml of 1% agarose in aquarium water solution. Let it solidify in a petri dish.
b) Use a scalpel to shape a hole in the agarose, wide enough to accommodate the fish body
(except caudal fin).
c) Store the agarose bed- petri dish at 4°C. Warm it to RT 15 minutes before microinjection.
2. Prepare and calibrate the injection needle:
a) Pull needles out of glass capillaries (World Precision Instruments (WPI) #1B100-6) in a
P-97 Flaming/Brown pipette puller (Sutter Instrument, Co.).
Page | 259
Chapter VI – Appendixes
b) Pipette 1-2 µL of injection fluid into back of the needle and place it into the
micromanipulator holder.
c) Under a stereoscope, carefully break off tip of the needle, using forceps.
d) Position the tip of needle inside oil drop and press pedal to release one drop of injection
fluid.
d) Assess drop size using a calibrated micro-scale and adjust drop size by changing injection
pressure and time, until the volume of the drop sphere is 70 nL per injection unit (each time
we press the injection pedal).
3. Anaesthetize and amputate the fish (chapter II: sections 1.2.1 and 1.2.2).
4. Position the fish in the agarose bed (step 1), placing the caudal fin up on a plasticin slant.
Make sure the anaesthetic solution covers the fish opercula but not the fin area to inject.
5. Using the micromanipulator, direct the tip of the needle into the target tissue to inject -
interior of the amputated bony fin ray or the blastema (the tissue distal to the ray),
depending on the regeneration stage upon injection.
6. Press pedal to release one injection unit and withdraw the needle.
7. Return fish to their tanks and observe until full recovery from the anaesthesia.
A1.18. Electroporation of adult zebrafish caudal fin
1. Make an agarose bed, similar to step 1 of Appendix 1: A1.17. Before storing it, use a scalpel
to take off half the agarose, obtaining an agarose-free zone.
2. Anesthetize and amputate the fish (chapter II: sections 1.2.1 and 1.2.2).
3. Position the fish in the agarose bed, placing the caudal fin in the agarose-free zone of the
petri dish.
4. Pour water with anaesthetic, sufficient to cover the fish and make the fin afloat.
5. Connect a 10mm platinum electrode to the electroporator.
6. Submerge the electrode in the agarose-free zone of the petri dish and carefully place the
caudal fin between the two electrode plates, avoiding direct contact between electrode and
tissue.
7. Press the pedal and deliver the pulse (10x 50milisecond pulses, 25V each, 1 second of
pause between pulses).
8. Return fish to their tanks and observe until full recovery from the anaesthesia.
Page | 260
Chapter VI - Appendixes
A1.19. Solutions
Embryo medium
NaCl
7.5mM
KCl
0.25mM
MgSO4
0.5mM
KH2PO4
0.075mM
NaHCO3
methylene blue
0.35mM
0.0002% (v/v)
Na2HPO4
CaCl2
0.025mM
0.5mM
Hybridization Mix
Formamidae
SSC. pH 6.0
Tween-20
yeast tRNA
Heparin
Luria Broth (LB)
Bacto-tryptone
Bacto-yeast extract
NaCl
MABT
Maleic acid
NaCl
Tween-20
NTMT
Tris-HCl. pH 9.5
MgCl2
NaCl
Tween-20
60%
5x
0.1%
500 μg/mL
50 μg/mL
in Rnases-free water
1% (w/v)
0.5% (w/v)
1% (w/v)
100mM
150mM
0.1% (v/v)
Adjust to pH 7.5 using NaOH 1N
100mM
50mM
100mM
0.1%
Page | 261
Chapter VI – Appendixes
PBDX
BSA
DMSO
Na2HPO4
Triton-X
PBS
NaCl
KCl
Na2HPO4
KH2PO4
PBT
Tween-20
PFA
PFA
TAE 1X
EDTA
Tris-acetate. pH 8.0
TPBS
Triton-X
Page | 262
10 µg/mL
1%
10 mM
0.05%
in 1x PBS
137 mM
2.7 mM
10 mM
2 mM
Ajust to pH 7.4 using
HCl
0.1% (v/v)
in 1x PBS
4%
in PBS
2mM
40mM
0.3%
in 1x PBS
Chapter VI - Appendixes
Appendix 2 – Plasmid vectors maps
A2.1. Map of pGEM®-T Easy vector
A2.2. Map of pBluescript® II KS+
Page | 263
Chapter VI – Appendixes
Appendix 3 – Microarray
Fold change relative to uncut fins
gene
Accession
3 hpa
24 hpa
48 hpa
96 hpa
adh8a: alcohol dehydrogenase 8a
AF295407.1
-
-3,55
-2,63
-
adh8b: alcohol dehydrogenase 8b
CD014898
-2,87
-
1,54
1,42
aebp2: AE binding protein 2
AW777932
-
-1,35
-1,4
-
aebp2: AE binding protein 2
AW777351
1,54
-
-
-
alp: alkaline phosphatase
BC052139.1
-
-1,45
-
-
amt: aminomethyltransferase
BG727082
-2,84
-
1,39
-
atf7b: activating transcription factor 7b
BI326602
-2,25
-1,52
-
-1,42
atf7b: Activating transcription factor 7b
BI670897
-1,6
-
-1,69
-
atp1a1a.3: ATPase, Na+/K+ transporting,
alpha 1a.3 polypeptide
NM_131688
.1
-
-1,71
-1,87
-1,86
atp1a1a.5: ATPase, Na+/K+ transporting,
alpha 1a.5 polypeptide
NM_178099
.2
1,47
-
-
-
atp1a1b: ATPase, Na+/K+ transporting, alpha
1b polypeptide
NM_131690
.1
-3,78
-1,95
-
-
atp1a3a: ATPase, Na+/K+ transporting, alpha
3a polypeptide
NM_131684
.1
-
-
-
-1,58
atp1a3b: ATPase, Na+/K+ transporting, alpha
3b polypeptide
NM_131685
.1
-
-
-1,42
atp1b1a: ATPase, Na+/K+ transporting, beta
1a polypeptide
BC045376.1
-
-1,48
-
-
atp1b1a: ATPase, Na+/K+ transporting, beta
1a polypeptide
AW421059
-
-1,75
-1,51
atp1b1b: ATPase, Na+/K+ transporting, beta
1b polypeptide
NM_131671
.1
1,38
-1,63
-1,62
atp1b2a: ATPase, Na+/K+ transporting, beta
2a polypeptide
AW826322
1,84
1,41
1,65
1,49
atp1b2a: ATPase, Na+/K+ transporting, beta
2a polypeptide
CB360954
-
-
1,63
-
atp1b3a: ATPase, Na+/K+ transporting, beta
3a polypeptide
BE200552
-5,96
-1,97
-
-
atp1b3a: ATPase, Na+/K+ transporting, beta
3a polypeptide
AF469651.1
-2,96
-
-
-
atp1b3b: ATPase, Na+/K+ transporting, beta
3b polypeptide
NM_131670
.1
-1,95
-1,83
-1,57
-1,51
atp2a2a: ATPase, Ca++ transporting, cardiac
muscle, slow twitch 2a
BC045327.1
-
-
-1,6
-
atp5a1 /// gcdh: glutaryl-Coenzyme A
dehydrogenase /// ATP synthase, H+
transporting, mitochondrial F1 complex, alpha
subunit 1, cardiac muscle
BI896429
-1,42
-
1,44
1,37
atp5c1: ATP synthase, H+ transporting,
mitochondrial F1 complex, gamma
polypeptide 1
BI897469
-1,57
1,42
1,51
1,46
atp5d: ATP synthase, H+ transporting,
mitochondrial F1 complex, delta subunit
CD014966
-
1,7
1,66
-
atp5f1: ATP synthase, H+ transporting,
mitochondrial F0 complex, subunit b, isoform
1
CD015508
-
1,43
1,66
1,57
Page | 264
-
-
Chapter VI - Appendixes
Fold change relative to uncut fins
(continued)
gene
Accession
3 hpa
24 hpa
48 hpa
96 hpa
atp5g: ATP synthase, H+ transporting,
mitochondrial F0 complex, subunit c (subunit
9)
BC045894.1
-
-
1,47
1,41
atp5h: ATP synthase, H+ transporting,
mitochondrial F0 complex, subunit d
BG305667
-
1,49
1,57
1,58
atp5l: ATP synthase, H+ transporting,
mitochondrial F0 complex, subunit g
BQ260489
-
1,63
1,62
1,55
atp6v1ba: ATPase, H+ transporting,
lysosomal, V1 subunit B, member a
AF472614.1
-
1,7
1,48
1,52
atp6v1c1: ATPase, H+ transporting,
lysosomal, V1 subunit C, isoform 1
BC053214.1
-1,43
1,36
1,20
-
atp6v1c1l: ATPase, H+ transporting,
lysosomal, V1 subunit C, isoform 1, like
BM071894
-1,66
-
-
-
atp6v1d: ATPase, H+ transporting, V1
subunit D
BC045370.1
-
1,36
-
-
atp6v1e1: ATPase, H+ transporting,
lysosomal, V1 subunit E isoform 1
NM_173254.1
-
1,91
1,64
1,56
bhmt: betaine-homocysteine
methyltransferase
BI705782
-2,21
-6,61
-4,14
-
bhmt: betaine-homocysteine
methyltransferase
BM342901
-2,65
-12,1
-5,48
-2,07
BC053151.1
-4,02
-2,18
-1,58
-1,6
AW077423
1,93
1,56
-
-
BC044418.1
-
-
-1,48
-1,47
AW232809
-
-
-
-1,37
bmi1b: B lymphoma Mo-MLV insertion
region 1b
brap: BRCA1 associated protein
brpf1: bromodomain and PHD finger
containing, 1
bty: Bloodthirsty
calm1b: calmodulin 1b
BI670912
1,6
-1,34
-1,59
-1,61
calm2a: calmodulin 2a (phosphorylase
kinase, delta)
AW280096
-1,7
1,61
1,83
2,53
calm3a: calmodulin 3a (phosphorylase
kinase, delta)
BC045298.1
-2,34
1,56
1,8
-
calm3a: calmodulin 3a (phosphorylase
kinase, delta)
BI846571
-
-
1,61
1,46
calm3b: calmodulin 3b (phosphorylase
kinase, delta)
BC044434.1
-1,42
-
-
1,43
NM_131047.1
-
1,61
1,93
1,92
calrl: calreticulin like
BG985448
1,74
3,37
6,71
-
calrl: calreticulin like
BC046906.1
-
1,84
3,48
3,37
calrl2: calreticulin, like 2
BG302583
-
1,67
2,71
3,07
calrl2: calreticulin, like 2
BI983290
-
-
2,24
-
calrl2: Calreticulin, like 2
BC050959.1
-1,65
-
-
-
CB357155
-
-
-2,02
-1,67
BC051626.1
-3,16
1,58
1,68
1,57
calr: calreticulin
casq2: calsequestrin 2
cat: catalase
cdc42bpb: CDC42 binding protein kinase
beta (DMPK-like)
CB365925
-
-
-2,29
-1,66
cdh11: cadherin 11, osteoblast
AI883276
-4,18
-1,91
-
-
cdh11: cadherin 11, osteoblast
BQ285646
-3,39
-
-
-
AF428098.1
-
3,53
1,77
-
cdh17: cadherin 17, LI cadherin (liverintestine)
Page | 265
Chapter VI – Appendixes
Fold change relative to uncut fins
(continued)
gene
Accession
3 hpa
24 hpa
48 hpa
96 hpa
cdh2 /// LOC572573: cadherin 2, neuronal ///
similar to N-cadherin
AF430842.1
-
1,55
2,89
-
NM_131081.1
-
-
1,83
-4,63
-
-
-
cdh2: cadherin 2, neuronal
cdo1: cysteine dioxygenase, type I
CH211-208D15.3: sideroflexin 2
cib2: calcium and integrin binding family
member 2
AI957754
-7,42
BC048044.1
-2,46
-5,67
BG305994
-
-1,5
-
-
copeb: core promoter element binding
protein
BC048893.1
-
-
-1,58
-1,56
cox17: COX17 cytochrome c oxidase
assembly homolog (S. cerevisiae)
BE201771
-1,45
-
-1,9
-1,73
crip2: cysteine-rich protein 2
BC044391.1
-3,1
-2,07
-
3,73
csrp1: cysteine and glycine-rich protein 1
BM529996
1,74
1,69
2,1
-
csrp1: cysteine and glycine-rich protein 1
BM534006
-
-
1,9
1,44
cyb5b: cytochrome b5 type B
CB352692
1,81
-
-
-1,83
NM_152952.1
-
3,49
4,13
4,01
cyp1a: cytochrome P450, family 1, subfamily
A
AB078927.1
-
-6,71
-11,55
-4,55
cyp1b1: cytochrome P450, family 1,
subfamily B, polypeptide 1
cygb1 /// LOC791505: cytoglobin 1 ///
hypothetical protein LOC791505
AF235139.1
1,59
-1,39
-1,72
-1,47
cyp26a1: cytochrome P450, subfamily
XXVIA, polypeptide 1
NM_131146.1
-1,97
-
-
-
cyp26b1: cytochrome P450, family 26,
subfamily b, polypeptide 1
BM024206
-2,99
-2,11
-1,59
-
cyp26b1: cytochrome P450, family 26,
subfamily b, polypeptide 1
AL714851
-3,34
-2,11
-2,03
-
cyp2j22: cytochrome P450, family 2,
subfamily J, polypeptide 22
AW422834
1,37
-
-
-
cyp2j28: Ccytochrome P450, family 2,
subfamily J, polypeptide 28
AI545969
1,84
-
-
-
cyp3c1: cytochrome P450, family 3,
subfamily c, polypeptide 1
AI883503
-
-1,54
-
-
cyp51: cytochrome P450, family 51
AI522712
-
-2,18
-2,05
-2,19
dlb: deltaB
AL722855
-
-
-1,42
-
dlb: DeltaB
AL718150
1,45
-
-
-
dlc: deltaC
NM_130944.1
-
-1,92
-2,11
-1,57
dlc: deltaC
BG883428
-
-2,09
-2,46
-
dld: deltaD
NM_130955.1
-2,3
-2,53
-
-
BC047809.1
-
-1,6
-
-
dnaja3a: DnaJ (Hsp40) homolog, subfamily
A, member 3A
dohh: deoxyhypusine
hydroxylase/monooxygenase
drl: draculin
eef2k: elongation factor-2 kinase
egr2a /// LOC571573: early growth response
2a /// similar to Egr2a protein
egr2b: early growth response 2b
ehd2: EH-domain containing 2
Page | 266
BC046086.1
1,86
1,37
1,53
-
NM_130977.1
1,48
-
-
2,11
AA495166
-5,16
-2,1
-1,87
-1,59
AY070229.1
-
-
-1,8
-1,87
NM_130997.1
-
-
-2,35
-2,17
CD605644
-
-
-
1,54
Chapter VI - Appendixes
Fold change relative to uncut fins
(continued)
gene
Accession
3 hpa
24 hpa
48 hpa
96 hpa
esr2a: estrogen receptor 2a
NM_180966.2
1,54
-
-
-
esr2b: estrogen receptor 2b
NM_174862.2
-2,46
-2,07
-2,29
-2,28
f7i: coagulation factor VIIi
NM_173228.1
-
-
-1,79
-
fads2: fatty acid desaturase 2
NM_131645.1
-5,03
-6,85
-4,23
-3,54
1,91
2,02
2,18
NM_131556.1
-2,71
-3,25
-5,3
-2,91
fhl: four and a half LIM domains
BC053279.1
-5,89
-1,91
-
2,28
fkbp9: FK506 binding protein 9
AI943251
-1,92
2,5
5,23
6,25
fbxo5: F-box protein 5
fgd: faciogenital dysplasia
AW171040
freqb: frequenin homolog b (Drosophila)
AA658635
-
--
-1,71
-1,85
gli2a: GLI-Kruppel family member GLI2a
NM_130967.1
-1,78
2,53
3,24
2,16
BC046027.1
1,74
-
-
-
gtf3aa: general transcription factor IIIAa
CA474391
1,52
-
-
-1,36
guca1a: guanylate cyclase activator 1A
NM_131870.1
3,08
-
-
-
gopc /// LOC797165: golgi associated PDZ
and coiled-coil motif containing /// similar to
Golgi associated PDZ and coiled-coil motif
containing
hbae3: hemoglobin alpha embryonic-3
BI896310
1,51
-
-
NM_152966.1
-2,52
-9,27
-3,54
hic1l /// LOC792473: hypermethylated in
cancer 1 like /// similar to Hypermethylated in
cancer 1 like
AF111712.1
-
-
-1,55
-
hif1an: hypoxia-inducible factor 1, alpha
subunit inhibitor
BC044475.1
-
-
1,81
1,8
hnf4a /// LOC792440: hepatocyte nuclear
factor 4, alpha /// similar to hepatocyte
nuclear factor 4 alpha
BG985513
-2,04
-
-
-
icln: swelling dependent chloride channel
BC052141.1
-
1,88
2,36
-
hgd: homogentisate 1,2-dioxygenase
icn: ictacalcin
BQ092588
-1,35
-
-
-
ikzf1: IKAROS family zinc finger 1 (Ikaros)
AF416370.1
-
-1,57
-
-
insm1b: insulinoma-associated 1b
BC053119.1
2,11
-
-
-
isl2b: islet2b
NM_130964.1
2
-
-
-
itk: IL2-inducible T-cell kinase
NM_131104.1
-1,79
-2
-2,33
-1,82
jag1a: jagged 1a
NM_131861.1
4,4
4,77
3,05
-
jag1b: jagged 1b
NM_131863.1
-1,6
-1,58
-1,84
-
kcmf1 /// LOC798742: potassium channel
modulatory factor 1 /// similar to Potassium
channel modulatory factor 1
BC053288.1
1,5
-
-
-
kctd10: potassium channel tetramerisation
domain containing 10
BG305807
1,39
-
-
-
AY120891.1
-
-1,88
-2,17
-
kctd12.2 /// LOC100006108: potassium
channel tetramerisation domain containing
12.2 /// similar to Kctd12.2 protein
BM529701
-2,5
-1,55
-
-
kctd12.2: potassium channel tetramerisation
domain containing 12.2
BI847041
-3,55
-1,58
-1,54
-
NM_131859.1
-
-1,93
-2,31
-1,92
kctd12.1 /// LOC796664: potassium channel
tetramerisation domain containing 12.1 ///
similar to leftover
klf12: Kruppel-like factor 12
Page | 267
Chapter VI – Appendixes
Fold change relative to uncut fins
(continued)
gene
Accession
3 hpa
24 hpa
klf2a: Kruppel-like factor 2a
NM_131856.1
1,68
-
-
-
klf2b: Kruppel-like factor 2b
NM_131857.1
-
-
-2,24
-2,28
klf4: Kruppel-like factor 4
NM_131723.1
2,57
-
-1,45
-
CD606143
-1,64
1,85
-
-
klf7l: Kruppel-like factor 7 (ubiquitous), like
klfd: Kruppel-like factor d
48 hpa
96 hpa
NM_130936.1
-5,21
-2,61
-2,37
-
lcp1: lymphocyte cytosolic plastin 1
AF157110.1
-
1,95
1,59
1,82
lhx1a: LIM homeobox 1a
AW077429
-
-
-1,43
-
lhx8: LIM homeobox 8
BM141496
-
-
-1,41
-1,42
lhx9: LIM homeobox 9
lima1: LIM domain and actin binding 1
lims1: LIM and senescent cell antigen-like
domains 1
BM023806
-2,28
-2
-
-
NM_131664.1
5,52
2,64
1,71
-
CD606661
-2,65
1,79
2,25
2,61
lmo1: LIM domain only 1
NM_173219.1
-
-1,42
-
-
lmo4: LIM domain only 4
NM_177984.1
-
-
1,69
AF398515.1
-
-1,48
-
-
BI866375
1,6
-1,59
-1,62
-
BC049430.1
-
-
1,69
-
LOC100003223 /// ppp1cb: protein
phosphatase 1, catalytic subunit, beta
isoform /// hypothetical protein
LOC100003223
BI867171
-1,34
-
-
-
LOC100003492 /// LOC793295 ///
zgc:66368: zgc:66368 /// hypothetical protein
LOC793295 /// hypothetical protein
LOC100003492
BM037186
-3,12
-1,71
-
-
LOC100005309 /// LOC100006428 ///
LOC558748 /// LOC559768 /// zgc:109934:
zgc:109934 /// hypothetical LOC558748 ///
hypothetical LOC559768 /// hypothetical
protein LOC100005309 /// hypothetical
protein LOC100006428
BI708028
5,08
1,82
-
LOC100006988 /// zgc:76916: zgc:76916 ///
hypothetical protein LOC100006988
BC049332.1
1,46
-1,67
-1,53
-
BI866584
3,06
-2,31
-2,16
-
BC045489.1
37,11
5,46
4,71
-
BE016352
1,44
-
-
-
LOC560615 /// zbtb16: zinc finger and BTB
domain containing 16 /// similar to Zinc finger
and BTB domain containing 16
BC046887.1
-2,79
-3,57
-3,77
-2,9
LOC562161 /// LOC792436 /// LOC794091
/// pitrm1: pitrilysin metalloproteinase 1 ///
similar to Pitrilysin metalloproteinase 1
BC045351.1
-
-
1,95
-
lmo4l: LIM domain only 4, like
lnx1: ligand of numb-protein X 1
LOC100003080 /// ppp4c: protein
phosphatase 4 (formerly X), catalytic subunit
/// similar to Protein phosphatase 4 (formerly
X), catalytic subunit
LOC100007297 /// LOC554429 ///
zgc:66427: zgc:66427 /// hypothetical
LOC554429 /// hypothetical protein
LOC100007297
LOC554697 /// slc16a3: solute carrier family
16 (monocarboxylic acid transporters),
member 3 /// hypothetical LOC554697
LOC559340: similar to chloride channel
CLC-3
Page | 268
Chapter VI - Appendixes
Fold change relative to uncut fins
(continued)
gene
Accession
3 hpa
24 hpa
48 hpa
96 hpa
LOC570980 /// zgc:91851: zgc:91851 ///
hypothetical LOC570980
AI974136
-2,04
-
3,15
4,68
LOC573171 /// zgc:92895: zgc:92895 ///
hypothetical LOC573171
BI866800
1,7
1,47
-
-
LOC573730 /// zgc:85729: zgc:85729 ///
hypothetical LOC573730
AW116619
1,35
-
-
-
LOC791586 /// zgc:56424: zgc:56424 ///
hypothetical protein LOC791586
BC050161.1
1,89
-
-
-
LOC791702 /// zgc:77898: zgc:77898 ///
hypothetical protein LOC791702
CD014378
-
-
1,79
1,94
LOC792016 /// zgc:55511 /// zgc:56194:
zgc:55511 /// hypothetical protein LOC792016
BC045983.1
-
-
-
-1,53
LOC792136 /// zgc:110249: zgc:110249 ///
hypothetical protein LOC792136
BM034951
-
-
-
-1,36
LOC792170 /// zgc:123008: zgc:123008 ///
hypothetical protein LOC792170
AI415900
-1,97
-
-1,49
-
LOC792184 /// zgc:112420: zgc:112420 ///
hypothetical protein LOC792184
CD015541
-
-
-1,49
-
LOC792208 /// zgc:86915: zgc:86915 ///
hypothetical protein LOC792208
AI883438
1,54
-
-
-
LOC792219 /// zgc:56095: zgc:56095 ///
hypothetical protein LOC792219
BC045905.1
-1,95
2,24
2,92
2,46
LOC793089 /// phf10: PHD finger protein 10
/// similar to Phf10 protein
AW420405
-
1,41
1,57
-
LOC793675 /// zgc:113271: zgc:113271 ///
hypothetical protein LOC793675
AI641414
-2,07
-
-
1,44
LOC795521 /// nnt: nicotinamide nucleotide
transhydrogenase /// similar to Nicotinamide
nucleotide transhydrogenase
AI884096
-2,19
1,82
2,15
-
AW019192
-1,47
-
-
-
LOC795940: similar to zinc transporter LIV1
AI721912
-
-
-
-1,4
LOC796194 /// mkrn1: makorin, ring finger
protein, 1 /// similar to Makorin RING zincfinger protein 1
BI863974
-4,59
-
-
-
LOC798840: hypothetical protein
LOC798840
LOC795865: hypothetical protein
LOC795865
BQ260759
-1,56
2,07
2,31
2,04
march5l: membrane-associated ring finger
(C3HC4) 5, like
BC049066.1
-
-
-
-1,32
mat1a: methionine adenosyltransferase I,
alpha
BC045343.1
-2,57
-2,38
-2,97
-2,51
mat2a: methionine adenosyltransferase II,
alpha
BC052136.1
2,11
-
-
-
mb: myoglobin
AW420360
-2
-3,11
-3,63
-1,82
mbtps2: membrane-bound transcription
factor protease, site 2
AW777526
-1,94
-
-
-
mcfd2: multiple coagulation factor deficiency
2
AW019194
2,38
2,03
2,79
2,17
mgrn1: mahogunin, ring finger 1
BC048069.1
-1,89
-
-
-
mib: mind bomb
AF506233.1
1,41
-
-
-
AI558276
-1,63
-
-
-
mizf: MBD2 (methyl-CpG-binding protein)interacting zinc finger protein
Page | 269
Chapter VI – Appendixes
Fold change relative to uncut fins
(continued)
gene
Accession
3 hpa
24 hpa
48 hpa
96 hpa
mpx: myeloid-specific peroxidase
AF349034.1
1,87
-2,24
-2,12
-1,95
NM_131329.1
1,32
-
-
-1,59
mylip: myosin regulatory light chain
interacting protein
BC045844.1
-1,66
-1,59
-
-1,66
nlz1: nocA related zinc finger 1
AY026937.1
-1,6
-
1,49
-
AL727924
-
-
3,11
2,87
NM_131180.1
-5,51
-2,66
-
-
nucb2a: nucleobindin 2a
BC046077.1
-
-
1,52
1,78
nucb2b: nucleobindin 2b
p2rx4a: purinergic receptor P2X, ligandgated ion channel, 4a
BC047852.1
2,27
-
-
-
NM_153653.1
-
1,94
2,1
1,64
p2rx5: purinergic receptor P2X, ligand-gated
ion channel, 5
AF500300.1
-
-1,5
-1,86
-
p4ha1: procollagen-proline, 2-oxoglutarate 4dioxygenase (proline 4-hydroxylase), alpha
polypeptide I
BC045890.1
-2,51
-
6,71
11,48
p4ha2: procollagen-proline, 2-oxoglutarate 4dioxygenase (proline 4-hydroxylase), alpha
polypeptide 2
myl7: myosin, light polypeptide 7, regulatory
nnt: nicotinamide nucleotide
transhydrogenase
nr2f1: nuclear receptor subfamily 2, group F,
member 1
AW059030
-
-
-
2,38
pcdh10a: protocadherin 10a
AI793921
-2,19
-2,35
-1,97
-1,86
pcdh1g1 /// pcdh1g11 /// pcdh1g18 ///
pcdh1g2 /// pcdh1g22 /// pcdh1g26 ///
pcdh1g29 /// pcdh1g3 /// pcdh1g30 ///
pcdh1g31 /// pcdh1g32 /// pcdh1g9 ///
pcdh1gb2 /// pcdh1gc5 /// pcdh1gc6:
protocadherin 1 gamma 22 /// protocadherin
1 gamma c 5 /// protocadherin 1 gamma c 6
/// protocadherin 1 gamma b 2 ///
protocadherin 1 gamma 1 /// protocadherin 1
gamma 2 /// protocadherin 1 gamma 3 ///
protocadherin 1 gamma 9 /// protocadherin 1
gamma 11 /// protocadherin 1 gamma 18 ///
protocadherin 1 gamma 26 /// protocadherin
1 gamma 29 /// protocadherin 1 gamma 30
/// protocadherin 1 gamma 31 ///
protocadherin 1 gamma 32
BM026607
-2,86
-1,74
-
-
pcdh2g20: protocadherin 2 gamma 20
BI865752
-
-
-
1,37
NM_131209.1
1,9
-
-
-
BQ615200
1,56
-
-
-
NM_152958.1
1,7
2,36
2,42
2,13
phf17: PHD finger protein 17
BC046874.1
-1,51
-
-
-
plekhf2: pleckstrin homology domain
containing, family F (with FYVE domain)
member 2
BC047820.1
-
-
1,38
-
NM_153656.1
-
-3,49
-2,84
-2,72
AF425739.1
1,63
-2,66
-2,46
-2,33
BI673753
-1,55
-1,4
-1,47
-1,39
NM_131389.1
1,93
-
-
-
pcdh8: protocadherin 8
pdlim7: PDZ and LIM domain 7
phc2: polyhomeotic-like 2 (Drosophila)
ptgs1: prostaglandin-endoperoxide synthase
1
pvalb8: parvalbumin 8
pxn: paxillin
rag1: recombination activating gene 1
Page | 270
Chapter VI - Appendixes
Fold change relative to uncut fins
(continued)
gene
raraa: retinoic acid receptor, alpha a
rbm4: RNA binding motif protein 4
rcn3: reticulocalbin 3, EF-hand calcium
binding domain
Accession
3 hpa
24 hpa
48 hpa
96 hpa
NM_131406.1
-
-
-1,51
-1,5
BC046057.1
-
-
1,68
-
AI793417
-
3,5
5,42
7,57
reverbb1: rev erb beta 1
AW077811
-
-3,74
-9,91
-10,93
reverbb2: rev erb beta 2
BQ074521
-2,01
-1,68
-3,44
-4,57
rhot1a: ras homolog gene family, member
T1a
BC044431.1
1,63
-
-
-
rnf11: ring finger protein 11
BC053118.1
-4,19
-1,54
-1,63
-1,88
AW421048
-1,48
-2,07
-2,84
-1,87
rnf128: ring finger protein 128
rnf144: ring finger protein 144
BI880177
-2,05
-1,68
-
-
rnf2: ring finger protein 2
BC044472.1
-
-
-
1,36
rorab: RAR-related orphan receptor A,
paralog b
BC051158.1
-1,7
-1,94
-3,35
-2,22
rpa1: replication protein A1
BC044372.1
-2,47
1,8
1,64
1,37
rrm2: ribonucleotide reductase M2
polypeptide
NM_131450.1
-3,84
3,91
4,29
4,17
rxrba: retinoid x receptor, beta a
NM_131275.1
-
-
-1,42
-
BC050163.1
-
-13,03
-14,86
-14,83
sc4mol: sterol-C4-methyl oxidase-like
scel: sciellin
BQ092124
-
-4,07
-3,94
-2,33
si:ch211-155a11.1: si:ch211-155a11.1
AI793670
-3,23
-
3,73
2,69
si:ch211-240l19.1: si:ch211-240l19.1
AI641408
1,96
-
-
-
si:ch211-260g14.3: si:ch211-260g14.3
BM185128
1,46
-
-
-
si:ch211-63o20.5: si:ch211-63o20.5
BI476367
-2,81
-3,72
-8,39
-6,89
si:dkey-181i3.1: si:dkey-181i3.1
BM316752
-
-
-1,55
-
si:dkey-18o7.1: si:dkey-18o7.1
BI710377
-
1,4
-1,33
2,05
si:dkey-18o7.1: si:dkey-18o7.1
AW058744
-
1,38
1,42
-
si:dkey-18o7.1: si:dkey-18o7.1
AW171417
-1,89
-
-
-
si:dkey-24l11.8: si:dkey-24l11.8
BI879696
-
-1,73
-2,3
-2,35
siah1: seven in absentia homolog 1
(Drosophila)
BC045870.1
-1,68
-1,37
-1,46
-1,3
sirt2: sirtuin 2 (silent mating type information
regulation 2, homolog) 2 (S. cerevisiae)
BC045510.1
-1,99
-
-
-
slc10a2: solute carrier family 10 (sodium/bile
acid cotransporter family), member 2
BC053189.1
-
-1,84
-
-1,54
slc16a1: solute carrier family 16
(monocarboxylic acid transporters), member
1
BC048883.1
-
1,42
-
-
slc1a3: solute carrier family 1 (glial high
affinity glutamate transporter), member 3
BC049340.1
-2,27
-1,77
-1,67
-1,59
slc1a4: solute carrier family 1
(glutamate/neutral amino acid transporter),
member 4
AI943367
-
4,82
11,96
9,59
slc25a28: solute carrier family 25, member
28
AI878799
-
-1,83
-1,99
-1,98
slc25a37: solute carrier family 25, member
37
AI884074
-
-
-1,53
-
Page | 271
Chapter VI – Appendixes
Fold change relative to uncut fins
(continued)
gene
slc25a37: solute carrier family 25, member
37
slc2a2: solute carrier family 2 (facilitated
glucose transporter), member 2
slc30a1: Solute carrier family 30 (zinc
transporter), member 1
Accession
3 hpa
24 hpa
48 hpa
96 hpa
BI673514
1,59
-
-
-
AW019704
-
-
-2
-
AI964204
3,64
2,18
1,64
1,59
slc31a1: solute carrier family 31 (copper
transporters), member 1
BC050484.1
-
-
1,78
-
slc31a1: solute carrier family 31 (copper
transporters), member 1
AY077715.1
-
-
-
1,73
slc35b4: solute carrier family 35, member B4
BC045293.1
-
1,54
1,77
-
slc39a13: solute carrier family 39 (zinc
transporter), member 13
AA658628
-2,93
1,41
1,93
3,11
slc39a7: solute carrier family 39 (zinc
transporter), member 7
BQ480733
-
2
2,9
-
slc39a7: solute carrier family 39 (zinc
transporter), member 7
AI437101
-
1,94
3,78
3,84
NM_131629.1
-
-2,01
-
-
CD596252
-
-
-1,63
-
CD597150
-
-
-1,75
-
slc40a1: solute carrier family 40 (ironregulated transporter), member 1
slc4a2: solute carrier family 4, anion
exchanger, member 2
slc4a2: solute carrier family 4, anion
exchanger, member 2
slc9a8: solute carrier family 9
(sodium/hydrogen exchanger), member 8
BI864810
-
-1,66
-1,86
-1,65
snai1a: snail homolog 1a (Drosophila)
NM_131066.1
1,81
2,46
2,46
2,61
sod1: superoxide dismutase 1, soluble
BM141482
-1,79
-
-1,29
-
sp8l: sp8 transcription factor-like
AI793487
-1,95
-
2,95
2,25
sparc: secreted acidic cysteine rich
glycoprotein
BG305371
-2,7
-2,43
-
1,68
BC053237.1
-
1,73
1,64
1,68
CD605058
1,52
2,38
2,82
2,34
NM_173225.1
-1,74
3,87
5,41
AY081009.1
-4,77
-5,38
-1,68
2,18
-1,75
-1,75
-1,51
sri: sorcin
tes: testis derived transcript (3 LIM domains)
thbs3a: thrombospondin 3a
thbs4: thrombospondin 4
thra: thyroid hormone receptor alpha
NM_131396.1
thrb: thyroid hormone receptor beta
AF302242.1
1,99
1,4
-
-
BI326469
-
1,85
1,86
-
tomm40: translocase of outer mitochondrial
membrane 40 homolog (yeast)
BC053295.1
-
-
-
-1,46
tomm40l: translocase of outer mitochondrial
membrane 40 homolog, like
BQ450003
-
-
1,78
-
tpte: transmembrane phosphatase with
tensin homology
timm9: translocase of inner mitochondrial
membrane 9 homolog
AW128322
-
2,04
2,37
2,42
traip: TRAF-interacting protein
BI709770
-
3,55
3,44
3,2
trim24: tripartite motif-containing 24
BI705535
1,98
-
-
-
trpm7: transient receptor potential cation
channel, subfamily M, member 7
BI983581
1,68
-
-1,81
-1,42
Page | 272
Chapter VI - Appendixes
Fold change relative to uncut fins
(continued)
gene
trpm7: transient receptor potential cation
channel, subfamily M, member 7
tshz1: teashirt family zinc finger 1
tspan18a: tetraspanin 18a
Accession
3 hpa
24 hpa
48 hpa
96 hpa
AI979410
2,45
-
-
-
AF242292.1
2,35
-
-
-
BI430212
-
-
1,66
2,16
usp5: ubiquitin specific protease 5
AW171454
-1,41
1,62
1,72
-
vdac1: voltage-dependent anion channel 1
BU709734
-1,54
-
-
-
vdac2: voltage-dependent anion channel 2
BC042329.1
-
-
-
1,34
vps18: vacuolar protein sorting protein 18
NM_173245.1
-1,88
-
1,63
1,7
BM775041
-1,8
1,92
1,86
-
wdr18: WD repeat domain 18
wu:fb58e08 /// zgc:136333: wu:fb58e08 ///
zgc:136333
yy1l: YY1 transcription factor, like
zbtb22: zinc finger and BTB domain
containing 22
AI477651
-
1,6
-
1,83
BC053307.1
-
-
-1,87
-
BM182223
1,39
-
-
-
zgc:101128: zgc:101128
AF262047.1
-
1,58
1,73
1,35
zgc:101562: zgc:101562
BM530902
-
-2,13
-1,84
-1,77
zgc:101628: zgc:101628
BM035033
1,52
-
-
-
zgc:103481: zgc:103481
BI867339
1,51
-
-
-
zgc:103663: zgc:103663
BM102182
-
-
-1,5
-1,47
zgc:109934: zgc:109934
AW232676
5,01
2,55
2,81
3,02
zgc:110141: zgc:110141
BI430294
-
-
-1,4
-
zgc:110464: zgc:110464
AW076585
-
-
-2,02
-1,85
zgc:110578: zgc:110578
BG304922
1,45
-
-
-
zgc:110767: zgc:110767
BI878929
-
-
1,61
-
zgc:110794: zgc:110794
AW232709
-
-
4,58
4,57
zgc:111795: zgc:111795
AW342722
-
3,35
3,04
2,82
zgc:111961: zgc:111961
BI897354
-
-
1,43
1,51
zgc:112015: zgc:112015
AW566838
1,56
-
-
-
zgc:112015: zgc:112015
BI881508
1,55
-
-
-
zgc:112083: zgc:112083
BQ261266
-1,57
-
-
-
zgc:112104: zgc:112104
BG305693
2,31
-
-
-
zgc:112165: zgc:112165
BI672240
1,77
-
-
-
zgc:112473: zgc:112473
AW202997
-
-
1,51
-
zgc:113085: zgc:113085
BM082885
-2,86
-2,52
-1,91
-
zgc:113339: zgc:113339
AW019047
-
-1,42
-1,45
-1,3
zgc:113452: zgc:113452
BI867231
-2,14
-
-
-
zgc:113518: zgc:113518
AA494741
-2,03
-
-
-
zgc:113878: zgc:113878
AW826698
-1,75
-
1,54
1,47
zgc:114095: zgc:114095
AW077846
1,69
1,49
-
-
zgc:114109: zgc:114109
CB353725
1,83
-
-
-
zgc:114109: zgc:114109
AI584229
1,52
-
-
-
zgc:136444: zgc:136444
AA658795
-
1,58
1,56
1,49
zgc:136815: zgc:136815
BQ783727
-1,76
-1,71
-1,84
-1,48
zgc:136815: zgc:136815
AI721396
-
-
-1,52
-
Page | 273
Chapter VI – Appendixes
Fold change relative to uncut fins
(continued)
gene
Accession
3 hpa
24 hpa
48 hpa
96 hpa
zgc:152801: zgc:152801
AW281908
1,48
-
-1,94
-
zgc:152947: zgc:152947
BM777731
3,21
-
-
-
zgc:158334: zgc:158334
AI943110
2,12
-
1,36
-
zgc:158393: zgc:158393
BG727638
-
-
-
-1,4
zgc:162161: zgc:162161
AW343822
-
-
-1,35
-1,45
zgc:55262: zgc:55262
AF282675.1
-1,64
1,45
2,31
2,36
zgc:55363: zgc:55363
BC044149.1
-3,33
-2,88
-2,51
-2,6
zgc:55491: zgc:55491
BC044410.1
-1,74
1,89
-
-
zgc:55891: zgc:55891
BG303543
-
2,76
2,52
2,08
zgc:55970: zgc:55970
BC047199.1
1,33
-
-
1,44
zgc:55983: zgc:55983
BC047798.1
-1,35
-
-1,47
-1,43
zgc:56064: zgc:56064
BC045892.1
-
-
-
-1,76
zgc:56116: zgc:56116
BC045922.1
1,94
-
-1,84
-1,77
zgc:56152: zgc:56152
BC050503.1
-
-
-1,6
-
zgc:56200: zgc:56200
BC045988.1
-
3,11
3,92
3,66
zgc:56326: zgc:56326
BC046075.1
-1,54
-
-
-1,35
zgc:56540: zgc:56540
BC049477.1
1,91
-
-
-
zgc:56628: zgc:56628
BC049054.1
-
-
1,68
2,02
zgc:63514: zgc:63514
AI397313
-1,65
-
-
1,56
zgc:63563: zgc:63563
BI979115
3,02
-
-
-
zgc:63629: zgc:63629
AI959504
-1,43
-
-
-
zgc:63667: zgc:63667
BM956897
-
-1,49
-
-
zgc:63695: zgc:63695
BM861653
-
-
2,08
2,18
zgc:63904: zgc:63904
CD014948
-
-
-1,81
zgc:63907: zgc:63907
BC053142.1
-1,99
-2,33
-2,7
-1,77
zgc:63986: zgc:63986
BM185037
-1,59
-
-
1,34
zgc:64185: zgc:64185
BC053301.1
-
-
-
-1,53
zgc:64214: zgc:64214
BI883233
1,88
-2,8
-3,63
-2,21
zgc:66378: zgc:66378
BM859695
1,75
-
-
-
zgc:66433: zgc:66433
BM860036
-
2,21
2,75
3,11
zgc:66433: zgc:66433
BG305790
-
-1,51
-1,48
-
zgc:66474: zgc:66474
CD285064
-
-1,62
-
-
zgc:73126: zgc:73126
BM529934
-1,44
-
-
-
zgc:73179: zgc:73179
BM889637
-
1,5
-
-
zgc:76940: zgc:76940
BC045444.1
2,88
-
-
1,85
zgc:77306: zgc:77306
AW343670
-2,9
-
-
-
zgc:77542: zgc:77542
CA470922
-
1,46
1,74
1,93
zgc:77724: zgc:77724
BM025990
-
-
-
-1,35
zgc:86799: zgc:86799
BI984247
1,74
-
-
-
zgc:86807: zgc:86807
BM184012
-
1,69
1,73
1,7
zgc:91986: zgc:91986
AI957806
1,57
-1,76
-1,92
-
zgc:92027: zgc:92027
CB356733
2,68
-
-
-
zgc:92027: zgc:92027
AI943210
1,86
-
-
-
Page | 274
Chapter VI - Appendixes
Fold change relative to uncut fins
(continued)
gene
Accession
3 hpa
24 hpa
48 hpa
96 hpa
zgc:92066: zgc:92066
BM141472
2,51
1,75
1,85
1,91
zgc:92074: zgc:92074
AW777479
-1,94
-
-
-
zgc:92077: zgc:92077
BI877898
-2,5
-
-
-
zgc:92139: zgc:92139
BG303801
2,27
1,84
2,04
1,4
zgc:92169: zgc:92169
AL718978
-1,61
-
-
-
zgc:92205: Zgc:92205
AL918722
1,48
-
-
-
zgc:92214: zgc:92214
BE605469
-70,86
-110,7
-147,7
-38,17
zgc:92251: zgc:92251
BM035522
2,27
-
-
-
zgc:92360: zgc:92360
BQ092384
-3,21
-1,69
-1,64
-1,36
zgc:92405: zgc:92405
CD605002
-1,62
-
-
-
zgc:92406: zgc:92406
AI558624
-
-29,33
-29,03
-23,7
zgc:92434: zgc:92434
BI980193
-
-
-1,63
-1,97
zgc:92463: zgc:92463
BQ092295
5,9
4,74
-
-
zgc:92480: zgc:92480
BE201806
-1,82
-
-1,45
-
zgc:92696: zgc:92696
BI879680
-
-2,05
-3,33
-
zgc:92774: zgc:92774
AA606218
1,47
1,96
1,86
1,49
zic2a: zic family member 2 (odd-paired
homolog, Drosophila), a
BI475021
-5,62
-2,16
2,54
2,01
zic2a: zic family member 2 (odd-paired
homolog, Drosophila), a
NM_131558.1
-
-
1,41
-
zic2b: zic family member 2 (odd-paired
homolog, Drosophila) b
AF207751.1
-
-
2,55
2,11
zic5: zic family member 5 (odd-paired
homolog, Drosophila)
AY326458.1
-
-2,31
2,17
2,13
zic5: zic family member 5 (odd-paired
homolog, Drosophila)
AY326458.1
-4,86
-
-
-
CD015585
1,43
-
-
-
znf503: zinc finger protein 503
BC044193.1
-3,2
-1,56
-
-
znf511: zinc finger protein 511
BI709799
-1,71
1,54
2,4
2,01
znf598: zinc finger protein 598
AI965205
-
-1,47
-1,76
-1,68
znf207a: zinc finger protein 207, a
Page | 275
Chapter VI – Appendixes
Page | 276
Chapter VI - Appendixes
Appendix 4
Results of this thesis published in international, peerreviewed publication
Page | 277
V-ATPase Proton Pumping Activity Is Required for Adult
Zebrafish Appendage Regeneration
Joana Monteiro1,2, Rita Aires1, Jörg D. Becker1, António Jacinto3, Ana C. Certal1,4*,
Joaquı́n Rodrı́guez-León1,5*
1 Instituto Gulbenkian de Ciência, Oeiras, Portugal, 2 Instituto de Medicina Molecular, Faculdade de Medicina de Lisboa, Lisboa, Portugal, 3 Centro de Estudos de Doenças
Crónicas, Faculdade de Ciências Médicas, Lisboa, Portugal, 4 Champalimaud Foundation, Lisboa, Portugal, 5 Department de Anatomı́a Humana, Biologı́a Celular y
Zoologı́a, Facultad de Medicina, Universidad de Extremadura, Badajoz, Spain
Abstract
The activity of ion channels and transporters generates ion-specific fluxes that encode electrical and/or chemical signals
with biological significance. Even though it is long known that some of those signals are crucial for regeneration, only in
recent years the corresponding molecular sources started to be identified using mainly invertebrate or larval vertebrate
models. We used adult zebrafish caudal fin as a model to investigate which and how ion transporters affect regeneration in
an adult vertebrate model. Through the combined use of biophysical and molecular approaches, we show that V-ATPase
activity contributes to a regeneration-specific H+ ef‘flux. The onset and intensity of both V-ATPase expression and H+ efflux
correlate with the different regeneration rate along the proximal-distal axis. Moreover, we show that V-ATPase inhibition
impairs regeneration in adult vertebrate. Notably, the activity of this H+ pump is necessary for aldh1a2 and mkp3 expression,
blastema cell proliferation and fin innervation. To the best of our knowledge, this is the first report on the role of V-ATPase
during adult vertebrate regeneration.
Citation: Monteiro J, Aires R, Becker JD, Jacinto A, Certal AC, et al. (2014) V-ATPase Proton Pumping Activity Is Required for Adult Zebrafish
Appendage Regeneration. PLoS ONE 9(3): e92594. doi:10.1371/journal.pone.0092594
Editor: Stephan C. F. Neuhauss, University Zürich, Switzerland
Received September 15, 2013; Accepted February 24, 2014; Published March 26, 2014
Copyright: ß 2014 Monteiro et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: JJM was supported by a fellowship (SFRH/BD/45131/2008) from Fundação para a Ciência e Tecnologia (FCT), Portugal. ACC was supported by a
postdocoral fellowship (SFRH/BPD/29957/2006) from Fundação para a Ciência e Tecnologia (FCT), Portugal. This work was supported by the following grants:
european FP6-Cells into Organs, FCT (Grant PTDC/BIA-BCM/100867/2008 and POCTI-ISFL-4-664) and Ministerio de Ciencia e Innovación, Spain (Subprograma
Ramon y Cajal, reference RYC-2008-02753 and grant BFU2009-12279). JRL is supported by the Subprogram Ramón y Cajal from Ministerio de Ciencia e Innovación,
Spain (RYC-2008-02753). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: [email protected] (JRL); [email protected] (ACC)
injury, including Wnt (canonical and non-canonical), Fgf, Shh,
Bmp, Activin-bA, Notch and Retinoic acid [1][10].
Alongside classical signalling pathways, the relevance of ion
channels and transporters for regeneration is becoming increasingly evident. Their coordinated activity results in the differential
accumulation of ions, thus electric charge, across cells membranes.
The electrical properties of all organisms arise from this charge
segregation [11]. Although the generation of an endogenous
wound electric current (EC) is a universal and essential response to
wounding [12], the maintenance of endogenous ECs after wound
closure is restricted to regenerating structures [13][14]. In fact, it
has been long known that ECs are essential to regeneration
[15][16]. In the last decade, successful efforts have begun to unveil
the ionic nature of these electric cues and the molecular players
that generate them. For instance, the ionic composition of the ECs
at rat corneal wounds is now described and is actively regulated by
specific ion transporters [17]. Moreover, cellular hyperpolarization
caused by the H+ pump V-ATPase has proven essential for
regeneration of Xenopus larval tail, by promoting cell proliferation
and neural patterning [18]. Also, during planarian regeneration,
the proton,-potassium transporter H+,K+-ATPase ensures the
membrane depolarization required to specify anterior polarity in
regenerating tissues and for tissue remodelling via apoptosis [19].
Other studies have identified ion transporters that generate electric
signals involved in cell migration, proliferation, differentiation and
Introduction
Although humans are unable to regenerate after severe organ
loss or amputation of body parts, other metazoans have such a
capacity. The teleost Danio rerio (zebrafish) is able to regenerate
several internal organs and the fins. The latter constitutes a great
model to study adult vertebrate regeneration due to its easy access
and non-vital function [1].
The caudal fin is composed of segmented bony rays or
lepidothrichia that encircle the intra-ray mesenchyme. They are
separated by inter-ray connective tissue and covered with
epithelium. Blood vessels, nerves and pigment cells complete the
fin [2]. Upon amputation, a new fin is produced roughly within
two weeks through a process called epimorphic regeneration,
including three main stages: wound healing (0–12 hours post
amputation - hpa), blastema formation (12–48 hpa), and regenerative outgrowth (48 hpa to 2 weeks) [3–5]. Importantly, the
blastema is the crucial structure for epimorphic regeneration. This
heterogeneous cell population arises from dedifferentiation of
mature cells [6–8], possibly in combination with cellular
transdifferentiation and/or a resident stem cell pool, and contains
the morphogenetic information required to give rise and repattern all the missing tissues [9]. Regeneration is regulated by the
orchestrated action of several signalling pathways activated after
PLOS ONE | www.plosone.org
1
March 2014 | Volume 9 | Issue 3 | e92594
V-ATPase Role in Adult Zebrafish Fin Regeneration
apoptosis (reviewed in [20][21]). Interestingly, all these cell
behaviours are required for regeneration.
Ion transporters also generate chemical gradients that contribute to instruct specific cell behaviours [21]. For example, the
increase in intracellular sodium, mediated by the voltage-gated
sodium channel NaV1.2, is required for cell proliferation and
tissue innervation during Xenopus tadpole tail regeneration [22]. In
the zebrafish eye, the V-ATPase regulates retinoblast proliferation
and survival, possibly through the acidification resulting from H+
accumulation [23]. The same H+ pump is essential for activation
of Wnt, JNK and Notch signalling, by regulating endosomal pH
[24–26].
Despite the increasing amount of data, a comprehensive
description of the role of ion channels and transporters in
regeneration is far from complete. In this study, we coupled
biophysical and molecular approaches to address the ion nature
and respective ion transporters involved in regeneration in an
adult vertebrate (zebrafish). We show that a H+ outward current
(efflux) is specifically set during caudal fin regeneration and that
the V-ATPase, which is the main H+ pump in animal cells,
contributes to that efflux. The onset and intensity of both VATPase expression and H+ efflux vary with the amputation plane
along the proximal-distal (PD) axis in a way that correlates with
the regeneration rate. Particularly, we demonstrate that inhibition
of V-ATPase activity impairs regeneration and that proximal
stumps have a stronger dependence on V-ATPase activity
compared to distally amputated fins. We then investigated how
the activity of this H+ pump articulates with molecular signalling
pathways to affect cell behaviour and give rise to the missing
tissues. We show that V-ATPase is required for aldh1a2 and mkp3
expression, blastema cell proliferation and normal fin innervation.
Scanning Ion-Selective Electrode Technique (SIET)
SIET (Applicable Electronics LLC, USA) is a non-invasive
technique that measures stable and low magnitude extracellular
ion-specific fluxes in aqueous media. Ion-selective electrodes (ISE)
were built, connected to the SIET system and calibrated as
described in [29–31], with adaptations to adult zebrafish (Table
S1). Fish were anesthetized in recording medium (Table S2)
(adapted from [32]) and accommodated in a custom-made plate
(Fig. 1A). The ISE was positioned in front of the distal end of the
fin, aligned with the fin in the ‘‘X’’ and ‘‘Z’’ axes and moved
between one position close to the rays (10–20 mm) and another
70 mm farther away to measure direct current (DC) voltage
potential. A reference measurement was taken away from the fish.
The electrical signal was recorded in ASET software (Science
Wares) and transformed into ion fluxes using the Nernst equation
and Fick’s law, as described [33]. Fluxes were classified according
to the direction: influx and efflux. We measured potassium-,
sodium-, calcium-, protons- and chloride- specific fluxes. Measurements were performed at the 3rd, 4th and 5th dorsal and
ventral rays. One-way ANOVA and post-hoc Tukey HSD test
were used to compare H+ flux at all regeneration stages screened,
and paired T-test for comparisons within each time point.
Microarrays
All procedures involving animal use were approved by the
Ethics Committee for Animal Welfare at Instituto Gulbenkian de
Ciência (IGC), according with directives from Direção Geral de
Veterinária (PORT 1005/92). All surgeries were performed under
Tricaine anesthesia, and all efforts were made to minimize animal
suffering.
Caudal fins were amputated at the distal plane and collected at
3, 24, 48 and 96 hpa. Intact fins (0 hpa) were also collected and
used as control. Two replicates were used per time point, each
consisting of three fins. Total RNA was isolated using RNeasy
Mini Kit (Qiagen). Scanned arrays were analyzed first with GCOS
1.4 software to obtain Absent/Present calls and for subsequent
analysis with dChip 2010 (http://www.dchip.org). The arrays
were normalized to a baseline array with median CEL intensity by
applying an Invariant Set Normalization Method [34]. Normalized CEL intensities of the ten arrays were used to obtain modelbased gene expression indices based on a PM (Perfect Match)-only
model. All genes compared were considered to be differentially
expressed if the 90% lower confidence bound of the fold change
between experiment and baseline was above 1.2 in both replicate
datasets and if the transcript had at least one Present Call per
replicate.
Animal procedures
Whole mount in situ hybridization
For most experiments, we used AB wild type (WT) zebrafish
(Danio rerio) from the IGC fish facility. The mutant line
atp6v1e1hi577tg (AB) was acquired from ZIRC. All fish were raised
and maintained under standard procedures [27]. Adult fish (6–9
month old) were kept at 30uC in isolated tanks with re-circulating
water
Prior to manipulation, fish were anesthetized in Tricaine
(Sigma-Aldrich #A5040), 1 mM for embryos/larvae and
0.6 mM for adults. Larval fin folds were amputated 2 days postfertilization (dpf) as described [28]. Adult caudal fins were
amputated with surgical razor blades along the dorsoventral axis,
1–2 ray segments before the first ray bifurcation (distal amputation) or 2 segments distal to the most posterior scale covering the
fin base (proximal amputation). For amputation at both planes
(proximal-distal amputation, PD), the dorsal and ventral halves of
the fin were amputated at either planes; a third cut along the
proximodistal axis, halfway through the dorsoventral axis,
completed tissue removal. Upon manipulation, animals returned
to their tanks to regenerate. For tissue collection, fins were reamputated at several regeneration time points, 1-2 bone ray
segments proximal to the first amputation.
Gene fragments for atp6v1e1b, atp6v1a, wnt10b, mkp3 and aldh1a2
were cloned by PCR amplification from zebrafish cDNA,
according to [35], using sequence-specific primers (Table S3).
PCR products were ligated into pGEM-T Easy (Promega
#A1360). For atp6v1e1b, we used pBluescript II KS+ (Stratagene
#212207). Digoxigenin-labeled RNA probes were then synthesized. After collection, caudal fins were processed and used for in
situ hybridization, as described [8]. In fins amputated at the PD
plane the final precipitation reaction was stopped when the
proximal regenerate was full stained.
Materials and Methods
Ethics statement
PLOS ONE | www.plosone.org
Whole mount immunohistochemistry
Caudal fins were fixated overnight in 0.2% PFA (for ATP6V1A)
or 4% PFA (for the remaining antigens) and processed according
to [8]. All methanol and acetone incubations were excluded when
staining for rhodamin-phalloidin (Invitrogen R415). The following
primary antibodies were used: anti-ATP6V1A (Genscript
A00938), anti-Pan-cadherin (Abcam ab6528-100), anti-phosphoHistone-3 (H3P) (Millipore 06-570), anti-active-Caspase-3 (Abcam
ab13847), anti-acetylated a-tubulin (Sigma T7451).
2
March 2014 | Volume 9 | Issue 3 | e92594
V-ATPase Role in Adult Zebrafish Fin Regeneration
Figure 1. H+ efflux and V-ATPase upregulation accompany appendage regeneration in an adult vertebrate. (A) Recording chamber for
H+ flux measurement using SIET, representing zebrafish emerged in recording medium. (B) H+ efflux established during regeneration. *statistical
significant results (n = 10, p,0.05). (C) Affimetrix microarray to assess gene expression during caudal fin regeneration, compared to intact fins. (D–I) In
situ hybridization of V-ATPase subunits atp6v1e1b (D–F) and atp6v1a (G–I), at 24 hpa (D, G), 48 hpa (E–H) and 72 hpa (F–I). (J–M)
Immunohistochemical detection of Atp6v1a at 24 hpa (J, K), 48 hpa (L) and 72 hpa (M). White arrowheads point to the Atp6v1a blastema
localization. (J) Detail of Atp6v1a (green) cellular localization in blastema cells, 24 hpa. hpa: hours post amputation. For each panel, n = 6, except
mentioned otherwise.
doi:10.1371/journal.pone.0092594.g001
fluo-MO-2 TGCAGATCCTGCTCCTGCTGCTTTA, cfluo-MO-2 TGgAcATCgTGCTgCTcCTGCTTTA, vivo-MO TCGGCATCGCTGAGCGCCA, cVivo-MO CCTCTTACCTCAGTTACAATTTTATA. Fins were amputated at either the proximal
or distal level. Each atp6v1e1b-specific morpholino was injected
into one half of the caudal fin at 2 or 16 hpa, and the other half
received the corresponding control. The same number of fish
received the inhibitory molecule at the dorsal and ventral part.
Fluo-MO experiments were performed on AB WT fish, and vivoMO was delivered to atp6v1e1bhi577aTg/+ (AB) fish (heterozygous
fish carrying a recessive mutation for atp6v1e1b). For fluo-MOs,
injection was immediately followed by electroporation of the
whole fin. Both procedures were performed as described [36]. The
areas of regenerating tissue after MO and control MO delivery
were compared with a paired T-test. Results were plotted as the
difference (%) in treated regenerate area compared to the control,
calculated using the formula: (MO area x 100/control MO area) 100 = % MO area relative to the control.
Concanamycin A (concA, Sigma C9705) was dissolved in 100%
DMSO and diluted in standard Danieau medium to working
concentrations of 100 and 500 nM; the corresponding control
solutions were 0.1% and 0.5% DMSO respectively, both prepared
in Danieau medium. ConcA and control were injected every 12 h
between 6–42 hpa. The experimental design and procedure was as
described for vivo-MO.
Cell proliferation
Proliferating cells were detected by whole mount immunohistochemistry against H3P. The number of H3P-positive cells was
counted in the regenerating mesenchyme and in the mesenchyme
immediately below the amputation plane. We used threedimensional projections of confocal images through the mid
20 mm of the mesenchymal depth, and pan-cadherin to exclude
epithelial cells. Statistical analysis was performed using paired Ttest.
Fin fold regeneration assay
Fin folds of 15 AB WT and 15 atp6v1e1bhi577tg/- (AB) mutant
larvae were amputated at 2 dpf. At 5 dpf the regenerated area was
measured and compared to the area of non-amputated larvae of
the same genotype using independent T-test. The two fish lines
were compared separately due to genotype- specific morphometric
differences. Phenotypic defects were also investigated by visual
inspection.
Pharmacological and morpholino knockdown
Different morpholinos (Gene Tools, LLC) were used to block
translation of V-ATPase subunit v1e1b. Fluorescein-tagged morpholinos (fluo-MO) and corresponding mismatch controls (cfluoMO) were used at 1 mM. Vivo-morpholino (vivo-MO) and
control vivo-MO (cVivo-MO) were delivered at 0.5 mM. Their
sequences were as follows (59 to 39): fluo-MO-1 TCGGCATCGCTGAGCGCCA, cfluo-MO-1 TCcGCATgGCTGAcCGCgA,
PLOS ONE | www.plosone.org
3
March 2014 | Volume 9 | Issue 3 | e92594
V-ATPase Role in Adult Zebrafish Fin Regeneration
For in situ hybridization and in vivo protocols, images were
obtained with a Leica Z6APO stereomicroscope equipped with a
Leica DFC320 color camera. Immunostainings were imaged on a
Zeiss LSM 710 confocal microscope. The ImageJ software was
used to analyze the Z stacks and to measure regenerate area and
blastema length. All statistical analyses were done on SPSS 16.0
software.
(Fig. 1J). Considering that Atp6v1a is part of the cytoplasmic
domain of the H+ pump, our results did not exclude a possible
plasma membrane location of the whole pump.
Overall, these three different approaches are in agreement with
a specific upregulation of V-ATPase during regeneration. Both VATPase expression and H+ efflux intensity seem stronger during
blastema formation and decrease thereafter, suggesting a causal
relation.
Results
V-ATPase inhibition affects regeneration
Imaging
To assess the functional significance of the V-ATPase during fin
regeneration, we used concA to specifically inhibit the pump’s
activity. Translation of atp6v1e1b, a V-ATPase subunit essential for
the pump activity, was also blocked using gene specific fluo-MOs.
Half regenerating fin was treated with one inhibitor whereas the
other half received the corresponding control (File S3). All VATPase inhibitors decreased the regenerate area for at least 48 h
compared to the corresponding control, despite high phenotypic
variability (Fig. 2A). This suggests a role for this H+ pump in the
regenerative process. In fact, V-ATPase inhibition seemed to affect
regeneration rate more that the regenerative ability itself, since,
notwithstanding the reduced area, regeneration still progressed in
a delayed fashion.
Proton efflux accompany blastema formation
The individual contribution of K+, Na+, H+, Ca2+ and Cl2 specific fluxes to the ECs during adult zebrafish fin regeneration
was investigated using SIET (Fig. 1B, File S1). From the five ionspecies tested, H+ was the only one with a dynamic pattern in
stages specific to regeneration events (later than wound healing).
Before amputation (0 hpa) and during wound healing (6 hpa) fins
maintained a small H+ efflux close to the background noise
(p.0.05, independent T-test). However, by 24 hpa, when the
wound had healed and a blastema was forming, an outward
current was established. This efflux was 14-fold higher than the
efflux detected in intact fins (p,0.05, one-way ANOVA), and
remained at high intensity until the end of blastema formation
(48 hpa). From 72 hpa on, it decreased towards levels closer to the
uninjured tissue (Fig. 1B). SIET measurements show for the first
time that H+ current is specifically set during adult vertebrate
appendage regeneration, suggesting that some mechanism of H+
extrusion is activated in cells during regeneration.
V-ATPase affects H+ efflux expression and correlates with
the position-dependent regeneration rate
To investigate if V-ATPase was related to regeneration rate, we
took advantage of the fact that proximal stumps have higher
regeneration rate than distal ones [37][38], and compared VATPase expression after proximal versus distal (PD) amputation.
In proximal wounds, atp6v1e1b was first visible around 12 hpa in
the first ray segment below the amputation plane and, to a smaller
extent, in the interray (Fig. 2B). Expression at the distal stump only
became evident at 24 hpa, as described (Fig. 1F, Fig. 2C, E). By
that time atp6v1e1b domain in proximal stumps was much stronger
and wider (Fig. 2D). By 48 hpa the differences between proximal
and distal atp6v1e1 expression had faded (Fig. 2F, G). Accordingly,
at the protein level, Atp6v1a in proximal stumps was present in
almost twice the length than in the regions amputated distally by
24 hpa (proximal:distal length ratio mean 6 s.e.m = 1.8460.17)
(Fig. 2H, I, M). At 48 hpa, the protein domain was still 1.5760.08
fold longer in proximal wounds (Fig. 2J, K, M). From the above,
V-ATPase seems to have a dynamic expression according to the
level of amputation: in the proximal, fast regenerating regions, the
pump expression starts earlier and the expression domain is larger
than in the slower regenerating distal wounds.
We have previously suggested V-ATPase as a mediator of the
regeneration-specific H+ efflux. If so, the dynamic expression of VATPase along the PD axis should be accompanied by a
concordant H+ efflux pattern. Thus, we measured H+ flux
throughout regeneration after PD amputation, using SIET
(Fig. 2L). The efflux peaked always at 24 hpa. However, in
proximal stumps H+ efflux started earlier (3 hpa instead of 12 hpa)
and was significantly higher than in distal regions for each timepoint (p,0.05, paired T-test). This agrees with the different onset
and magnitude of V-ATPase expression at proximal and distal
stumps, reinforcing the correlation between H+ efflux and VATPase and extending such correlation to the position-dependent
regeneration rate.
To deepen the relation between V-ATPase activity and H+
efflux, we analysed the effect of V-ATPase inhibition on H+ flux.
For that, we used atp6v1e1bhi577aTg/+ (AB) fish to perform an
atp6v1e1b knockdown using vivo-MO as described in materials and
methods, at 2 h after proximal and distal amputation. Then, H+
V-ATPase is specifically upregulated during adult caudal
fin regeneration
To find candidate H+ transporters that could be associated to
regeneration and to the detected H+ efflux, we took advantage of
an Affymetrix microarray previously done in our laboratory to
assess gene expression during regeneration after distal amputation.
Upon a specific analysis for proton transporters’ expression, we
focused on the V-ATPase, one of the main H+ transporters in
animal cells. In fact, all V-ATPase subunits present in the
microarray were upregulated between 24 and 96 hpa (Fig. 1C).
This expression pattern matches that of H+ efflux, suggesting that
the regeneration specific H+ extrusion could be associated to the
increased V-ATPase expression.
The regeneration-associated expression of this H+ pump was
confirmed by in situ hybridization for different V-ATPase subunits.
Neither atp6v1a nor atp6v1e1b were detected in intact fins (Figures
A and B in File S2). In contrast, 24 h after distal amputation, both
atp6v1a and atp6v1e1b were expressed in the blastema-forming
region and in scattered cells below the amputation plane (Fig. 1D,
G and Figure C in File S2). By 48 hpa, their expression domain
was expanded, accompanying the growth of the blastema (Fig. 1E,
H). At 72 hpa both transcripts were faint but could still be
observed in the distal regenerating region (Fig. 1F, I).
For V-ATPase detection at the protein level, we targeted the
cytoplasmic subunit Atp6v1a. In the intact fin, Atp6v1a was
mainly restricted to the epidermis, in a scattered pattern (Figures
D-F in File S2). On the contrary, by 24 hpa, this subunit was
strongly upregulated in the blastema (Fig. 1J, K) and was present
all over the blastema until48 hpa (Fig. 1L). At that time, Atp6v1a
also became evident in the regions where ray segment joints were
forming. At 72 hpa it was also present in the areas of lepidotrichia
regenerative outgrowth and in the intra-ray mesenchyme
(Fig. 1M). Atp6v1a did not co-localize with rhodamin- phalloidin,
which labels cortical F-actin, but stained immediately below
PLOS ONE | www.plosone.org
4
March 2014 | Volume 9 | Issue 3 | e92594
V-ATPase Role in Adult Zebrafish Fin Regeneration
Figure 2. V-ATPase inhibition affects regeneration and, similar to H+ efflux, has a different expression pattern depending on the
amputation plane along the PD axis. (A) Inhibition of the V-ATPase using concanamycinA (concA) and fluorescein- tagged morpholinos (fluoMO-1 and 2). (B–M) Experiments performed after proximo-distal amputation. (B–G) In situ hybridization for atp6v1e1b at 12 h (B, C), 24 h (D, E) and
48 h (F, G) after proximal (B, D, F) and distal amputation (C, E, G). (H–K) Immunohistochemical detection of Atp6v1a at 24 h (H, I) and 48 h (J, K) after
proximal (I, K) and distal amputation (H, J). (L) H+ efflux pattern during regeneration after proximal and distal amputation (n = 8–10). (M) Length of
Atp6v1a expression domain in proximal and distal stumps, 24 and 48 hpa. *statistical significant results (n = 3, p,0.05). hpa: hours post amputation.
For each panel, n = 6, except mentioned otherwise.
doi:10.1371/journal.pone.0092594.g002
fluxes were measured at main regeneration stages using SIET
(Fig. 3A, B). Aside from the higher efflux intensity proximally,
distal and proximal wounds had a similar flux pattern, as follows:
in the controls, H+ efflux intensity was maximal at 24 hpa and
then decreased gradually, as previously detected (Fig. 2L). After
atp6v1e1b knockdown, H+ efflux at 24 hpa decreased significantly
(p,0.05, paired T-test), confirming the causal relation between VATPase activity and H+ efflux. Surprisingly, by 48 hpa the efflux
pattern reverted compared to the control: as the latter began its
descendent path, the former increased significantly (p,0.01,
paired T-test) to a level that resembled the control efflux at
24 hpa for the same amputation plane. Similarly, at 72 hpa the
H+ efflux intensity was higher than in the control (p,0.01, paired
T-test), and was similar to the control efflux at 48 hpa, as if there
was a 24 h delay on flux intensity due to the transient vivo-MO
effect. Thus, the level of flux seems to be controlled by V-ATPase
activity and relevant for position- dependent regeneration.
PLOS ONE | www.plosone.org
V-ATPase is required during regeneration and is
dependent on the amputation plane
To further investigate the role of V-ATPase and its association
with regeneration rate, we performed vivo-MO mediated
atp6v1e1b knockdown in atp6v1e1bhi577aTg/+ (AB) fish, 2 or 16 h
after proximal and distal amputation. In all experimental sets,
atp6v1e1b knockdown decreased the regenerate area compared to
the control (Fig. 3C, C’, D, D’). However, proximal regenerates
were more affected by vivo-MO delivery at 2 hpa (Fig. 3C, C’)
whereas distal stumps exhibited a more significant area reduction
when atp6v1e1b was inhibited at 16 hpa (Fig. 3D, D’). Importantly,
this correlates with the different onset of both V-ATPase
expression and H+ efflux, and again it links to regeneration rate.
Besides, the overall decrease in the regenerate area was steeper
proximally than at distal stumps (24 hpa, mean6s.e.m. =
35.668.7% and 11.764.9%, respectively, for delivery at 2 and
16 hpa), suggesting that higher regeneration rate have a stronger
dependence on V-ATPase activity.
5
March 2014 | Volume 9 | Issue 3 | e92594
V-ATPase Role in Adult Zebrafish Fin Regeneration
Figure 4. V-ATPase is not required for larval fin fold
regeneration. (A, B) Fin fold of 5 dpf atp6v1e1hi577aTg/- mutant larvae,
intact (A) or regenerated after amputation at 2 dpf (B). (C, D) Fin fold of
5 dpf AB wild type larvae, intact (C) or regenerated after amputation at
2 dpf (D). (E) Area of intact and regenerated fin fold by 5 dpf for either
genotypes (p.0.05). dpa: days post amputation. For each panel, n = 15.
doi:10.1371/journal.pone.0092594.g004
Figure 3. Vivo-morpholino mediated atp6v1e1b knockdown
impairs regeneration and decreases H+ flux. (A, B) H+ flux during
regeneration after vivo-MO mediated atp6v1e1b knockdown, 2 h after
proximal (A) and distal (B) amputation. *statistical significant results
(p,0.05). (C, D) Caudal fin regeneration after atp6v1e1b vivo-MO
delivery to atp6v1e1bhi577aTg/+ (AB) fish, 2 h after proximal amputation
(C) and 16 h after distal amputation (D). (C’, D’) Percentage of
regenerate area in atp6v1e1b knocked down regions compared to the
control vivo-MO (cVivo-MO). Vivo-MOs were delivered 2 h (C’) or 16 h
(D’) after both proximal and distal amputation. hpa: hours post
amputation. For each panel, n = 8.
doi:10.1371/journal.pone.0092594.g003
caudal appendages do not seem to operate through the same
mechanisms.
Blastema cell proliferation is reduced upon atp6v1e1b
knockdown
Reduced regeneration upon V-ATPase inhibition could be due
to increased cell death or decreased cell proliferation. To
investigate that, we knocked down atp6v1e1b in the caudal fin of
atp6v1e1bhi577aTg/+ (AB) fish by delivering vivo-MO at 2 hpa. Fins
were collected at different regeneration timepoints and immunostained for active-Caspase-3 and Phospho-Histone-3 (H3P),
apoptotic and proliferative markers respectively. Apoptosis was
similar in both control and treated fish, suggesting that reduced
regeneration is not due to increased apoptosis (File S4). As for
proliferation, 24 h after proximal amputation, most H3P-positive
cells in control fins were found in the intra-ray mesenchyme 1–2
ray segments below the proximal amputation plane, with only
occasional cells stained above the amputation plane (Fig. 5A);
whereas at 48 hpa, many proliferating cells had accumulated in
the mature blastema (Fig. 5B). Likewise, atp6v1e1b knockdown
didn’t affect the number or location of proliferating cells by 24 hpa
(Fig. 5C). However, at 48 hpa there were significantly less
blastema cells positive for H3P than in the control (less
40.1%611.58) (Fig. 5D, E). Similar results were found in distal
regenerates (File S5). These results show that V-ATPase is
required for normal cell proliferation in the blastema.
V-ATPase is not required for larval fin fold regeneration
The knockout of one V-ATPase subunit becomes lethal around
6 dpf [23], long enough to study the effects of the gene absence in
the larval fin fold regeneration. In fact, many evidences suggest
that regeneration of adult and larval caudal appendage follow
similar mechanisms [5][28]. Given that, we amputated the fin fold
of atp6v1e1hi577aTg/- mutants and AB WT fish at 2 dpf and the
regenerated area was compared with non-amputated fins of the
same genotype 3 days later. Intact mutants were underdeveloped
and had a smaller fin fold than the wild type (Fig. 4A, C, E). After
amputation, there were no additional phenotypic differences
between the two fish lines (Fig. 4B, D), and the regenerated fin fold
area was similar to the control, for either genotypes (Fig. 4E).
These results show a normal larval regeneration process in the
absence of V-ATPase activity, contrary to what was observed in
the adult caudal fin. Hence, regeneration of the adult and larval
PLOS ONE | www.plosone.org
6
March 2014 | Volume 9 | Issue 3 | e92594
V-ATPase Role in Adult Zebrafish Fin Regeneration
Figure 5. V-ATPase is required for blastema cell proliferation and expression of mkp3 and aldh1a2. (A–D) Immunohistochemical
detection of proliferating cells (H3P-positive) 24 h (A, C) and 48 h (B, D) after proximal amputation. (A, B) control fin; (C, D) V-ATPase knocked down
fin. (E) Quantification of H3P-positive cells in the blastema. *statistical significant results (p,0.05). (F–U) In situ hybridization for mkp3 (F-M) and
aldh1a2 (N-U), after proximal amputation (F, H, J, L; N, P, R, T) and distal amputation (G, I, K, M; O, Q, S, U): (F–G; N–O) control fin, 24 hpa; (H–I; P–Q) VATPase knocked down fin, 24 hpa; (J–K; R–S) control fin, 48 hpa; (L–M; T–U) V-ATPase knocked down fin, 48 hpa. Control fin: caudal fin from AB wild
type fish, non-treated. V-ATPase knockdown procedure: atp6v1e1b vivo-MO delivered to the caudal fin of atp6v1e1bhi577aTg/+ (AB) fish, 2 hpa. hpa:
hours post amputation. For each panel, n = 3.
doi:10.1371/journal.pone.0092594.g005
marker acetylated a-tubulin. 24 hours after the proximal amputation of non-treated controls, nerve axons extended mainly along
intra-ray regions, forming bundles parallel to the proximal-distal
axis of the fin. Actually, these bundles almost reached the
amputation plane, after an initial retraction from the stump that
typically occurs upon amputation (Fig. 6A). At 48 hpa, the control
stumps were innervated by axons sproutings (Fig. 6B). After VATPase knockdown, fins were less innervated at 24 hpa and axons
remained distant from the amputation plane (Fig. 6C). Later, at
48 hpa, axons were beginning to invade the regenerating tissue in
proximal stumps (Fig. 6D). Similar results were found in distal
regenerates (File S7). These results show that V-ATPase is
required for normal innervation of the regenerating fin.
V-ATPase is required for normal expression of aldh1a2
and mkp3
Cell proliferation during blastema formation is controlled by
several signalling pathways, including Fgf, Wnt/b-catenin and
Retinoic acid (RA). We assessed the link between V-ATPase and
these signalling pathways by comparing the expression of mkp3,
wnt10a and aldh1a2 during proximal and distal regeneration in
control fins (AB WT fish) and in atp6v1e1b knocked down fins
(vivo-MO delivered 2 hpa). In the controls, mkp3 and aldh1a2
expression domain was wider at proximal stumps, at both 24 and
48 hpa (Fig. 5 compare F–G; J–K; N–O; R–S). This pattern was
somewhat similar to what was observed for the V-ATPase. On the
contrary, in V-ATPase knocked down fins, aldh1a2 and mkp3 were
absent at 24 hpa at either amputation planes, demonstrating that
V-ATPase affects the expression of both genes (Fig. 5H–I; P–Q).
At 48 hpa, these transcripts’ expression was re-established, likely
as a consequence of the vivo-MO transient effect (Fig. 5L–M; T–
U). Expression of wnt10a remained unchanged in control and VATPase knocked down fins for all time points, in proximal and
distal stumps alike (File S6). These results show that V-ATPase is
required for the normal expression of at least aldh1a2 and mkp3,
establishing a molecular link between V-ATPase and two
important signalling pathways that control cell proliferation, Fgf
and RA.
Discussion
V-ATPase activity contributes to a regeneration-specific
H+ efflux that depends on the amputation position along
the proximal-distal axis
Our data showed that H+ efflux is specifically established during
appendage regeneration in an adult vertebrate. The efflux was first
detected several hours upon amputation, and it was present for at
least 5 days after wound closure. Previous reports in vertebrates
including humans have showed that regeneration is accompanied
by an endogenous electric current (EC) for several days after
wound healing [13][14][40], and this EC seems to be controlled
by the activity of specific ion transporters [14][17]. Since the
wound is already closed when an efflux is detected, we propose
that H+ efflux contributes to the regeneration-specific endogenous
EC, probably together with sodium flux, which is a crucial
V-ATPase inhibition affects fin innervation
Proper tissue innervation is another important factor for normal
fin regeneration [39]. As such, it was decided to test if any relation
to the H+ pump existed. For that, atp6v1e1b knocked down fins
(vivo-MO delivered 2 hpa) were immunostained for the axonal
PLOS ONE | www.plosone.org
7
March 2014 | Volume 9 | Issue 3 | e92594
V-ATPase Role in Adult Zebrafish Fin Regeneration
observations suggest that the V-ATPase has an active role in
regeneration and is involved in the formation of positiondependent cues.
V-ATPase is required for adequate nerve supply and
blastema cell proliferation and correlates with RA and Fgf
signalling
V-ATPase is ubiquitously expressed in eukaryotic cells and is
not only required for several housekeeping functions that depend
on pH or membrane potential. Additionally, it is strongly
upregulated in particular cell types where it is necessary for
specific processes such as bone formation/resorption and renal
acidification [42]. In the amputated adult zebrafish caudal fin, VATPase was upregulated in the regenerating tissue during
blastema formation and early regenerative outgrowth, and its
inhibitions impaired regeneration. Therefore, V-ATPase seems to
be required for the regenerative process in some role other than
housekeeping functions.
In the Xenopus tadpole tail, the V-ATPase-mediated H+
extrusion is necessary for cell proliferation in the blastema-like
regeneration bud [18]. Here, we show that V-ATPase inhibition
decreases regeneration by decreasing proliferation in the mature
blastema (48 hpa), but not during early blastema formation
(24 hpa). Interestingly, H+ efflux, mediated by ion transporters
such as sodium/proton exchanger 1 (NHE1) and V-ATPase, is a
major contributor for cell migration by promoting extracellular
matrix degradation [43][44]. As the blastema arises from intra-ray
cells that proliferate and migrate distally [3][4], V-ATPase could
be required for the migration of blastema-forming cells from the
intra-ray mesenchyme into the regenerating region.
An alternative view is that cells migrate to the blastema but
become unable to proliferate in the absence of V-ATPase. In fact,
V-ATPase has been associated to proliferation in other regeneration models [18][23]. Fgf signalling is required for cell
proliferation in the blastema but not in cell populations below
the amputation plane [38], and the same influence on cell
proliferation was found when V-ATPase activity was inhibited.
Besides, V-ATPase knockdown inhibited the expression of mkp3, a
target of Fgf signalling, demonstrating that this H+ pump interferes
with this signalling pathway. V-ATPase was also required for the
expression of aldh1a2, a key molecule for RA synthesis. It is known
that both RA and V-ATPase mediate cell survival by upregulating
bcl2 expression [45][46], so it would be interesting to investigate if
the two molecules act as part of a single, common pathway.
Importantly, it was recently demonstrated that RA and Fgf
signalling, together with Wnt/b-catenin, regulate each other in a
positive reciprocal manner and modulate the overall rate of
regeneration [47]. Considering this, V-ATPase seems to be
another component of this interconnected molecular net by
affecting RA and Fgf signalling in a direct or indirect manner.
Additionally, an effect of V-ATPase on other signalling pathways,
including Wnt/b-catenin, cannot be excluded. Although wnt10a
was not affect by the pump’s inhibition, it has been showed in
other systems that V-ATPase is required for Wnt/b-catenin
signalling downstream of Wnt ligand [24].
Inhibition of V-ATPase decreased the amount of axons in the
fin and inhibited axonal growth into the regenerating tissue. It is
possible that this hindered innervation was a direct result of the
decrease of V-ATPase mediated H+ efflux since it is known that
endogenous electric currents and associated electric fields can
control the amount of nerve sprouting and the direction of axonal
growth into the regenerating region in other models [47]. Besides,
in Xenopus froglet limb regeneration, nerve supply is not necessary
for blastema formation but is required for blastema outgrowth, by
Figure 6. V-ATPase inhibition affects fin innervation. Immunohistochemical detection of acetylated a-tubulin (axons marker) under
control regeneration conditions (A, B) and after atp6v1e1b knockdown,
2 h after proximal amputation (C, D). (A,C) 24 hpa, (B, D) 48 hpa. Arrow
heads: innervation of regenerating tissue. hpa: hours post amputation.
For each panel, n = 3.
doi:10.1371/journal.pone.0092594.g006
component of regeneration-specific EC, and other ions such as
potassium and chloride [13][14].
The molecular source of regeneration-specific ion fluxes has
only recently begun to be unveiled: the H+ pump V-ATPase and
the voltage-gated sodium channel NaV1.2 are essential for the
regeneration of Xenopus larvae tail [18][22], and the H+,K+ATPase is required for planarian head regeneration [19].
Nevertheless, evidence in other models for conservation of these
mechanisms, especially in adult vertebrate models, is still lacking.
In this work, we have showed for the first time that the V-ATPase
is upregulated in the regenerating tissue of the adult zebrafish
caudal fin. We took advantage of the fact that different
manipulations (eg. injection of drugs or morpholinos, amputation
planes) can be held on separate parts of one single fin to provide an
extra level of control to our experiments that could not be
examined in other models such as the Xenopus larval tail [18]. We
demonstrate that the onset and magnitude of V-ATPase expression varied with the amputation plane along the PD axis and H+
efflux followed a similar pattern. Besides, inhibition of this H+
pump after either proximal or distal amputation decreased H+
efflux. Thus, V-ATPase contributes to the regeneration-specific
H+ efflux in the adult zebrafish caudal fin.
In the atp6v1e1b knocked down fins, the H+ efflux decreased at
24 hpa but increased from 48 hpa onwards compared to the
control. This phenotype reversal probably reflects the decreasing
inhibitory effect of the MO with time [41]. Two interesting facts
were that the efflux increase at 48 and 72 hpa closely resembled
the control efflux level at 24 and 48 hpa respectively, and for each
time point, efflux intensity was always smaller in distal stumps than
in proximal ones. Taken together, our data shows that during
regeneration V-ATPase activity and the consequent H+ efflux are
tightly controlled at the genetic level in order to reach a specific
intensity that depends on the amputation position. These
PLOS ONE | www.plosone.org
8
March 2014 | Volume 9 | Issue 3 | e92594
V-ATPase Role in Adult Zebrafish Fin Regeneration
pronounced proximally, demonstrating that regions of higher
regeneration rate have stronger dependence on V-ATPase activity.
This suggests that H+ efflux triggers some important mechanism
that needs to be activated earlier in the highly proliferating
proximal wounds.
Overall, our results suggest that V-ATPase H+ pumping activity
is part of the signals that translate position into adequate cell
behaviour, including position-dependent proliferation rate. In this
way, V-ATPase has a role in positional memory system. We
propose that some unknown position-instructor signal upstream of
V-ATPase sets the level of expression for this H+ pump according
to the level of amputation along the PD axis. Then, localized VATPase H+ pumping activity in the blastema generates pH and/or
voltage domains within the regenerating tissue, that will act,
directly or indirectly (for example, via inhibition of nerve supply),
as positive regulators of RA and Fgf signalling, ultimately affecting
cell proliferation in the blastema. As V-ATPase gene expression is
activated earlier and more strongly in proximal stumps than in
distal ones, pH/voltage domains would be more intense and
maintained for a greater period of time after proximal amputation.
Consequently, V-ATPase activity would exert a stronger influence
on gene expression in proximal stumps than in distal ones,
including Retinoic Acid and Fgf signalling, ultimately setting a
higher regeneration rate in proximal amputated fins.
In 2007, a study from Adams et al. [18] demonstrated that the
V-ATPase is necessary for Xenopus tadpole tail regeneration. In the
present study, our findings further support that the V-ATPase is
important to adult vertebrate regeneration. Particularly, our
results indicate that the V-ATPase H+ pumping activity orchestrates with major molecular signalling pathways to control
position-dependent regeneration rate. Understanding of this and
other ion-driven mechanisms underlying adult regeneration may
open way for new therapeutic strategies, both in regenerative and
developmental medicine and in cancer therapy.
controlling cell proliferation, cell survival and expression of Fgf
signalling genes in the blastema [39]. Our results showed a similar
effect of V-ATPase on blastema cells. Taken all, V-ATPase effect
on blastema outgrowth may be mediated by nerve supply, though
independent routes for V-ATPase and nerve supply effects cannot
be excluded.
V-ATPase and its putative role in regeneration events
that depend on a blastema with specific proliferative
function
Although larval fin fold of atp6v1e1bhi577atg-/- zebrafish regenerated normally in the absence of V-ATPase activity, our results
clearly show that V-ATPase is required for regeneration in adult
fish appendages. In fact, despite the reported conservation of
molecular events during regeneration of adult fins and larval fin
fold [5][28], recent in vivo cell tracing experiments have showed
that the fin fold blastema does not have a specific function for
proliferation, and in that way it is not a classical blastema as
observed in the adult system [48]. Thus, regeneration of the adult
and larval caudal appendages in zebrafish are distinct processes.
On the other hand, some remarkable parallels have been observed
between regeneration of the adult zebrafish caudal fin and Xenopus
tadpole limb and tail buds [49], including conserved molecular
pathways and dependence on blastema-restricted cell proliferation. Particularly, our work and others [18] demonstrate that, in
both models, V-ATPase is required for adequate nerve supply and
cell proliferation in the blastema. Taken all, we propose that the
V-ATPase has a conserved role in regeneration events that depend
on a blastema with specific proliferative function.
V-ATPase: a novel component of the positional memory
transduction system
One important property of the blastema is positional memory,
which instructs both the amount and the rate of regeneration so
that the missing structures are replaced in the correct 3D pattern
and the process is completed simultaneously, regardless the level of
amputation along the PD axis [38][50]. Position-dependent
regeneration rate is regulated by the level of expression of several
molecules during regeneration [50]. In zebrafish, those include Fgf
signalling and msxb, which have enhanced proximal expression
compared to distally amputated fins [37][38]. RA is also a major
instructor of positional information in several vertebrates, but its
role in zebrafish appendage regeneration has proven difficult to
assess [51]. We showed that aldh1a2 has stronger proximal
expression compared to distal stumps, adding new evidence that
agree with a role for RA in positional memory in zebrafish.
Moreover, our results showed that V-ATPase and H+ efflux follow
a position-dependent pattern with increased proximal expression,
while other regeneration markers, such as wnt10a, maintain a
similar expression regardless the amputation level. Besides, VATPase knockdown decreased proliferation in the blastema and
inhibited aldh1a2 and mkp3 expression. Altogether, these data
agree with a role for the V-ATPase in position-dependent
regeneration rate, by affecting blastema proliferation through the
modulation of at least two essential signalling pathways, Fgf and
RA.
To further investigate the role of V-ATPase in positiondependent regeneration rate, we knocked down atp6v1e1b at
different time points after proximal and distal amputation. The
most dramatic regeneration reduction was obtained when the gene
knockdown approximated the different onset of H+ efflux at
proximal and distal positions, around 3 and 12 hpa, respectively.
In addition, the decrease in the regenerate area was more
PLOS ONE | www.plosone.org
Supporting Information
Table S1 Ion-specific electrodes optimized to measure
ion-specific flux in the adult zebrafish fin, using SIET.
(XLS)
Table S2 Ion-specific recording medium for SIETbased ion-specific flux measurement in the adult zebrafish fin.
(XLS)
Table S3 Sequence-specific primers for cloning of genespecific fragments for atp6v1e1b, atp6v1a, wnt10b, mkp3 and aldh1a2
by PCR amplification from zebrafish cDNA.
(XLS)
File S1 Ion-specific fluxes during caudal fin regeneration. SIET-mediated detection of potassium (K+, Figure A),
sodium (Na+, Figure B), calcium (Ca2+, Figure C) and chloride
(Cl-, Figure D) flux patterns at the ray and inter-ray regions,
during regeneration. For the four ion-species, there was a high
efflux upon amputation (0.08 hpa) that rapidly decreased as the
wound closed (6 hpa), becoming similar to intact fins (0 hpa) from
24 hpa.
(TIF)
File S2 V-ATPase subunits localization in chloride cells,
intact and regenerating fins. Whole mount in situ hybridization for atp6v1e1b (Figure A) and atp6v1a (Figure B) in intact fins.
Cross section of the whole mount in situ hybridization for atp6v1a at
24 hours post amputation (hpa) where expression can be observed
in the blastema, distal to the bone (Figure C, arrowheads).
9
March 2014 | Volume 9 | Issue 3 | e92594
V-ATPase Role in Adult Zebrafish Fin Regeneration
Atp6v1a in the intact caudal fin is present mainly in the epidermis,
in a scattered pattern (Figure D). Whole mount in situ
hybridization (Figure E) and immunostaining (Figure F) for
atp6v1a subunit in the chloride cells of the zebrafish embryo.
(TIF)
stronger/wider expression in proximal stumps than in distal ones,
both at 24 and 48 hpa under normal regeneration conditions
(compare Figures A and B, Figures E and F). This pattern
remained unchanged upon atp6v1e1b knockdown (compare Figures
C and D, Figures G and H).
(TIF)
File S3 Delivery of control and atp6v1e1b fluorescein-
tagged morpholinos. Merged fluorescent and bright field
image showing the incorporation of both control and atp6v1e1b
fluorescein-tagged morpholinos into opposite regions of a
regenerating fin, 24 h after delivery.
(TIF)
File S7 V-ATPase inhibition affects fin innervation after
distal amputation. Fins were immunostained for acetylated atubulin under normal regeneration conditions (control) and after
atp6v1e1b knockdown at 2 hpa. V-ATPase knockdown decreased
fin innervation both below the amputation plane and in the
regenerating tissue (compare Figures A–B with C–D, respectively).
(TIF)
V-ATPase inhibition does not affect apoptosis
during regeneration. atp6v1e1b knockdown didn’t affect cell
proliferation by 24 hpa compared to the control (compare Figures
A-A’ with B-B’).
(TIF)
File S4
Acknowledgments
The authors thank the Zebrafish International Resource Center for the
atp6v1e1hi577aTg (AB) zebrafish line, and Fish Facility technicians Maysa
Franco and Liliana Carvalho for support with animal care. We also thank
Alan Shipley (Applicable Electronics LLC, USA) for SIET technical
support and Moisés Mallo for reagents and scientific discussion.
File S5 V-ATPase is required for cell proliferation in the
mature blastema after amputation at the distal plane.
atp6v1e1b knockdown didn’t affect cell proliferation by 24 hpa
(compare Figures A and C; E). However, at 48 hpa there were
significantly less blastema cells positive for H3P than in the control
(compare Figures B and D; E).
(TIF)
Author Contributions
Conceived and designed the experiments: JJM RA JDB AJ ACC JRL.
Performed the experiments: JJM RA JDB ACC JRL. Analyzed the data:
JJM RA JDB AJ ACC JRL. Contributed reagents/materials/analysis tools:
JJM RA JDB AJ ACC JRL. Wrote the paper: JJM RA JDB AJ ACC JRL.
File S6 Expression of wnt10a is not affected by VATPase knockdown. In situ hybridization for wnt10a showed a
References
18. Adams DS, Masi A, Levin M (2007) H+ pump-dependent changes in membrane
voltage are an early mechanism necessary and sufficient to induce Xenopus tail
regeneration. Development 134(7): 1323–1335.
19. Beane WS, Adams DS, (2011) A chemical and genetics approach reveals H,KATPase- mediated membrane voltage is required for planarian head
regeneration. Chem Biol 18(1): 77–89.
20. Levin M (2007) Large-cale biophysics: ion flows and regeneration. Trends Cell
Biol 17(6): 261–270.
21. Sundelacruz S, Levin M, Kaplan DL (2009) Role of membrane potential in the
regulation of cell proliferation and differentiation. Stem Cell Rev 5(3): 231–246.
22. Tseng AS, Beane WS, Lemire JM, Masi A, Levin M (2010) Induction of
Vertebrate Regeneration by a Transient Sodium Current. J Neurosci 30(39):
13192–13200.
23. Nuckels RJ, Ng A, Darland T, Gross JM (2009) The Vacuolar-ATPase Complex
Regulates Retinoblast Proliferation and Survival, Photoreceptor Morphogenesis,
and Pigmentation in the Zebrafish Eye. Invest Ophthalmol Vis Sci 50(2): 893–
905.
24. Cruciat CM, Ohkawara B, Acebron SP, Karaulanov E, Reinhard C, et al.
(2010) Requirement of Prorenin Receptor and Vacuolar H+-ATPase–Mediated
Acidification for Wnt Signaling. Science 327(5964): 459–463.
25. Vaccari T, Duchi S, Cortese K, Tacchetti C, Bilder D (2010) The vacuolar
ATPase is required for physiological as well as pathological activation of the
Notch receptor. Development 137(11): 1825–1832.
26. Petzoldt AG, Gleixner EM, Fumagalli A, Vaccari T, Simons M (2013) Elevated
expression of the V-ATPase C subunit triggers JNK-dependent cell invasion and
overgrowth in a Drosophila epithelium. Dis Model Mech 6(3): 689–700.
27. Westerfield M (2000) The zebrafish book: A guide for the laboratory use of
zebrafish (Danio rerio). 4th ed, University of Oregon Press, Eugene, OR.
28. Kawakami A, Fukazawa T, Takeda H (2004) Early fin primordia of zebrafish
larvae regenerate by a similar growth control mechanism with adult
regeneration. Developmental Dynamics 231(4): 693–699.
29. Reid B, Zhao M (2011) Measurement of bioelectric current with a vibrating
probe. J Vis Exp 47: pii: 2358.
30. Shipley AM, Feijó JA (1999) The use of the vibrating probe technique to study
steady extracellular currents during pollen germination and tube growth. In:
Cresti M, Cai G, Moscatelli A editors. Fertilisation in Higher Plants: molecular
and cytological aspects. Springer-Verlag, Berlin, Heidelberg, NY pp. 235–250
31. Bjornsson CS, Huebner E (2004) Extracellular H+ dynamics during oogenesis in
Rhodnius prolixus ovarioles. J Exp Biol 207(Pt 16): 2835–2844.
32. Lin LY, Horng JL, Kunkel JG, Hwang PP (2006) Proton pump-rich cell secretes
acid in skin of zebrafish larvae. Am J Physiol Cell Physiol 290(2): C371–378.
33. Smith PJS, Hammar K, Porterfield DM, Sanger RH, Trimarchi JR (1999) Selfreferencing, non-invasive, ion selective electrode for single cell detection of
transplasma membrane calcium flux. Microsc Res Technique 46(6): 398–417.
1. Tal TL, Franzosa JA, Tanguay RL (2010) Molecular Signaling Networks That
Choreograph Epimorphic Fin Regeneration in Zebrafish – A mini-review.
Gerontology 56(2): 231–240.
2. Becerra J, Montes GS, Bexiga SR, Junqueira LC (1983) Structure of the tail fin
in teleosts. Cell Tissue Res 230(1): 127–137.
3. Poleo G, Brown CW, Laforest L, Akimenko MA (2001) Cell proliferation and
movement during early fin regeneration in zebrafish. Dev Dyn 221(4): 380–390.
4. Nechiporuk A, Keating MT (2002) A proliferation gradient between proximal
and msxb-expressing distal blastema directs zebrafish fin regeneration.
Development 129(11): 2607–2017.
5. Yoshinari N, Ishida T, Kudo A, Kawakami A (2009) Gene expression and
functional analysis of zebrafish larval fin fold regeneration. Dev Biol 325(1): 71–
81.
6. Tu S, Johnson SL (2011) Fate restriction in the growing and regenerating
zebrafish fin. Dev Cell 20(5): 725–732.
7. Knopf F, Hammond C, Chekuru A, Kurth T, Hans S, et al. (2011) Bone
Regenerates via Dedifferentiation of Osteoblasts in the Zebrafish Fin.
Developmental Cell 20(5): 713–724.
8. Sousa S, Afonso N, Bensimon-Brito A, Fonseca M, Simões M, et al. (2011)
Differentiated skeletal cells contribute to blastema formation during zebrafish fin
regeneration. Development 138(18): 3897–3905.
9. Stoick-Cooper CL, Moon RT, Weidinger G (2007) Advances in signaling in
vertebrate regeneration as a prelude to regenerative medicine. Genes Dev
21(11): 1292–1315.
10. Yoshinari N, Kawakami A (2011) Mature and juvenile tissue models of
regeneration in small fish species. Biol Bull 221(1): 62–78.
11. McCaig CD, Rajnicek AM, Song B, Zhao M (2005) Controlling cell behavior
electrically: current views and future potential. Physiol Rev 85(3): 943–978.
12. Zhao M (2009) Electrical fields in wound healing- An overriding signal that
directs cell migration. Semin Cell Dev Biol 20(6): 674–82.
13. Borgens RB, Vanable Jr JW, Jaffe LF (1977) Bioelectricity and regeneration:
large currents leave the stumps of regenerating newt limbs. Proc Natl Acad Sci
USA 74(10): 4528–4532.
14. Reid B, Song B, Zhao M (2009) Electric currents in Xenopus tadpole tail
regeneration. Dev Biol http://www.ncbi.nlm.nih.gov/pubmed/?term = Elec
tric+currents+in+Xenopus+tadpole+tail+regeneration335(1): 198–207.
15. Borgens RB, Vanable JW Jr, Jaffe LF (1979) Reduction of sodium dependent
stump currents disturbs urodele limb regeneration. J Exp Zool 209(3): 377–86.
16. Borgens RB, Roederer E, Cohen MJ (1981) Enhanced spinal cord regeneration
in lamprey by applied electric fields. Science 213(4508): 611–617.
17. Vieira AC, Reid B, Cao L, Mannis MJ, Schwab IR, et al. (2011) Ionic
Components of Electric Current at Rat Corneal Wounds. PLoS ONE 6(2):
e17411.
PLOS ONE | www.plosone.org
10
March 2014 | Volume 9 | Issue 3 | e92594
V-ATPase Role in Adult Zebrafish Fin Regeneration
43. Stock C, Gassner B, Hauck CR, Arnold H, Mally S, et al. (2005) Migration of
human melanoma cells depends on extracellular pH and Na+/H+ exchange.
J Physiol 567(Pt 1): 225–238.
44. Nishisho T, Hata K, Nakanishi M, Morita Y, Sun-Wada GH, et al. (2011) The
a3 isoform vacuolar type H+-ATPase promotes distant metastasis in the mouse
B16 melanoma cells. Mol Cancer Res 9(7): 845–855.
45. Blum N, Begemann G (2012) Retinoic acid signaling controls the formation,
proliferation and survival of the blastema during adult zebrafish fin regeneration.
Development 139(1): 107–116.
46. Sasazawa Y, Futamura Y, Tashiro E, Imoto M (2009) Vacuolar H+-ATPase
inhibitors overcome Bcl-xL-mediated chemoresistance through restoration of a
caspase-independent apoptotic pathway. Cancer Sci 100(8): 1460–1467.
47. Song B, Zhao M, Forrester J, McCaig C (2004) Nerve regeneration and wound
healing are stimulated and directed by an endogenous electrical field in vivo. J Cell
Sci 117(Pt 20): 4681–4690.
48. Mateus R, Pereira T, Sousa S, de Lima JE, Pascoal S, et al. (2012) In vivo Cell
and Tissue Dynamics Underlying Zebrafish Fin Fold Regeneration. PLoS ONE
7(12): e51766.
49. Lin G, Slack JM (2008) Requirement for Wnt and FGF signaling in Xenopus
tadpole tail regeneration. Dev Biol 316(2): 323–335.
50. Brockes JP, Kumar A (2005) Appendage regeneration in adult vertebrates and
implications for regenerative medicine. Science 310(5756): 1919–1923.
51. Blum N, Begemann G (2013) The roles of endogenous retinoid signaling in
organ and appendage regeneration. Cell Mol Life Sci Mar 12. [Epub ahead of
print]
34. Li C, Hung Wong W (2001) Model-based analysis of oligonucleotide arrays:
model validation, design issues and standard error application. Genome Biol 2:
RESEARCH0032
35. Henrique D, Adam J, Myat A, Chitnis A, Lewis J, Ish-Horowicz D (1995)
Expression of a Delta homologue in prospective neurons in the chick. Nature
375(6534): 787–790.
36. Hyde DR, Godwin AR, Thummel R (2012) In vivo electroporation of
morpholinos into the regenerating adult zebrafish tail fin. J Vis Exp (61). pii:
3632.
37. Akimenko MA, Johnson SL, Westerfield M, Ekker M (1995) Differential
induction of four msx homeobox genes during fin development and regeneration
in zebrafish. Development 121(2): 347–357.
38. Lee Y, Grill S, Sanchez A, Murphy-Ryan M, Poss KD (2005) Fgf signaling
instructs position-dependent growth rate during zebrafish fin regeneration.
Development 132(23): 5173–5183.
39. Suzuki M, Satoh A, Ide H, Tamura K (2005) Nerve-dependent and independent events in blastema formation during Xenopus froglet limb
regeneration. Dev Biol 286(1): 361–375.
40. Illingworth CM, Barker AT (1980) Measurement of electrical currents emerging
during the regeneration of amputated fingertips in children. Clin Phys Physiol
Meas 1: 87–89.
41. Bill BR, Petzold AM, Clark KJ, Schimmenti LA, Ekker SC (2009) A primer for
morpholino use in zebrafish. Zebrafish 6(1): 69–77.
42. Forgac M (2007) Vacuolar ATPases: rotary proton pumps in physiology and
pathophysiology. Nat Rev Mol Cell Biol 8(11): 917–929.
PLOS ONE | www.plosone.org
11
March 2014 | Volume 9 | Issue 3 | e92594
Baixar

Dissecting the Biophysical Mechanisms Underlying Regeneration of