UNIVERSIDADE FEDERAL DE PELOTAS
Programa de Pós-Graduação em Parasitologia
Tese
Expressão da proteína NcSRS2 de Neospora caninum em
Pichia pastoris e sua utilização no desenvolvimento de
imunobiológico
Amanda Fernandes Pinheiro
Pelotas, 2013
1
AMANDA FERNANDES PINHEIRO
Expressão da proteína NcSRS2 de Neospora caninum em Pichia pastoris e sua
utilização no desenvolvimento de imunobiológico caninum em Pichia
pastoris e sua utilização no desenvolvimento d
Tese apresentada ao Programa de PósGraduação
em
Parasitologia
da
Universidade Federal de Pelotas, como
requisito parcial à obtenção do Título de
Doutor em Ciências Biológicas (área do
conhecimento: Parasitologia).
Orientação: Prof. Dr. Fábio Pereira Leivas Leite
Co-Orientação: Prof. Dra. Sibele Borsuk
Pelotas, 2013
Dados de catalogação na fonte:
Ubirajara Buddin Cruz – CRB-10/901
Biblioteca de Ciência & Tecnologia - UFPel
P654e
Pinheiro, Amanda Fernandes
Expressão da proteína NcSRS2 de Neospora caninum em
Pichia pastoris e sua utilização no desenvolvimento de imunobiológico / Amanda Fernandes Pinheiro. – 65f. : il. – Tese
(Doutorado). Programa de Pós-Graduação em Parasitologia.
Universidade Federal de Pelotas. Instituto de Biologia. Departamento de Microbiologia e Parasitologia. Pelotas, 2013. –
Orientador Fabio Pereira Leivas Leite ; co-orientador Sibele
Borsuk.
1.Parasitologia. 2.Neospora caninum. 3.Pichia pastoris.
4.ELISA-NcSRS2. 5.IFI. 6.Vacina. I.Leite, Fabio Pereira Leivas. II.Borsuk, Sibele. III.Título.
CDD: 614.56
2
Banca Examinadora
Prof. Dr. Fábio Pereira Leivas Leite
Prof. Dra. Maria Elizabeth Aires Berne
Prof. Dra. Sibele Borsuk
Prof. Dr. Leandro Nizoli
Prof. Dr. Marcelo de Lima
3
Agradecimentos
Uma tese de Doutorado é uma longa viagem, com muitos percalços pelo
caminho. Este trabalho não teria sido possível sem a ajuda de muitas pessoas às
quais agradeço o apoio dado:
Em primeiro agradeço a Deus. Ele esteve sempre ao meu lado durante esta
caminhada, muitas vezes o caminho tornou-se tortuoso e pensei em desistir. Porém,
Ele me deu duas características que estão inseridas em minha alma: persistência e
determinação!
Agradeço aos meus pais, Wilton Rodrigues Pinheiro e Maria da Graça
Fernandes Pinheiro, que mesmo distantes, estiveram sempre comigo acreditando
em meu potencial. Eu amo vocês!
Obrigada a todos os meus familiares e aos meus amigos, que entenderam
(às vezes nem tanto) a minha ausência em muitas (quase todas) datas
comemorativas.
Muito obrigada ao meu orientador e Professor Doutor Fábio Pereira Leivas
Leite por acreditar em mim, por me incentivar e apoiar sempre que precisei. Ainda
no âmbito acadêmico, devo agradecer a Professora Doutora Sibele Borsuk, um
exemplo que sempre levarei comigo, como pessoa e como profissional. Agradeço ao
Professor Doutor José Alexandre Cameira Leitão por me receber tão bem em seu
grupo de pesquisa no exterior.
Agradeço a Universidade Federal de Pelotas e a Universidade Técnica de
Lisboa pela oportunidade de realizar um Curso de Pós-Graduação de qualidade.
Estendo esse agradecimento a CAPES pelo apoio financeiro fornecido para
realização das minhas pesquisas nestas Instituições.
Por fim, agradeço ao Programa de Pós-Graduação em Parasitologia e a
todos os professores do Departamento de Microbiologia e Parasitologia que lutam
por uma educação digna e ensino de qualidade.
Divido com todos vocês mais uma etapa de minha vida.
Muito Obrigada!
4
“Cada sonho que você deixa para trás é um pedaço do seu futuro que deixa de
existir”
(Steve Jobs)
5
Resumo
PINHEIRO, Amanda Fernandes. Expressão da proteína NcSRS2 de Neospora
caninum em Pichia pastoris e sua utilização no desenvolvimento de
imunobiológico. 2013. 65f. Tese (Doutorado) - Programa de Pós-graduação em
Parasitologia. Universidade Federal de Pelotas, Pelotas, RS.
A neosporose é uma enfermidade causada pelo protozoário intracelular Neospora
caninum. Esta é de grande importância principalmente em bovinos, pois pode
ocasionar abortos nos animais infectados, causando grandes perdas econômicas
para indústria pecuária de vários países do mundo, o que justifica a utilização de
estratégias profiláticas. O presente estudo, teve como objetivos expressar, purificar e
caracterizar a proteína NcSRS2 de N. caninum na levedura metilotrófica Pichia
pastoris. O gene ncsrs2 truncado foi clonado no vetor de expressão pPICZαB
seguindo de integração no genoma da levedura P.pastoris. A proteína recombinante
NcSRS2 foi confirmada no sobrenadante da cultura onde posteriormente foi
concentrada e purificada. Um ensaio imunoenzimático indireto (ELISA) foi
desenvolvido utilizando soros negativos e positivos de bovinos, ovinos e cães
naturalmente infectados por N. caninum e os resultados foram comparados com a
imunofluorescência indireta (IFI). Este estudo também avaliou a imunidade humoral
e celular desenvolvida pela vacinação de camundongos com a proteína NcSRS2r
associada a adjuvantes e analisada a expressão das seguintes citocinas: IL-4, IL-10,
IL-12, IFNγ e TNFα pelo método quantitativo da reação em cadeia da polimerase
(qPCR). Os dados sugerem que a vacina contendo o polisacarideo xantana como
adjuvante induziu uma resposta por linfócitos Th2 enquanto que a vacina com
hidróxido de alumínio induziu uma resposta modulada por linfócitos Th1. Este
trabalho demonstrou que a proteína recombinante apresentou as características
antigênicas e imunogênicas similares a da proteína nativa o que permitiu o seu
reconhecimento por soros de diferentes espécies de animais com neosporose como
também estimulou a resposta imunológica em camundongos vacinados com esta.
Palavras chaves: Neospora caninum; Pichia pastoris; ELISA-NcSRS2; IFI; Vacina
6
Abstract
PINHEIRO, Amanda Fernandes. Expression of Neospora caninum NcSRS2
protein in Pichia pastoris and its application as immunobiological..2013. 65f.
Tese (Doutorado) - Programa de Pós-graduação em Parasitologia. Universidade
Federal de Pelotas, Pelotas, RS.
The neosporosis is a disease caused by the intracellular protozoan Neospora
caninum. This is of importance especially in cattle, because it may cause abortions in
infected animals, causing important economic losses to the cattle industry of various
countries of the world, which justifies the application of prophylactic strategies. In the
present study, we report the expression, purification and characterization of protein
NcSRS2 of N. caninum in methylotrophic yeast Pichia pastoris, this protein is a
potential target for the development of diagnostic tests and vaccines. The truncated
ncsrs2 gene was cloned into the expression vector pPICZαB following integration into
the yeast genome. The recombinant protein NcSRS2 was demonstrated in the
culture supernatant which was subsequently concentrated and purified. Enzymelinked immunosorbent assay (ELISA) was developed using positive and negative
sera from cattle, sheep and dogs naturally infected by N. caninum and the results
were compared with indirect immunofluorescence (IFI). This study also evaluated the
cellular immunity developed by immunizing mice with the protein NcSRS2 associated
with adjuvants and evaluated the production the following cytokines: IL-4, IL-10, IL12, IFNγ e TNFα. The data suggest that a vaccine containing xanthan adjuvant
induced a Th2 response whereas the vaccine with aluminum hydroxide induced a
Th1 cell response. This study demonstrated that the recombinant protein presented
antigenic and immunogenic characteristics similar to the native protein which allowed
its recognition by sera from different animal species with neosporosis as well as
stimulated the immune response in mice immunized with this.
Key words: Neospora caninum; Pichia pastoris; ELISA-NcSRS2; IFI; Vaccine
7
Abreviações e Siglas
AOX
Álcool Oxidase
O.D.
Densidade óptica
ELISA
Ensaio Imunoenzimático (Enzyme Linked Immuno Sorbent
Assay)
IBGE
Instituto Brasileiro de Geografia e Estatística
IFI
Imunofluorescência Indireta
IFN-γ
Interferon gamma
IgG
Imunoglobulina G
IL
Interleucina, Citocina, (Interleukin)
NcSRS2
Antígeno de superfície de Neospora caninum
SNC
Sistema Nervoso Central
8
Sumário
1 Introdução geral ................................................................................................... 09
2 Objetivo geral ....................................................................................................... 14
2.1 Objetivos específicos........................................................................................ 14
2 Artigo 1 .................................................................................................................. 15
3 Manuscrito 1 ......................................................................................................... 16
The use of ELISA based on NcSRS2 of Neospora caninum expressed in Pichia
pastoris for diagnosis of neosporosis in sheep and dogs .......................................... 17
Abstract ..................................................................................................................... 18
Introduction................................................................................................................ 19
Methods .................................................................................................................... 20
Results ...................................................................................................................... 23
Discussion ................................................................................................................. 24
Acknowledgements ................................................................................................... 27
References ................................................................................................................ 28
4 Manuscrito 2 ......................................................................................................... 37
Immune modulation of recombinant NCSRS2 protein of Neospora caninum by
different adjuvants ..................................................................................................... 38
Abstract ..................................................................................................................... 39
Introduction................................................................................................................ 40
Methods .................................................................................................................... 41
Results ...................................................................................................................... 44
Discussion ................................................................................................................. 45
Acknowledgements ................................................................................................... 48
References ................................................................................................................ 48
5 Conclusões ........................................................................................................... 57
6 Referências ........................................................................................................... 58
9
1 Introdução Geral
A neosporose, causada pelo protozoário Neospora caninum, é uma
enfermidade de importância global que pode infectar uma série de hospedeiros de
interesse produtivo, incluindo os ruminantes. É de grande importâcia principalmente
nos rebanhos bovinos devido aos custos associados aos abortos, aumento no
número de descarte de vacas e diminuição na produção de leite, causando perdas
econômicas para a indústria pecuária (BASSO et al., 2010). O Brasil é referência na
agropecuária mundial, com um dos maiores rebanhos bovinos, constituído por quase
210 milhões de cabeças no ano de 2010 (IBGE, 2012). As regiões Centro-Oeste e
Sul do Brasil destacam-se na produção de carne bovina e o Rio Grande do Sul, além
de contribuir significativamente para a exportação de carne, é considerado um dos
principais estados produtores de leite do país, juntamente com os Estados de Minas
Gerais, Goiás e Paraná (AGRONEGÓCIO BRASILEIRO, 2010).
Bovinos podem infectar-se por via transplacentária (transmissão endógena),
esta pode ocorrer ao longo de sucessivas gestações perpetuando a infecção no
rebanho (TREES; WILLIANS et al., 2005). Estes animais jovens são clinicamente
normais, soropositivos e abrigam o parasito encistado em vários tecidos, sendo
muito importantes na epidemiologia da enfermidade (YILDZ et al., 2009). Este modo
de infecção também foi observado em outras espécies como ovinos, caprinos e
equinos (TREES; WILLIANS et al., 2005). A transmissão horizontal ou exógena,
ocorre através da ingestão dos oocistos esporulados presentes em pastagens,
silagem, cochos ou bebedouros contaminados por fezes de cães infectados criados
juntamente com o rebanho (BASSO et al., 2010). N. caninum tem sido encontrado
parasitando uma ampla variedade de tecidos como cérebro, medula espinhal,
coração, pulmão, fígado, rins, placenta e músculos. Os animais mais suscetíveis à
infecção são os bovinos e a principal sintomatologia é o aborto, porém pode ocorrer
também o nascimento de animais doentes com sintomas neurológicos (BASSO et
al., 2010).
10
No Brasil o diagnóstico da neosporose não é realizado rotineiramente em
casos de aborto. Isto ocorre por falta de conhecimento do agente e da sua
prevalência nos rebanhos brasileiros, o elevado custo do diagnóstico é devido ao
difícil isolamento do agente e sua manutenção em laboratório (ANDREOTTI et al.,
2003).
Sendo considerado um problema para o setor pecuário, devido ao impacto
econômico gerado, vários testes diagnósticos e vacinas estão sendo desenvolvidos
e aperfeiçoados (ANDREOTTI et al., 2003). Estudos têm sido desenvolvidos para
identificar e caracterizar os componentes moleculares antigênicos e imunogênicos
específicos de N. caninum com o objetivo de melhorar o diagnóstico sorológico e o
resultado das vacinas disponíveis comercialmente, aumentando os conhecimentos
relacionados com a biologia celular e sua interação com o hospedeiro (ROJOMONTEJO et al., 2009).
A Imunofluorescência indireta (IFI) foi o primeiro teste diagnóstico sorológico
desenvolvido para a pesquisa de anticorpos anti-N. caninum e vem sendo utilizada
como referência para o desenvolvimento de outros testes sorológicos por utilizar os
antígenos intactos de superfície do protozoário (WAPENAAR et al., 2007). As
vacinas disponíveis para o uso nos rebanhos bovinos utilizam taquizoítos inativados
caracterizando-se por produzir imunidade baixa e de curta duração (MOORE et al.,
2011). Pesquisas sugerem que os antígenos mais específicos das espécies do filo
Apicomplexa, que compreende o gênero Neospora, encontram-se na superfície
celular, e testes sorológicos assim como as vacinas que possuem como alvo estes
antígenos apresentam maior potencial (BJORKMAN & UGGLA, 1999). A análise
sequencial do DNA do protozoário N. caninum tem possibilitado a descoberta de
novas proteínas envolvidas em diferentes fases do processo de infecção e que são
fortes candidatos ao desenvolvimento da vacina ou de novos testes para o
diagnóstico, como: NcSRS2, NcROP2, NcSAG1, NcMIC3. Dentre estas, nosso
grupo de pesquisa tem avaliado o potencial da proteína de membrana externa, a
NcSRS2.
Nesta perspectiva, a NcSRS2 também chamada de Nc-p43 é uma proteína
de superfície imunodominante presente em todos os estágios do parasito. Em 2001,
foi determinado um domínio antigênico localizado na região C-terminal, envolvendo
aminoácidos do segundo e terceiro terço do polipeptídeo (SON et al., 2001). Foi
11
confirmada a ausência de reações inespecíficas com antígenos de Toxoplasma
gondii e também determinada a localização subcelular da proteína através da IFI e
imunoeletromicroscopia com partículas de ouro, após a purificação de anticorpos
específicos contra a NcSRS2 (SONDA et al., 1998). Em outro estudo, a proteína
NcSRS2 foi utilizada para a padronização de um ELISA indireto em que este
mostrou não haver reações cruzadas com T. gondii, como também se mostrou
específica para N. caninum frente a soros positivos para Sacocystis spp,
Cryptosporidium parvum, Eimeria bovis, Babesia divergens (SHARES et al., 2000).
Testes ELISA utilizando baculovírus como sistema de expressão da proteína
NcSRS2 também foi testado para sorodiagnóstico da neosporose (NISHIKAWA et
al., 2002). Borsuk et al., 2010 desenvolveu um teste ELISA com a proteína NcSRS2
expressa na bactéria Escherichia coli, este apresentou resultados satisfatórios de
sensibilidade e especificidade para o diagnóstico de N. caninum em bovinos
superiores ao de IFI. Pinheiro et al., 2013 demonstrou, pela primeira vez, a
expressão com êxito em sistema eucarioto da proteína NcSRS2 na levedura
metilotrófica P. pastoris, mostrando que as propriedades antigênicas da proteína
nativa são conservadas na proteína recombinante e o ELISA desenvolvido
apresentou resultados de especificidade e sensibilidade satisfatórios.
O papel dos anticorpos na neosporose não esta suficientemente esclarecido.
Acredita-se que atuem em taquizoítos situados extracelularmente (INNES et al.,
2002). Uma resposta de anticorpos IgG2 anti-N. caninum, foi encontrada em bovinos
infectados experimentalmente (WILLIANS et al., 2000). Estudos mostram que tanto
a imunidade inata quanto a adquirida está envolvida na resistência a neosporose
(NISHIKAWA et al., 2003).
Durante a gestação a resposta imune se caracteriza de diferentes formas
dependendo do estágio gestacional. Na fase inicial da gestação ocorre uma resposta
imune ineficaz do feto, porém a mãe é capaz de gerar uma resposta imune celular
proliferativa com produção de IFN-γ em resposta aos antígenos (INNES et al., 2002).
No terço médio inicia uma resposta imune do tipo Th2 proveniente da presença do
feto e da placenta, favorecendo a comunicação do feto com sua mãe (INNES et al.,
2002). No terço final o feto já apresenta certa maturidade do sistema imunológico e
por isso, dificilmente a infecção provoca o aborto. Estudos sugerem que uma
resposta Th1 compromete a gestação, enquanto uma resposta Th2 localizada pode
12
favorecê-la (INNES et al., 2005). Sendo N. caninum um protozoário intracelular
obrigatório, a resposta imune mediada por células desempenha um importante papel
frente à infecção.
A proteína NcSRS2 por estar presente na superfície dos taquizoítos e
bradizoítos desempenha importante papel na interação parasita-hospedeiro e está
envolvida nos processos de adesão e invasão à célula hospedeira (HEMPHILL;
GOTTSTEIN, 1996). Esta proteína tem sido descrita como um antígeno potencial
para o desenvolvimento de uma vacina recombinante. O potencial protetor da
proteína imunodominante NcSRS2 foi descrito por Hemphill et al., (1997). A
imunização com vetor vírico mostrou reduzir a infecção em camundongos não
gestantes e preveniu a transmissão transplacentária em animais gestantes
(NISHIKAWA et al., 2001). A redução da transmissão transplacentária em bovinos
também foi demosntrada com a proteína NcSRS2 nativa purificada em coluna de
afinidade (HALDORSON et al., 2005). Em bovinos experimentalmente infectados a
NcSRS2 induziu a ativação de linfócitos T de memória CD4+ e CD8+ (STASKA et
al., 2005). Desta forma a NcSRS2 é uma forte candidata a antígeno em estudos de
vacina contra a neosporose.
Vários estudos estão sendo realizados no sentido de utilizar leveduras para
a produção de proteínas recombinantes, quando o interesse é produzir proteínas de
organismos eucariotos, estas se destacam como plataformas de expressão
heteróloga alternativas (CEREGHINO et al., 2000). Pichia pastoris mostra-se muito
eficiente para a síntese e expressão de proteínas heterólogas para aplicações
acadêmicas e industriais (COS et al., 2005). A utilização desta plataforma oferece
vantagens sobre os sistemas de expressão em procariotos, destacando a alta
multiplicação em meios de cultura relativamente simples, possibilidade de expandir a
produção para escalas industriais, bem como, a presença neste sistema de um forte
promotor induzível com metanol (DALY et al., 2006). Este sistema eucarioto
apresenta o promotor AOX1 que codifica a enzima álcool oxidase que é reprimido
em cultura contendo glicerol e induzido quando as células são transferidas para um
meio contendo metanol como única fonte de carbono (BOETTNER et al., 2002). Este
sistema apresenta também um segundo promotor funcional para a enzima álcool
oxidase, o gene AOX2 que codifica uma proteína que é 97% idêntica e tem a mesma
atividade especifica do AOX1. A aquisição de altas concentrações de proteínas
13
heterólogas no sobrenadante da cultura depende também da estabilidade da
proteína as condições ambientais como sua resistência a ação das proteases, além
disso, há a possibilidade de secreção de proteínas heterólogas de forma solúvel no
meio, o que simplifica as etapas de purificação (CHOI et al., 2005). Até o presente
momento, não existem relatos na literatura da avaliação do potencial imunogênico e
antigênico de proteínas recombinantes de N. caninum produzidas na levedura P.
pastoris.
A hipótese deste estudo é que a proteína expressa em P. pastoris
apresentará as características antigênicas e imunogênicas similares a proteína
nativa.
Os dados gerados nesta tese estão apresentados na forma de artigos
científicos. Neste contexto, o artigo 1 trata do processo de clonagem e expressão da
proteína NcSRS2 em sistema eucarioto. Este trabalho foi publicado no periódico
Pathogens and Global Health. O manuscrito 1 relata a utilização da proteína
rNcSRS2 como antígeno no desenvolvimento de imunodiagnóstico (ELISA indireto)
para neosporse em duas espécies animais estudadas: ovino e canino. Como
prosseguimento deste estudo, avaliamos o potencial imunogênico da proteína
NcSRS2r produzida em P. pastoris. Neste estudo, avaliamos o efeito dos adjuvantes
na modulação da resposta imune utilizando a proteína NcSRS2r. Este trabalho
originou o manuscrito 2.
14
2 Objetivo Geral:
Produzir a proteína de N. caninum, NcSRS2, utilizando P. pastoris como sistema de
expressão e avaliar sua utilização no desenvolvimento de imunodiagnóstico e como
antígeno vacinal.
2.1 Objetivos específicos:
1. Clonar o gene ncrsr2 no plasmídeo pPICZαB de expressão em P. pastoris;
2. Expressar e purificar a proteína NcSRS2;
3. Realizar análises imunológicas para a confirmação da proteína NcSRS2r;
4. Avaliar o potencial antigênico e imunogênico da proteína produzida em sistema
eucarioto.
15
2. ARTIGO 1
Expression of Neospora caninum NcSRS2 surface protein in Pichia
pastoris and its application for serodiagnosis of Neospora infection
(Artigo publicado no periódico Pathogens and Global Health)
Expression of Neospora caninum NcSRS2
surface protein in Pichia pastoris and its
application for serodiagnosis of Neospora
infection
Amanda Fernandes Pinheiro, Sibele Borsuk, Maria Elisabeth Aires Berne,
Luciano da Silva Pinto, Renato Andreotti, Talita Roos, Barbara Couto Rollof,
Fábio Pereira Leivas Leite
Universidade Federal de Pelotas, Pelotas, Rio Grande do Sul, Brazil
Published by Maney Publishing (c) W S Maney & Son Ltd
Neospora caninum is considerd a major cause of abortion in cattle worldwide. The antigenic domain of
NcSRS2 in N. caninum is an important surface antigen present in the membrane of this parasite. In the
present study, the Pichia pastoris expression system proved to be a useful tool for the production of
recombinant protein. The truncated NcSRS2 gene (by removal of the N-terminal hydrophobic sequence),
was cloned in the vector pPICZalphaB, and integrated on the genome of the methylotrophic yeast P.
pastoris. Subsequently, the NcSRS2 protein was expressed, purified, and characterized using naturally
infected cattle sera and Mab 6xhistag. The recombinant protein NcSRS2 was present in the supernatant of
the culture, where later it was concentrated and purified using ammonium sulfate (y100 mg/ml). An
indirect immunoenzymatic assay (ELISA) was performed using cattle sera from endemic N. caninum area.
Keywords: NcSRS2, Pichia pastoris, Expression
Introduction
Neospora caninum is the causative agent of neosporosis. The economic importance of N. caninum infections in
cattle is attributed to abortion costs of increased animal
disposals,1 and decreasing milk production.2 Worldwide,
Brazil has the second largest cattle herd and is the largest
beef exporter.3 Yet, the country still has major economic
losses related to livestock diseases, which can affect
weight gain, reproductive rate, or even cause loss of the
animal. Losses of this type are not insignificant reaching
an index of up to 27.34% in the state of Mato Grosso do
Sul, which concentrates the majority of the total national
cattle herd.4 While Neosporosis is important for these
losses economically, there are few studies about the
actual impact of the disease in Brazilian herds.
NcSRS2 is an immunodominant surface protein
present in bradyzoites and tachyzoites of N. caninum.5,6
It has potential for use in specific serological diagnoses of
neosporosis. The antigenic domain of the protein
NcSRS2 has been determined and is localized in the Cterminal 2/3 parts.7 The protein has also been expressed
using prokaryotic systems in several studies;8–10 however,
Escherichia coli, which is used extensively as a host for
Correspondence to: Sibele Borsuk, Universidade Federal de Pelotas,
Pelotas, Rio Grande do Sul, Brazil. Email: [email protected]
116
ß W. S. Maney & Son Ltd 2013
DOI 10.1179/2047773213Y.0000000082
heterologous recombinant protein expression, has limitations that include yield, folding, and post-translational
modifications.11,12
The methylotrophic yeast, Pichia pastoris has been
used effectively for expression of heterologous
proteins.13 The main characteristics of protein
production with P. pastoris are its capacity to
promote post-translation modifications, and its secretion of heterologous proteins in soluble form.14 The
use of this yeast gives advantages over prokaryotic
expression systems, which include easy genetic
manipulation and fast growth in relatively simple
culture media, allowing for expansion into large-scale
protein production.15,16 In addition, it is well known
that this eukaryotic system preserves characteristics
of the recombinant antigen, e.g. glycosylation, that
might be important in its recognition by the immune
system. As such, this platform was chosen for
production of a recombinant N. caninum antigen.
Materials and Methods
Cattle sera
The cattle sera used came from beef cattle breeding
region of Brazil, and the main breed is Bos Taurus.
The peripheral blood was collected from the jugular
vein of adult bovine, using a 19 g needle attached to
Pathogens and Global Health
2013
VOL .
107
NO .
3
Pinheiro et al.
Vacutainer tubes (Becton-Dickinson, Rutherford,
NJ, USA) and stored at –20uC until use. The sera
was confirmed as positive or negative by IFAT using
the method previously described.17,18
Published by Maney Publishing (c) W S Maney & Son Ltd
Bacterial strains and growth conditions
Neospora caninum isolate NC-115 was used to prepare
the antigen for this study. The parasite was propagated in Vero cells using Dulbecco’s modified
essential medium supplemented with 10% fetal calf
serum (FCS), at 37uC in a humidified atmosphere of
5% CO2 in air. When 80% of the Vero cells had been
destroyed by the tachyzoites, the monolayer cells
were removed and washed twice with phosphatebuffered saline (PBS) solution at 10006g centrifugation for 10 minutes.
E. coli strain TOP10 (Invitrogen was grown in
Luria-Bertani medium (1% tryptone, 0.5% yeast
extract, 0.5% NaCl, and 2% agar) at 37uC with the
addition of zeocin at 25 mg/ml. P. pastoris strain X33
(Invitrogen, Carlsbad, CA, USA) was grown in yeast
extract peptone dextrose medium (1% yeast extract,
2% peptone, and 2% D-glucose) supplemented with
100 mg/ml of zeocin at 28uC.
Cloning NcSRS2
The C-terminal DNA sequences coding for the
NcSRS2 gene (Genbank accession no. JQ410454.1)
were amplified by PCR using primers F5’- CGG
AAT TCC CAA AGA GTG GGT GAC TGG AAC
and R5’- GCT CTA GAC ATG CAT CTC CTC
TTA ACA CGG G. The PCR product was cleaved
with EcoRI and XbaI before in-frame ligation of the
fragment to the pPICZalphaB vector (Invitrogen),
which had been previously digested with the same
enzymes. The ligation reaction was transformed into
E. coli TOP10 competent cells. The pPICZalphaB/
NcSRS2 was propagated in E. coli TOP10, and the
plasmids isolated using GFXTM PCR DNA and Gel
Band Purification Kit (GE Healthcare Life Sciences,
Salt Lake City, Utah, USA). The identity of the
inserts was determined by DNA sequencing using the
DYEnamic ET Dye Terminator Cycle Sequencing
Kit for MegaBACE DNA analysis systems —
MegaBACE 500 (GE Healthcare).
The recombinant plasmid (pPICZalphaB/NcSRS2)
was linearized with PmeI enzyme (New England
BioLabs, Ipswich, MA, USA). The linear plasmid
DNA was then purified by phenol-chloroform
extraction, and P. pastoris competent cells were
transformed by electroporation (25 mFD, 200 Ohms,
and 2.0 kV) with 10 mg of the linear plasmid DNA.
Screening for expression of recombinant NcSRS2
Approximately 100 colonies were plated onto buffered
methanol complex medium (BMMY: 1% yeast extract,
2% peptone, 1.34% yeast nitrogen base, 0.00004% biotin,
0.5% methanol, 100 mM potassium phosphate, and 2%
Expression of NcSRS2 protein in Pichia pastoris
agar; pH 6.0). After 48 hours of incubation at 28uC,
expression of NcSRS2 was induced with 1% methanol
and evaluated at 48 hours. Expression of the recombinant protein was confirmed by colony blotting. Briefly,
a nitrocellulose membrane (Hybond ECL; GE
Healthcare) was placed on the surface of each Petri dish,
and in direct contact with the colonies for 1 hour at
28uC. Any adherent matter was removed from the
membrane by washing with PBS-T [PBS, pH 7.4, 0.05%
(v/v) Tween 20]. After blocking (PBS-T, 5% non-fat
dried milk), the membrane was incubated for 1 hour at
room temperature with anti-His-6X tag (Sigma Aldrich,
St. Louis, MO, USA), and diluted at 1 : 10 000 with PBS
containing 5% skimmed milk (PBS-SM) at room
temperature for 1 hour. The membrane was washed
three times with PBS-T for 5 minutes each, and
incubated with horseradish peroxidase-conjugated antimouse IgG (Sigma Aldrich), diluted at 1 : 5000 with PBSSM at room temperature for 1 hour. The reacting bands
were revealed using 3,3’-diaminobenzidine and H2O2.
The presence of the ncsrs2 gene in the P. pastoris
genome was confirmed by colony PCR. Crude
genomic DNA extracts were prepared by boiling
selected recombinant yeast clones in water. PCR was
performed (similarly to the primers described above)
using the crude genomic DNA extracts as the
template. The PCR products were analyzed by
horizontal gel electrophoresis and visualized with
GelRed (Biotium, Hayward, CA, USA).
Expression of NcSRS2 protein in P. pastoris X33
A recombinant clone (positive by dot blotting and by
colony PCR) was selected and inoculated into a 3 l
baffled fermenter containing 1 l of BMMY broth.
The culture was incubated at 28uC, for approximately
48 hours until an OD600 of 2–6 was reached.
Expression was induced by the addition of methanol
at a 1% final concentration. Samples (supernatant
and cells) were collected at the following times: 24,
48, 72, 96, 120, and 144 hours. Finally, the media
were harvested at 10 0006g for 10 minutes, and the
supernatant was stored at 270uC. The expression of
the recombinant protein was analyzed by dot blotting
using the anti-hisx6tagMab (Sigma).
Purification and concentration of rNcSRS2
The secreted NcSRS2 recombinant protein was
concentrated and purified by precipitation using a
20% ammonium sulfate saturation that was added to
the culture supernatant at 4uC, and increased up to
final concentrations of 30, 40, 50, 60, and 70%. The
precipitated proteins were collected by centrifugation
at 10 0006g for 15 minutes at 4uC, suspended in PBS
buffer, and then dialyzed in deionized water for
72 hours. The protein concentrations in the culture
supernatants, concentrates, and purified protein
Pathogens and Global Health
2013
VOL .
107
NO .
3
117
Pinheiro et al.
Expression of NcSRS2 protein in Pichia pastoris
samples were determined using a BCA kit (Pierce,
Rockford, IL, USA).
Western blotting (WB)
Published by Maney Publishing (c) W S Maney & Son Ltd
The ability of the recombinant protein to interact
specifically with neosporosis-positive sera was determined by WB using sera collected from neosporosispositive cattle previously defined by IFAT. Purified
recombinant NcSRS2 and an unrelated recombinant
protein (negative control) were used for WB analysis
of positive and negative bovine sera. The samples
were mixed with sodium dodecyl sulfate gel-loading
buffer (100 mM Tris-HCl at pH 6.8, 100 mM 2mercaptoethanol, 4% sodium dodecyl sulfate, 0.2%
bromophenol blue, and 20% glycerol) under reducing
conditions. The samples were heated at 100uC for
10 minutes, and subjected to sodium dodecyl sulfatepolyacrylamide gel electrophoresis. Afterwards, the
proteins in the gel were electrically transferred to a
nitrocellulose membrane (GE Healthcare). The
membrane was blocked with PBS-SM for 1 hour at
room temperature and incubated with positive or
negative cattle sera diluted at 1 : 100 with PBS-SM at
room temperature for 1 hour. The membrane was
washed three times with PBS-T for 5 minutes each
and incubated with horseradish peroxidase-conjugated antibovine IgG (Sigma) diluted at 1 : 4000 with
PBS-SM at room temperature for 1 hour. The
reacting bands were revealed using 3,3’-diaminobenzidine and H2O2.
Indirect enzyme-linked immunosorbent assays
(ELISAs)
The 96-well polystyrene microtiter plates (Polysorp,
Nunc, Rochester, NY, USA) were coated overnight
at 4uC with 50 ng/well of recombinant protein
NcSRS2 in 0.05-M carbonate–bicarbonate buffer
(pH 9.6). The plates were then washed three times
using 0.01M PBS with 0.05% Tween 20 (PBS-T), and
blocked using 0.01M PBS with 5% non-fat milk at
37uC for 1 hour. After three washes with PBS-T, the
positive and negative control sera and serum samples,
all in duplicate, were diluted to 1 : 100 in 0.01M PBST and incubated at 37uC for 1 hour. After three
washes, anti-bovine IgG conjugated to peroxidase
(Sigma), and diluted at 1 : 4000 in 0.01M PBS-T,
100 ml/well was added, which was followed by
incubation at 37uC for 1 hour. After five washes,
100 ml of the substrate (o-phenylenediamine dihydrochloride; OPD tablets, Sigma) in phosphate–
citrate buffer (0.4 mg/ml) containing 0.04% of 30%
(v/v) hydrogen peroxide, pH 5.0, was added to each
well, and the plates were incubated in the dark, and at
room temperature for 15 minutes, and then 50 ml of
stop buffer (1 N H2SO4) was added. Mean optical
density (OD) at 492 nm was determined for all
test wells using a microtiter plate reader (Multiskan
118
Pathogens and Global Health
2013
VOL .
107
NO .
3
Figure 1 Dot blotting of P. pastoris supernatant transformed with pPICZalphaB/NcSRS2 and cultured in fermenter
using the anti-hisx6tagMab. (Cz): positive control (NcSRS2
expressed in E. coli); (C2): negative control (P. pastoris X33
untransformed). Days 1, 2, 3, 4, 5, and 6 are the induction
periods for NcSRS2 expression with 1% of methanol.
MCC/340 MKII), and intra-plate ELISA was
performed.
Statistical analysis
To accurately assess the ELISA for diagnostic specificity, sensitivity, cutoff, and predictive values, the results
from the 139 bovine sera (confirmed positive and
negative samples) were subjected to receiver operating
characteristic (ROC) analysis using MedCalc statistical
software (version 10.3.0.0) (www.medcalc.be).
Results
Plasmid construction
The DNA sequences that encode for the protein
NcSRS2 (732 bp) were amplified by PCR and cloned
into the P. pastoris expression vector pPICZaB. Of
the 100 P. pastoris colonies screened for expression,
about 30% were recognized by a monoclonal antibody (Mab) specific to the 6XHis tag at the Cterminus of the recombinant protein. Colony PCR
was used to confirm the presence of the insert in the
expression vector of the P. pastoris genome. The
clones exhibiting the highest expression levels were
selected for further expression studies.
Recombinant protein purification and
concentration
The NcSRS2 was secreted to supernatant of the
culture of P. pastoris transformed with pPICZalphaB/
NcSRS2, which contains the alpha-factor signal
sequence, allowing secretion of the recombinant protein.
The concentration of NcSRS2 in the culture supernatant
was found to increase with time (Fig. 1) and recombinant proteins of the expected size were observed,
NcSRS2 (30 kDa) (Fig. 2).
The supernatant containing the secreted NcSRS2
was collected and purified or concentrated by
ammonium sulfate precipitation. The optimal salt
concentration for NcSRS2 was 40–50%. The recombinant proteins were dialyzed to remove the ammonium sulfate and then analyzed by dot blotting
Pinheiro et al.
Expression of NcSRS2 protein in Pichia pastoris
ELISA-NcSRS2, sensitivity, and specificity
The NcSRS2 produced in P. pastoris was used for
standardization of ELISA-NcSRS2 which was
achieved using 139 bovine sera (94 positive and
45 negative) previously determined by IFAT, and
were evaluated using ELISA-NcSRS2. Correlation
between the two diagnostic tools was assessed using
ROC analysis. Figure 4A shows the frequency
distribution of both the positive and negative IFAT
samples. Based on ROC analysis (Fig. 4B), a mean
bovine sera ELISA OD value of 0.42 was chosen as
the threshold to distinguish between positive and
negative samples, yielding a specificity of 97.8% and a
sensitivity of 100%.
Published by Maney Publishing (c) W S Maney & Son Ltd
Discussion
Figure 2 WB of P. pastoris expressing NcSRS2. MW: full
range rainbow molecular weight marker (GE), 1 – recombinant NcSRS2. The bands were revealed with bovine sera
positive for neosporosis diluted at 1 : 100 and anti-bovine IgG
conjugated to peroxidase diluted at 1 : 4000.
(Fig. 3A), which were reactive using sera from
positive cattle and from mice inoculated with
recombinant protein NcSRS2 purified from E. coli.
The yield obtained was 100 mg/l after concentration
with 50% ammonium sulfate.
Antigenicity of the recombinant NcSRS2 protein
The antigenicity of the purified protein was evaluated
with positive cattle sera for neosporosis by WB. The
protein NcSRS2 expressed in P. pastoris was recognized by the sera, showing that the antigenic properties were conserved when the eukaryotic system was
used for expression (Fig. 2).
The NcSRS2 surface protein is common to both the
tachyzoite and bradyzoite stages, and shows potential for
use in N. caninum serological infection diagnosis.6,19–22
The protein has been expressed in systems that include
prokaryotic and eukaryotic systems based on the
baculovirus;8–10,22 however, P. pastoris has never been
used to express proteins from N. caninum.
P. pastoris is important for the production of
recombinant proteins.23 The use of this yeast provides
advantages over prokaryotic expression systems, since
easy genetic manipulation, and fast growth in relatively
simple culture media allow for its expansion to industrial
scale protein production, all this besides having a strong
induction promoter in methanol.16
In this work, a C-terminal fragment of NcSRS2
was successfully cloned and expressed in P. pastoris
methylotrophic yeast. In previous studies, there are
no reports concerning the amount of protein
obtained after purification; our group has already
produced NcSRS2 in E. coli,8 with yields of between
3.2 and 8 mg/l (unpublished data). In this study, we
report the expression in P. pastoris resulting in yields
of over 100 mg/l for rNcSRS2 after concentration
with 50% ammonium sulfate, without the need for
subsequent solubilization, and/or re-folding steps.
This procedure allowed us to evaluate the applicability of a low cost and simpler purification.24
Several proteins from parasites have been expressed in
P. pastoris systems.25–31 Some recombinant antigens
were used as vaccine, where VAR2CSA-DBL1 recombinant can be targeted by vaccination and may have application for pregnancy malaria vaccine development.32
Mice challenged with live cells of T. gondii have also been
protected after immunization with recombinant SAG2.26
Protective immunity against lethal malaria infection in
mice has been induced by cholera toxin B subunit
glycoprotein expressed in yeast.33 Partial protection has
been obtained using P. falciparum HGXPRT expressed
in P. pastoris, after immunization of mice that were
challenged with P. yoeli,34 and msp1.35 Antigens from
Pathogens and Global Health
2013
VOL .
107
NO .
3
119
Pinheiro et al.
Expression of NcSRS2 protein in Pichia pastoris
Figure 3 Dot blotting of NcSRS2 purification/precipitation. (A) Precipitation of NcSRS2 of supernatant culture with 30, 40, 50,
60, and 70% of ammonium sulfate. (B) Positive control (NcSRS2 purified from E. coli) and negative control (P. pastoris X33
untransformed). Line 1 — bovine serum positive to neosporosis; Line 2 — mice serum positive to recombinant NcSRS2; Line 3
— Mab anti-Hisx6Tag.
Published by Maney Publishing (c) W S Maney & Son Ltd
Schistosoma japonicum have been evaluated as well as
vaccine.36
Use in diagnosis has also been assessed; SAG2
expressed in P. pastoris was used for toxoplasmosis
diagnosis.27,37 Recombinant cathepsin B-1 protease
has been used as a serodiagnostic antigen for human
opisthorchiasis showing sensitivity and specificity
(ELISA test) of 67 and 81%, respectively.38 Cysteine
protease of Clonorchis sinensis has also been used for
serological diagnosis of clonorchiasis with a sensitivity of 91.7% and a specifity of 97.6%.39
Several reports have suggested that recombinant
proteins produced in E. coli exhibit failures during
protein folding, which interferes when these proteins
are used in diagnosis, or as a recombinant vaccine.40
NcSRS2 expressed in P. pastoris has been recognized
by neosporosis positive bovine sera, showing that it
conserves its antigenic properties when the eukaryotic
expression system is used. The NcSRS2 recombinant
was then evaluated using indirect ELISA with cattle
sera from positive and negative animals. The results
for specificity and sensitivity were 97.8 of 100%,
respectively.
We believe that this is the first report of the use of
the methylotrophic yeast P. pastoris to express the
NcSRS2 protein of N. caninum. The method provided
satisfactory expression (great amounts of protein),
and an easy purification strategy. The protein proved
useful for the diagnosis of neosporosis in cattle using
indirect ELISA.
Figure 4 Receiver operating characteristic (ROC) analysis of the ELISA-NcSRS2 using 94 confirmed positive and 45 assuredly
negative sera. (A) Distribution frequency of confirmed positive (1) and confirmed negative (0) sera. Samples were considered
positive when cutoff values were greater than or equal to 0.42 ELISA absorbance (mean values). (B) ROC plot. Area under
curve50.999 (0.003); 95% confidence interval between 0.971 and 1.000.
120
Pathogens and Global Health
2013
VOL .
107
NO .
3
Pinheiro et al.
Acknowledgements
Funding for this study was provided by the
Coordenação de Aperfeiçoamento de Pessoal de
Nı́vel Superior (CAPES, grant AUX-PE-PNPD1513/2008) and the Conselho Nacional de
Desenvolvimento Cientı́fico e Tecnológico (CNPq).
Published by Maney Publishing (c) W S Maney & Son Ltd
References
1 Hasler B, Regula G, Stark KD, Sager H, Gottstein B, Reist M.
Financial analysis of various strategies for the control of
Neospora caninum in dairy cattle in Switzerland. Prev Vet Med.
2006;77:230–53.
2 Hernandez J, Risco C, Donovan A. Association between
exposure to Neospora caninum and milk production in dairy
cows. J Am Vet Med Assoc. 2001;219:632–5.
3 Instituto Brasileiro de Geografia e Estatı́stica. IBGE; 2010.
[cited 2010 Dec 12]; Available from: URL: www.ibge.gov.br
4 Andreotti R, Barros JC, Pereira AR, Oshiro LM, Cunha RC,
Figueiredo Neto LF. Association between seropositivity for
Neospora caninum and reproductive performance of beef heifers
in the Pantanal of Mato Grosso do Sul, Brazil. Rev Bras
Parasitol Vet. 2010;19:119–23.
5 Fuchs N, Sonda S, Gottstein B, Hemphill A. Differential
expression of cell surface- and dense granule-associated
Neospora caninum proteins in tachyzoites and bradyzoites. J
Parasitol. 1998;84:753–8.
6 Hemphill A, Gottstein B. Identification of a major surface
protein on Neospora caninum tachyzoites. Parasitol Res.
1996;2:497–504.
7 Son ES, Ahn HJ, Kim JH, Kim DY, Nam HW. Determination
of antigenic domain in GST fused major surface protein (Ncp43) of Neospora caninum. Korean J Parasitol. 2001;39:241–6.
8 Borsuk S, Andreotti R, Leite FP, da Silva PL, Simionatto S,
Hartleben CP, et al. Development of an indirect ELISANcSRS2 for detection of Neospora caninum antibodies in cattle.
Vet Parasitol. 2011;177:33–8.
9 Liu J, Yu J, Wang M, Liu Q, Zhang W, Deng C, et al.
Serodiagnosis of Neospora caninum infection in cattle using a
recombinant tNcSRS2 protein-based ELISA. Vet Parasitol.
2007;143:358–63.
10 Nishikawa Y, Claveria FG, Fujisaki K, Nagasawa H. Studies
on serological cross-reaction of Neospora caninum with
Toxoplasma gondii and Hammondia heydorni. J Vet Med Sci.
2002;64:161–4.
11 Makrides SC. Strategies for achieving high-level expression of
genes in Escherichia coli. Microbiol Rev. 1996;60:512–38.
12 Marston FA. The purification of eukaryotic polypeptides
synthesized in Escherichia coli. Biochem J. 1986;240:1–12.
13 Cos O, Ramon R, Montesinos JL, Valero F. Operational
strategies, monitoring and control of heterologous protein
production in the methylotrophic yeast Pichia pastoris under
different promoters: a review. Microb Cell Fact. 2006;5:17.
14 Cereghino GP, Cregg JM. Applications of yeast in biotechnology: protein production and genetic analysis. Curr Opin
Biotechnol. 1999;10:422–7.
15 Dubey JP, Hattel AL, Lindsay DS, Topper MJ. Neonatal
Neospora caninum infection in dogs: isolation of the causative
agent and experimental transmission. J Am Vet Med Assoc.
1988;193:1259–63.
16 Cereghino GP, Cereghino JL, Ilgen C, Cregg JM. Production of
recombinant proteins in fermenter cultures of the yeast Pichia
pastoris. Curr Opin Biotechnol. 2002;13(4):329–32.
17 Pare J, Hietala SK, Thurmond MC. Interpretation of an
indirect fluorescent antibody test for diagnosis of Neospora sp.
infection in cattle. J Vet Diagn Invest. 1995;7:273–5.
18 Trees AJ, Guy F, Tennant BJ, Balfour AH, Dubey JP.
Prevalence of antibodies to Neospora caninum in a population
of urban dogs in England. Vet Rec. 1993;132:125–6.
19 Ahn HJ, Kim S, Kim DY, Nam HW. ELISA detection of IgG
antibody against a recombinant major surface antigen (Nc-p43)
fragment of Neospora caninum in bovine sera. Korean J
Parasitol. 2003;41:175–7.
20 Gaturaga I, Chahan B, Xuan X, Huang X, Liao M, Fukumoto
S, et al. Detection of antibodies to Neospora caninum in cattle
by enzyme-linked immunosorbent assay with truncated
NcSRS2 expressed in Escherichia coli. J Parasitol.
2005;91:191–2.
Expression of NcSRS2 protein in Pichia pastoris
21 Ghalmi F, China B, Kaidi R, Losson B. Evaluation of a SRS2
sandwich commercial enzyme-linked immunosorbent assay for
the detection of anti-Neospora caninum antibodies in bovine
and canine sera. J Vet Diagn Invest. 2009;21:108–11.
22 Nishikawa Y, Kousaka Y, Tragoolpua K, Xuan X, Makala L,
Fujisaki K, et al. Characterization of Neospora caninum surface
protein NcSRS2 based on baculovirus expression system and its
application for serodiagnosis of Neospora infection. J Clin
Microbiol. 2001;39:3987–91.
23 Sorensen HP. Towards universal systems for recombinant gene
expression. Microb Cell Fact. 2010;9:27.
24 Hebert GA, Pelham PL, Pittman B. Determination of the
optimal ammonium sulfate concentration for the fractionation
of rabbit, sheep, horse, and goat antisera. Appl Microbiol.
1973;25:26–36.
25 Cunha RC, Andreotti R, Leite FP. Rhipicephalus (Boophilus)
microplus: expression and characterization of Bm86-CG in
Pichia pastoris. Rev Bras Parasitol Vet. 2011;20:103–10.
26 Fong MY, Lau YL, Zulqarnain M. Characterization of
secreted recombinant Toxoplasma gondii surface antigen 2
(SAG2) heterologously expressed by the yeast Pichia pastoris.
Biotechnol Lett. 2008;30:611–8.
27 Lau YL, Shamilah H, Fong MY. Characterisation of a
truncated Toxoplasma gondii surface antigen 2 (SAG2) secreted
by the methylotrophic yeast Pichia pastoris. Trop Biomed.
2006;23:186–93.
28 Lau YL, Thiruvengadam G, Lee WW, Fong MY.
Immunogenic characterization of the chimeric surface antigen
1 and 2 (SAG1/2) of Toxoplasma gondii expressed in the yeast
Pichia pastoris. Parasitol Res. 2011;109:871–8.
29 Rodriguez-Valle M, Vance M, Moolhuijzen PM, Tao X, LewTabor AE. Differential recognition by tick-resistant cattle of
the recombinantly expressed Rhipicephalus microplus serine
protease inhibitor-3 (RMS-3). Ticks Tick Borne Dis.
2012;3:159–69.
30 Thiruvengadam G, Init I, Fong MY, Lau YL. Optimization of
the expression of surface antigen SAG1/2 of Toxoplasma gondii
in the yeast Pichia pastoris. Trop Biomed. 2011;28:506–13.
31 Zou L, Miles AP, Wang J, Stowers AW. Expression of malaria
transmission-blocking vaccine antigen Pfs25 in Pichia pastoris
for use in human clinical trials. Vaccine. 2003;21:1650–7.
32 Avril M, Cartwright MM, Hathaway MJ, Hommel M, Elliott
SR, Williamson K, et al. Immunization with VAR2CSA-DBL5
recombinant protein elicits broadly cross-reactive antibodies to
placental Plasmodium falciparum-infected erythrocytes. Infect
Immun. 2010;78:2248–56.
33 Miyata T, Harakuni T, Taira T, Matsuzaki G, Arakawa T.
Merozoite surface protein-1 of Plasmodium yoelii fused via an
oligosaccharide moiety of cholera toxin B subunit glycoprotein
expressed in yeast induced protective immunity against lethal
malaria infection in mice. Vaccine. 2012;30:948–58.
34 Xiao JY, Zhang DM, Cai LS, Shen LH, Pan WQ. [Evaluation
of immunogenicity and protection efficacy of the recombinant
hypoxanthine-guanine-xanthine of Plasmodium falciparum in
mice]. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing
Za Zhi. 2006;24:192–5.
35 Zhang ZG, Yu WG, Qiu WS, Zhao HM. Immunogenicity of Cterminus of Plasmodium falciparum merozoite surface protein 1
expressed as a non-glycosylated polypeptide in yeast. Acta
Biochim Biophys Sin. 2006;38:403–9.
36 Zhang DM, Pan WQ, Qian L, Duke M, Shen LH, McManus
DP. Investigation of recombinant Schistosoma japonicum
paramyosin fragments for immunogenicity and vaccine efficacy
in mice. Parasite Immunol. 2006;28:77–84.
37 Ling LY, Ithoi I, Yik FM. Optimization for high-level
expression in Pichia pastoris and purification of truncated and
full length recombinant SAG2 of Toxoplasma gondii for
diagnostic use. Southeast Asian J Trop Med Public Health.
2010;41:507–13.
38 Sripa J, Brindley PJ, Sripa B, Loukas A, Kaewkes S, Laha T.
Evaluation of liver fluke recombinant cathepsin B-1 protease as
a serodiagnostic antigen for human opisthorchiasis. Parasitol
Int. 2012;61:191–5.
39 Jiang WC, Jin XL, Shen MX, Cao HJ, Xu XZ, Jiang G, et al.
Cloning, expression and evaluation on effect in serological
diagnosis of cysteine protease of Clonorchis sinensis. Zhongguo
Xue Xi Chong Bing Fang Zhi Za Zhi. 2011;23:682–6.
40 Faisal SM, Yan W, Chen CS, Palaniappan RU, McDonough
SP, Chang YF. Evaluation of protective immunity of
Leptospira immunoglobulin like protein A (LigA) DNA vaccine
against challenge in hamsters. Vaccine. 2008;26:277–87.
Pathogens and Global Health
2013
VOL .
107
NO .
3
121
16
3. MANUSCRITO 1
The use of ELISA based on NcSRS2 of Neospora caninum
expressed in Pichia pastoris for diagnosis of neosporosis in sheep
and dogs
(Manuscrito a ser submitido ao periódico Parasite Immunology)
http://onlinelibrary.wiley.com/journal/10.1111/(ISSN)1365-3024
17
The use of ELISA based on NcSRS2 of Neopora caninum expressed in Pichia pastoris for
diagnosis of neosporosis in sheep and dogs
Amanda Fernandes Pinheiro1, Sibele Borsuk2, Maria Elisabeth Aires Berne1, Luciano da Silva
Pinto2, Renato Andreotti3, Talita Roos4*, Barbara Couto Roloff2 and Fábio Pereira Leivas
Leite5**
1
Departamento de Microbiologia e Parasitologia, Instituto de Biologia, UFPel, Pelotas, RS, Brazil
2
Centro de Desenvolvimento Tecnológico, Biotecnologia, UFPel, Pelotas, RS, Brazil
3
EMBRAPA Gado de Corte, BR 262, km 4, CP 154, Campo Grande, MS, Brazil;
4
Departamento de Microbiologia e Parasitologia, Instituto de Biologia, UFPel, Pelotas, RS, Brazil;
PNPD/CAPES-PPG-Parasitologia, UFPel
5
Centro de Desenvolvimento Tecnológico, Biotecnologia, UFPel, Pelotas, RS, Brazil; Corresponding author.
Mailing address: Departamento de Microbiologia e Parasitologia, Campus Universitário, s/n, Caixa Postal 354,
Pelotas, RS 96010-900, Brazil. Tel.: (53)3275-7381. E-mail: [email protected]
18
Abstract
Neosporosis caused by protozoan Neospora caninum has caused extensive economic
losses in many countries. In the present study we report the utilization of the recombinant
protein NcSRS2 of N. caninum expressed in Pichia pastoris and its use in an indirect
immunoenzymatic assay (ELISA) in sheep and dogs. The recombinant protein presents
antigenic characteristics of native proteins recognized in sheep and dog serums naturally
infected with N. caninum, suggesting that epitopes of the native were conserved in the
recombinant protein. The ELISA-NcSRS2 diagnosis test described in the present study has
shown to be a specific and sensitive method for the detection of N. caninum in this two
species. In sheep, with a mean ELISA OD of 0.25 as the threshold value, the results yield a
specificity of 94.5% and a sensitivity of 100%. Using this same value as a cut-off point (OD
≤ 0.25), the test’s negative predictive value was 100%, and the positive predictive value
ranged from 69.8 to 99.4%, at 10 to 90% prevalence of neosporosis. In the dog population
using the same ROC analysis, and considering sera samples with a mean ELISA OD cut-off
value of 0.21, the test yielded a specificity of 93.3% and a sensitivity of 100%. Using the
same cut-off value, the test’s negative predictive value was 100% with its positive predictive
value ranging from 69.8 to 99.4% (for 10 to 90% of neosporosis prevalence in a specific
area). The results observed in this study suggest that the recombinant protein expressed in P.
pastoris can be used as an antigen for the development of immunodiagnosis methods to detect
the presence of N. caninum in the two exposed species to this parasitosis.
Key words: Neospora caninum, Pichia pastoris, ELISA-NcSRS2, Serological Diagnosis.
19
INTRODUCTION
The neosporosis, caused by the coccidian Neospora caninum, is responsible for economic
losses in the cattle industry around the world causing spontaneous abortions, reduced milk
production, feed conversion, and forced culling.1 Problems due to naturally acquired
Neospora infections have also been reported in other species, including sheep2 and goats.3
Dogs are essential to the life cycle of this parasite4 being both the definitive and intermediate
host, and are epidemiologically important for horizontal transmission to other animals.5
Various studies have been done to identify and characterize the molecular antigenic
components of N. caninum in order to better the performance of serological diagnosis and
reveal mechanisms of its host interactions.6 The antigenicity of Apicomplex specific antigens
which include N. caninum is needed to avoid cross-reaction with the parasites from the same
phylum.7 Serological tests which use this category of antigens increase testing specificity by
reducing possible antibody cross-reactions with familiar antigens.
NcSRS2 is an immunodominant surface protein present in bradyzoites and tachyzoites of
N. caninum8 and gives a specific serological diagnosis of neosporosis. The protein was
already expressed in different platforms, including Escherichia coli10, and bacillus-virus
systems.9 The approach of this study was to use P. pastoris as the expression system for
production of the NcSRS2 protein31. This yeast is genetically stable once transformed, and
grows in relatively simple culture media making industrial production scale up of
recombinant proteins straightforward.11
In the present study we were able to demonstrate that the protein NcSRS2 of N. caninum
expressed in P. pastoris conserved the epitopes of the native form in the recombinant protein
and was recognized by antibodies of naturally infected sheep and domestic dogs, suggesting a
promising system for diagnosis using ELISA.
20
MATERIALS AND METHODS
Parasites
Neospora caninum isolate NC-112 was used to prepare antigen for this study. The parasite was
propagated in Vero cells using Dulbecco’s modified essential medium (DMEM),
supplemented with 10% fetal calf serum (FCS) at 37°C in humidified atmosphere of 5% CO2.
When 80% of the Vero cells had been destroyed by N. caninum tachyzoites, the cell
monolayer was removed and washed twice with phosphate-buffered saline (PBS) solution at
1000g centrifugation for 10 min.
Sera
The sera, ovine and canine, used from this experiment were collected in endemic areas of
neosporosis in Brazilian states with large ovine herds. Peripheral blood was collected from the
jugular veins of 110 adult sheep using 19 g needles, and 65 adult dogs using a 22 g needle all
attached to Vacutainer tubes (Becton-Dickinson, Rutherford, NJ). The blood was then kept at
room temperature for clot formation, centrifuged for 10 min at 2000g for sera separation, and
stored at -20o C until used.
Indirect fluorescence antibody test (IFAT)
Cells infected with N. caninum tachyzoites were used to prepare the slide well for IFAT. The
sera samples were analyzed at a dilution of 1:50, defined as the cut-off point, using the
method described by.13 The sera from each species were diluted and incubated for 45min at
37ºC. Then, for each species, secondary fluorescein isothiocyanate-conjugated IgG (Sigma
21
Chemicals, USA) were added to the respective species and incubated for 45min at a dilution
of 1:1000 in PBS buffer for 45 min at 37ºC. Each glass slide included negative and positive
control sera.
Recombinant NcSRS2
The protein NcSRS2 was expressed as described by Pinheiro et al., 2013. The P. pastoris
cells in the log phase were treated with methanol for 6 days in a bioreactor for the expression
of NcSRS2. The recombinant NcSRS2 expression was confirmed by Western blotting using
bovine sera positive for neosporosis. Antibody-reacting protein bands were revealed using 3,
3’-tetrahydrochloride (DAB) and H2O2. The protein was concentrated using ammonium
sulfate, and purified for dialysis following the Invitrogen Protocol. Subsequently, the
concentration of recombinant NcSRS2 was determined by a BCA kit (Pierce, Rockford, IL,
USA).
Western blot
Purified recombinant NcSRS2 and an unrelated recombinant protein (negative control) were
used for Western blotting analysis of positive and negative ovine and canine sera. The
samples were mixed with SDS gel-loading buffer (100-mM Tris-HCl at pH 6.8, 100-mM 2mercaptoethanol, 4% SDS, 0.2% bromophenol blue, 20% glycerol) under reducing
conditions. The samples were brought to 100°C for 10 min and subjected to SDS-PAGE, after
which the proteins in the gel were electrically transferred to a nitrocellulose membrane (GE
Healthcare, UK). The membrane was blocked with PBS containing 5% skimmed milk (PBSSM) for 1h at room temperature and incubated with sheep (1:100 with PBS-SM) and dog
(1:50 with PBS-SM) sera at room temperature for 1h. The membrane was washed three times
22
with PBS-T for 5min each.
Then they were incubated with anti-ovine or anti-canine,
secondary peroxidase-conjugated IgG (Sigma Chemicals, USA), respectively, diluted to
1:4000 with PBS-SM at room temperature for 1h. The reacting bands were revealed using 3,
3’-tetrahydrochloride (DAB) and H2O2.
Indirect enzyme-linked immunosorbent assays (ELISA)
Polystyrene 96-well microtiter plates (Polysorp Nunc, USA) were coated overnight at 4 C
with 50ng/well of recombinant protein NcSRS2 in 0.05-M carbonate-bicarbonate buffer (pH
9.6). The plates were then washed three times using 0.01-M PBS with 0.05% Tween 20 (PBST) and blocked using 0.01-M PBS with 5% nonfat milk at 37 C for 1h. After three washes
with PBS-T, positive and negative control sera and serum samples, all in duplicate, were
diluted at 1:100 in 0.01-M PBS-T and incubated at 37 C for 1h. After three washes, 100
µL/well of anti-ovine or anti-canine, secondary peroxidase-conjugated IgG (Sigma
Chemicals, USA), were added to the respective specie, diluted at 1:4000 in 0.01-M PBS-T,
and followed by incubation at 37 C for 1h. After another five washes, 100 µL of the substrate
(o-phenylenediamine dihydrochloride; OPD tablets, Sigma Chemicals, USA) in phosphatecitrate buffer (0.4 mg/mL) containing 0.04% of 30% (v/v) hydrogen peroxide, pH 4.0, was
added to each well, and the plates were incubated in the dark at room temperature for 15 min,
and 50 µL of stop buffer (1-N H2SO4) was then added. Mean optical density (OD) at 492 nm
was determined for all test wells using a microtiter plate reader (Multiskan MCC/340 MKII,
Alabama, USA). The same positive and negative sera were used, for intraplate control.
23
Statistical analysis
To accurately assess the assay for diagnostic specificity, sensitivity, cut-off, and predictive
value, the results from the 110 ovine and 65 canine sera-confirmed positive and negative
samples were subjected to Receiver Operating Characteristic (ROC) analysis using MedCalc
statistical software (version 10.3.0.0, www.medcalc.be).
RESULTS
Recombinant NcSRS2
In order to confirm that the transformed P. pastoris was expressing the recombinant protein,
cultures were induced with methanol, and the expression confirmed by dot blot using anti
6xhisTag monoclonal antibody (data not shown). Concentrated and purified protein was then
confirmed by molecular weight with SDS-PAGE, and Western Blot. We were able to confirm
protein expression by probing with sera from naturally infected animals (Figure 1), it is
suggested that the recombinant protein presents conformation similar to the protein of the N.
caninum.
IFAT and ELISA-NcSRS2
ELISA-NcSRS2 was standardized. For sheep we used 110 sera, with 37 positive samples and
73 negatives. For canine sera we tested 21 positive samples and 44 negatives. In order to
determine the best serum dilution to be used, a check board was performed using different
antigen concentration and sera dilutions (pool of positive and negative sera). Then, the
dilution that falls within the linear range of the ELISA was used. The samples were
24
determined positive or negative by IFAT. The correlation between the two diagnostic tools
was assessed using ROC analysis. Among the sheep 73 negative-IFAT sera, 2 were found to
be above the cut-off point. For the canine population analysis considering a cut-off value of
0.21 for 15 IFAT-negative canine sera, only four sera were above the cut-off point. Sera
found above the cut-off point were evaluated by Western Blotting and was observed that they
were positive to Western Blotting (Figure 4).
Sensitivity, specificity, and predictive values
The figures 2 and 3 show the frequency distribution of the IFAT-positive and negative
samples for ovine and canine sera.
In sheep, with a mean ELISA OD of 0.25 as the threshold value, the results yield a
specificity of 94.5% and a sensitivity of 100%. Using this same value as a cut-off point (OD
≤ 0.25), the test’s negative predictive value was 100%, and the positive predictive value
ranged from 69.8 to 99.4%, at 10 to 90% prevalence of neosporosis (Figure 2C). In the dog
population using the same ROC analysis, and considering sera samples with a mean ELISA
OD cut-off value of 0.21, the test yielded a specificity of 93.3% and a sensitivity of 100%.
Using the same cut-off value, the test’s negative predictive value was 100% with its positive
predictive value ranging from 69.8 to 99.4% (for 10 to 90% of neosporosis prevalence in a
specific area) (Figure 3C).
DISCUSSION
Ovine herds and dog populations are epidemiologically important in the transmission of
parasitoses, and if they become affected by neosporosis, it creates the need for a standardized
25
diagnostic assay to detect N. caninum infection. Many serological tests for detecting N.
caninum antibodies have been described12, including indirect fluorescence assay (IFA), as
well as enzyme linked immunosorbent assays (ELISA), based upon either whole or partially
purified native N. caninum antigen.17 However, the need remains for N. caninum-specific
serological assays, principally for further identification of definitive and/or intermediate hosts,
for accurate herd diagnosis, and for epidemiological investigations into transmission and risk
factors.
To increase sensitivity, commercial ELISA, and IFAT use whole tachyzoites of N.
caninum. However, this can lead to decreased specificity, which in turn, leads to false-positive
results due to cross-reactions with another coccidian.14 Moreover, the presence of N. caninum
antibodies in the bovine fetal serum used in the culture media to prepare whole tachyzoites
antigens can also lead to false-positive results in cattle.16
Even though there are different serological methods, IFAT is still the predominant test.
However, the IFAT test is complex and subjective, which can compromise its effectiveness in
large-scale epidemiological investigations. A low-cost ELISA, for the livestock industry that
detects specific Neospora antibodies would make an important contribution to the control of
the disease.30
The utilization of a single antigen increases diagnostic specificity, as is the case of the
NcSRS2 antigen for N. caninum, it is conserved in different isolates, and it is the
immunodominant antigen recognized by sera from naturally infected animals. 19 In previous
studies, recombinant NcSRS2 protein was used for the development of ELISAs for diagnosis
of N. caninum infections, in most of them the protein was expressed through a prokaryotic
system10, or using a baculovirus approach.9
26
In this study the protein NcSRS2 from N. caninum expressed in P. pastoris in an ELISA
was used. We were also able to demonstrate; by Western blot and ELISA that the
recombinant protein expressed in P. pastoris was recognized by antibodies N. caninum
infected sheeps and dogs, suggesting that epitopes of the native protein were conserved in the
recombinant protein, showing that sera from two different species naturally infected with N.
caninum react positively to it.
The data obtained in this study, using an ELISA with recombinant NcSRS2 expressed in
P. pastoris as the antigen, suggest that it is promising system to provides advantages since
easy genetic manipulation, and fast growth in relatively simple culture media allow for its
expansion to industrial scale protein production, all this besides having a strong induction
promoter in methanol. The protein may be used as a diagnostic tool for the study of this
disease in sheep and dogs. The sensitivity and specificity results were suitable, from 100%
and 94.5% for sheep and 100% and 93.3% for canines, respectively.
Our group, in another study, using the same recombinant protein, we observed higher
ELISA sensitivity and specificity when the assay was performed using the antigen expressed
by P. pastoris with 97,8% specificity and 100% sensibility (Pinheiro et al., 2013). In Brazil,
there are few studies on the prevalence of neosporosis in sheep herds. The prevalence rate in
Parana state was of 9.5% of the positive animals,20 in the state of Rio Grande do Norte, the
rate ranges between 1.8%21 and 8.1%.22 If we consider a prevalence of 10% in a sheep herds,
and using the ELISA described in this study with a cut-off point value of OD ≤ 0.25, we can
obtain the predictably positive values of ~ 70% and predictably negative values of 100%.
Dogs are epidemiologically important in horizontal transmission of this protozoan to other
animals.5 There is evidence of the relationship between N. caninum infection in dogs and
cattle23, as well the increasing risk factor for neosporosis among sheep and goat herds when
27
there is contact with dogs.24 Thus, identification of seropositive animals and sero-prevalence
data in the dog population is extremely important for control strategies acting as the source of
infection for other species.
In South America, there are variations in the prevalence of neosporosis in the canine
population, as examples; 20% in Uruguay25, 37.8% in Argentina26 and 18% in Chile.27 In
Brazil, prevalence falls between 8.4% for Paraiba state28, and 15.6% for Rio Grande do Sul
state29. These reports suggest that the average prevalence that one might find is ~20% in
South America countries. The data obtained in this study, and the assay uses 20% as a
prevalence for neosporosis in the canine population; the results give us values of 93.3% for
sensibility and 100% for specificity, with a positive and negative predictive of 69.8% and
100%, respectively. Using this new ELISA might help to study the neosporosis epidemiology,
and control this economically important disease.
In this study we reported that the recombinant NcSRS2 protein expressed in P. pastoris
was recognized in sera from differing animal species with neosporosis using NcSRS2-ELISA.
Satisfactory results for sensitivity and specificity suggest that it could serve as a useful tool
for better understanding and control of this important disease.
ACKNOWLEDGMENTS
Funding for this study was provided by the Coordenação de Aperfeiçoamento de Pessoal
de Nível Superior (CAPES, grant AUX-PE-PNPD-1513/2008) and the Conselho Nacional de
Desenvolvimento Científico e Tecnológico (CNPq). We also would like to thanks Dr. Nilton
Azevedo Cunha Filho and Dr. Felipe Papen for kindly provided ovine and canine sera
samples.
28
REFERENCES
1 Anderson ML, Andrianarivo AG, Conrad PA. 2000. Neosporosis in cattle. Anim Reprod.
Sci. 60: 417-431.
2 Dubey JP, Hartley WJ, Lindsay DS, Topper MJ. 1990. Fatal congenital Neospora caninum
infection in a lamb. J. Parasitol. 76: 127-130.
3 Dubey JP, Lindsay DS, Adams DS, Gay JM, Baszler TV, Blagburn BL, Thulliez P. 1996.
Serologic responses of cattle and other animals infected with Neospora caninum. Am. J.
Vet. Res. 57: 329-336.
4 Dubey JP, Schares G, Ortega-Mora LM. 2007. Epidemiology and control of neosporosis
and Neospora caninum. Clin. Microbiol. Rev. 20: 323-367.
5 Gondim LF, Sartor IF, Hasegawa M, Yamane I. 1999. Seroprevalence of Neospora
caninum in dairy cattle in Bahia, Brazil. Vet Parasitol. 86; 71-75.
6 Hemphill A, Fuchs N, Sonda S, Hehl A. 1999. The antigenic composition of Neospora
caninum. Int. J. Parasitol. 29: 1175-1188.
7 Dubey JP, Ross AD, Fritz D. 2003. Clinical Toxoplasma gondii, Hammondia heydorni,
and Sarcocystis spp. infections in dogs. Parassitologia 45: 141-146.
8 Fuchs N, Sonda S, Gottstein B, Hemphill A. 1998. Differential expression of cell surfaceand dense granule-associated Neospora caninum proteins in tachyzoites and bradyzoites.
J. Parasitol. 84: 753-758.
9 Nishikawa Y, Kousaka Y, Tragoolpua K, Xuan X, Makala L, Fujisaki K, Mikami T,
Nagasawa H. 2001. Characterization of Neospora caninum surface protein NcSRS2 based
on baculovirus expression system and its application for serodiagnosis of Neospora
infection. J. Clin. Microbiol. 39: 3987-3991.
10 Borsuk S, Andreotti R, Leite FP, da Silva PL, Simionatto S, Hartleben CP, Goetze M,
Oshiro LM, Matos MF, Berne ME. 2011. Development of an indirect ELISA-NcSRS2 for
detection of Neospora caninum antibodies in cattle. Vet. Parasitol. 177: 33-38.
11 Cereghino GP, Cereghino JL, Ilgen C, Cregg JM. 2002. Production of recombinant
proteins in fermenter cultures of the yeast Pichia pastoris. Curr. Opin. Biotechnol. 13:
329-332.
12 Dubey JP, Hattel AL, Lindsay DS, Topper MJ. 1988. Neonatal Neospora caninum
infection in dogs: isolation of the causative agent and experimental transmission. J. Am.
Vet. Med. Assoc. 193: 1259-1263.
13 Pare J, Hietala SK, Thurmond MC. 1995. Interpretation of an indirect fluorescent antibody
test for diagnosis of Neospora sp. infection in cattle. J. Vet. Diagn. Invest 7: 273-275.
29
14 Ahn HJ, Kim S, Kim DY, Nam HW. 2003. ELISA detection of IgG antibody against a
recombinant major surface antigen (Nc-p43) fragment of Neospora caninum in bovine
sera. Korean J. Parasitol. 41: 175-177.
15 Gaturaga I, Chahan B, Xuan X, Huang X, Liao M, Fukumoto S, Hirata H, Nishikawa Y,
Takashima Y, Suzuki H, Fujisaki K, Sugimoto C. 2005. Detection of antibodies to
Neospora caninum in cattle by enzyme-linked immunosorbent assay with truncated
NcSRS2 expressed in Escherichia coli. J. Parasitol. 91: 191-192.
16 Dubey JP, Schares G. 2006. Diagnosis of bovine neosporosis. Vet Parasitol. 140: 1-34.
17 Ghalmi F, China B, Kaidi R, Losson B. 2009. Evaluation of a SRS2 sandwich commercial
enzyme-linked immunosorbent assay for the detection of anti-Neospora caninum
antibodies in bovine and canine sera. J. Vet. Diagn. Invest 21; 108-111.
18 Higa AC, Machado RZ, Tinucci-Costa M, Domingues LM, Malheiros EB. 2000.
Evaluation of cross-reactivity of Toxoplasma gondii and Neospora caninum antigens in
dogs sera. Rev. Bras. Parasitol. Vet 9: 91-95.
19 Howe DK, Crawford AC, Lindsay D, Sibley LD. 1998. The p29 and p35
immunodominant antigens of Neospora caninum tachyzoites are homologous to the
family of surface antigens of Toxoplasma gondii. Infect. Immun. 66: 5322-5328.
20 Romanelli PR, Freire RL, Vidotto O, Marana ER, Ogawa L, De Paula VS, Garcia JL,
Navarro IT. 2007. Prevalence of Neospora caninum and Toxoplasma gondii in sheep and
dogs from Guarapuava farms, Parana State, Brazil. Res. Vet. Sci. 82: 202-207.
21 Soares HS, Ahid SM, Bezerra AC, Pena HF, Dias RA, Gennari SM. 2009. Prevalence of
anti-Toxoplasma gondii and anti-Neospora caninum antibodies in sheep from Mossoro,
Rio Grande do Norte, Brazil. Vet. Parasitol. 160: 211-214.
22 Ueno TE, Goncalves VS, Heinemann MB, Dilli TL, Akimoto BM, de Souza SL, Gennari
SM, Soares RM. 2009. Prevalence of Toxoplasma gondii and Neospora caninum
infections in sheep from Federal District, central region of Brazil. Trop. Anim Health
Prod. 41: 547-552.
23 Wouda W, Dijkstra T, Kramer AM, van MC, Brinkhof JM. 1999. Seroepidemiological
evidence for a relationship between Neospora caninum infections in dogs and cattle. Int. J.
Parasitol. 29: 1677-1682.
24 Abo-Shehada MN, Abu-Halaweh MM. 2010. Flock-level seroprevalence of, and risk
factors for, Neospora caninum among sheep and goats in northern Jordan. Prev. Vet. Med.
93: 25-32.
25 Barber JS, Gasser RB, Ellis J, Reichel MP, McMillan D, Trees AJ. 1997. Prevalence of
antibodies to Neospora caninum in different canid populations. J. Parasitol. 83: 10561058.
26 Basso W, Venturini L, Venturini MC, Moore P, Rambeau M, Unzaga JM, Campero C,
Bacigalupe D, Dubey JR. 2001. Prevalence of Neospora caninum infection in dogs from
30
beef-cattle farms, dairy farms, and from urban areas of Argentina. J. Parasitol. 87: 906907.
27 Patitucci AN, Pérez MJ, Rozas MA. 2001. Neosporosis canine: detection of sera
antibodies in rural and urban canine population of Chile. Arch. Med. Vet. 33: 227-232.
28 Azevedo SS, Batista CS, Vasconcellos SA, Aguiar DM, Ragozo AM, Rodrigues AA,
Alves CJ, Gennari SM. 2005. Seroepidemiology of Toxoplasma gondii and Neospora
caninum in dogs from the state of Paraiba, Northeast region of Brazil. Rev. Vet. Sci. 79:
51-56.
29 Cunha Filho NA, Lucas AS, Pappen FG, Ragozo AM, Gennari SM, Junior TL, Farias NA.
2008. [Risk factors and prevalence of antibodies anti-Neospora caninum in urban and
rural dogs from Rio Grande do Sul, Brazil]. Rev. Bras. Parasitol. Vet. 17: 301-306.
30 Baldani CD. 2011. Production of recombinant EMA-1 protein and its application for the
diagnosis of Theileria equi using an enzyme immunoassay in horses from São Paulo state.
Rev. Bras. Parasitol. Vet. 20(1), 54-60.
31 Pinheiro, A. F., Borsuk, S., Berne, M. E. A., Pinto, L. S., Andreotti, R., Roos, T., Rollof,
B. C., Leite, F. P. L. 2013. Expression of Neospora caninum NcSRS2 surface protein
in Pichia pastoris and its application for serodiagnosis of Neospora infection. Pathogens
and global health.
31
FIGURE CAPTIONS
Figure 1: Western Blot using recombinant NcSRS2 protein expressed in P. pastoris system.
The recombinant protein reacted with sera of animals naturally infected with N. caninum.
Marker molecular weight full range rainbow (GE). (1) Ovine sera. (2) Canine sera.
Figure 2: ROC analysis of the ELISA-NcSRS2 using 37 confirmed positive and 73 assuredly
(by indirect fluorescence antibody test, IFI) negative sheep sera. (A) Frequency distribution of
confirmed positive (1) and confirmed negative (0) sera. Samples were considered positive
when cut-off values were greater than or equal to 0.25 ELISA absorbance mean values. (B)
ROC plot. Area under curve = 0.996 (0.008); 95% confidence interval between 0.958 and
0.997. (C) Predictive values Negative (squares) and positive (diamonds) associated with
ELISA-NcSRS2 for varying prevalence levels of neosporosis determined by ROC analysis
based on ELISA OD mean value threshold.
Figure 3: ROC analysis of the ELISA-NcSRS2 using 21 confirmed positive and 44 assuredly
(by indirect fluorescence antibody test, IFI) negative canine sera. (A) Frequency distribution
of confirmed positive (1) and confirmed negative (0) sera. Samples were considered positive
when cut-off values were greater than or equal to 0.21 ELISA absorbance mean values. (B)
ROC plot. Area under curve = 0.986 (0.018); 95% confidence interval between 0.919 and
0.997. (C) Predictive values Negative (squares) and positive (diamonds) associated with
ELISA-NcSRS2 for varying prevalence levels of neosporosis determined by ROC analysis
based on ELISA OD mean value threshold.
32
Figure 4: Western Blot of positive and negative serum diluted at 1:100 and IgG conjugated to
peroxidase diluted at 1:4000. Marker molecular weight full range rainbow marker (GE). (A)
The bands 1a, 2a, 3a, 4a were revealed with canine sera positive and 1b, 2b, 3b, 4b, 5b with
negative sera for neosporosis (B) The bands 1a and 2a were revealed with ovine sera positive
and 1b, 2b, 3b, 4b with negative sera for neosporosis.
33
Figure 1.
34
Figure 2.
35
Figure 3.
36
Figure 4.
37
4. MANUSCRITO 2
Immune modulation of recombinant NCSRS2 protein of
Neospora caninum by different adjuvants
(Manuscrito a ser submetido ao periódico Clinical and Vaccine Immunology)
http://cvi.asm.org
38
Immune modulation of recombinant NCSRS2 protein of Neospora caninum by different
adjuvants
Amanda Fernandes Pinheiro1, Sibele Borsuk2, Isabel Martins Madrid3*, Barbara Couto
Roloff2, Régis Sturbelli2, Renato Andreotti4, Fábio Pereira Leivas Leite5**
1
Departamento de Microbiologia e Parasitologia, Instituto de Biologia, UFPel, Pelotas, RS, Brazil
Centro de Desenvolvimento Tecnológico, Biotecnologia, UFPel, Pelotas, RS, Brazil
3
Departamento de Microbiologia e Parasitologia, Instituto de Biologia, UFPel, Pelotas, RS, Brazil;
PNPD/CAPES-PPG-Parasitologia, UFPel
4
EMBRAPA Gado de Corte, BR 262, km 4, CP 154, Campo Grande, MS, Brazil;
5
Centro de Desenvolvimento Tecnológico, Biotecnologia, UFPel, Pelotas, RS, Brazil; Corresponding author.
Mailing address: Departamento de Microbiologia e Parasitologia, Campus Universitário, s/n, Caixa Postal 354,
Pelotas, RS 96010-900, Brazil. Tel.: (53)3275-7381. E-mail: [email protected]
2
39
Abstract
In this study, the immune response of recombinant rNcSRS2 protein of Neospora
caninum expressed in Pichia pastoris adjuvanted with oil, xanthan gum, and alumen
hydroxide were assessed in the murine model. Mice (10/group) were vaccinated intramuscular with 20µg of rNcSRS2 with two doses twenty one days apart, alone or adjuvanted
with oil, xanthan, and alumen hydroxide. At day 35th, four mice of each group were
euthanized and the splenocytes cultured. The IgG dynamics were evaluated by indirect
ELISA and spleen cytokine expression patterns assed by qPCR of different vaccines. All
group seroconvert, with oil group showing the higher antibodies titers. The rNcSRS2 alone
was able to induce a significant splenic transcription level of IL-17. The association of
adjuvants to the rNcSRS2 protein modulates differently cytokine splenic transcription. The oil
modulates the expression of TNF-α, whereas the xanthan modulate IL-4, IL-10, IL-12, and
alumen hydroxide IFN-γ, TNF-α, IL-4, IL-10 and IL-12. This study demonstrates the impact
that adjuvants can have on the recombinant antigen modulation of immune response against
N. caninum.
KEY WORDS: Adjuvant, Vaccine, cytokine, Neospora caninum, NcSRS2 protein.
40
INTRODUCTION
Neospora caninum infects a very wide range of different domestic and livestock causing
important economic losses in the cattle industry. 1 The endogenous transplacental infection
from a pregnant dam to its unborn fetus is considered to be the predominant route of
transmission.2 Cows of any reproductive age may abort, with most abortions occurring at five
to six month of gestation.3 A number of compounds have been evaluated for the potential
treatment of neosporosis, but none of these have demonstrated efficacy, leaving the
development of a vaccine as a promising alternative.4 Several types of vaccines have been
developed using live parasites, irradiated, antigens of cell lysates or recombinant protein, as
well as virus vaccines recombinant have been evaluated, showing that the protection is
dependent on the adjuvants used.5 The surface protein NcSRS2 from the parasite, that is
involved in the adhesion process and in host cell invasion6, have been regarded a candidate
for effective vaccines.
Recombinant subunit vaccines are often poorly immunogenic and require additional
components to help stimulate protective immunity. The adjuvants provide the needed to
enhance the immunogenicity of vaccine antigens. Adjuvants currently in use, has been
developed empirically, without a clear understanding of mechanisms of action. Nevertheless,
recent data suggest that adjuvants enhance T and B lymphocytes responses by engaging
components of the innate immune system, rather than directly through the lymphocytes
themselves.7,8,9
Thus, this study was undertaken to further investigate the immunogenic effect of
adjuvants to the N. caninum recombinant NcSRS2 protein expressed in Pichia pastoris and
evaluate the differential cytokines transcription at splenic level.
41
METHODS
Parasite culture and recombinant NcSRS2 preparation
The Neospora caninum isolate NC-1 was propagated in Vero cells using Dulbecco’s modified
essential medium supplemented with 10% fetal calf serum (FCS), at 37C in a humidified
atmosphere of 5% CO2. Pichia pastoris strain X33 (Invitrogen Tech, Carlsbad, CA) was
grown in Yeast Extract Peptone Dextrose (YPD) medium (1% yeast extract, 2% peptone and
2% D-glucose) or YPD 1.5% agar at 30 0C supplemented with 100 µg/ml of zeocin. The
expression of rNcSRS2 was performed using the eukaryotic system based in P. pastoris.
Briefly, the recombinant plasmid (pPICZαB/ncsrs2) and inoculated into a 3L baffled
fermenter containing 1 L of BMMY broth. The culture was incubated at 28 0C, for
approximately 48 h until an OD600 of 2–6 was reached. Expression was induced by the
addition of methanol at 1% final concentration, as described previously .10
Vaccination of the mice
Female BalbC, 4 - 6 weeks of age, were used in this experiment. Mice were housed in 5
groups of 10 animals; food and water were provided ad libitum. Each mouse was inoculated
with a 200 μL volume as follows: Group 1 was given PBS alone, Group 2- 20μg of
recombinant NcSRS2; Group 3- 20μg of recombinant NcSRS2 with 50% oil (50% v/v
Montanide ISA 50 V2 (Seppic Adjuvants, France); Group 4- 20μg of recombinant NcSRS2
with xanthan gum (Patent n. PI1020120218100) and Group 5- 20μg of recombinant NcSRS2
with 15% alumen hydroxide adjuvant (Alhydrogel, Superfos Biosector, Vedbaek, Denmark).
All vaccines were administred via subcutucaneusly, with the exception of the vaccine oil
adjanted. After 21 days, inoculation was repeated in all groups with the same vaccine dose.
42
Blood samples were collected through the retro-orbital plexus before each immunization and
on days 7, 14, 21, 28 and 35 post-vaccination. The sera was collected and stored at −20 0C
until use. Mice were housed at the animal facility of the Biotechnology Centre, Federal
University of Pelotas (UFPel). All procedures were performed in accordance with the
Brazilian Committee for animal care and use (COBEA) guidelines and approved by the UFPel
Ethics Committee for animal research (project number 2.11.04.014).
Evaluation of the IgG level
Antibody responses were monitored by an indirect ELISA using rNcSRS2 as antigen. ELISA
plates (Polysorp Surface, Nunc) were coated overnight at 4 °C with 50 ng of recombinant
protein per well, diluted in carbonate bicarbonate buffer pH 9.6. The plates were then washed
three times using PBS-T (0.01M PBS with 0.05% Tween 20), and blocked using 0.01M PBS
with 5% non-fat milk at 37 °C for 1 h. After three washes with PBS-T, the positive and
negative control sera and serum samples, all in duplicate, were diluted to 1:100 in 0.01M
PBS- T and incubated at 37 °C for 1 h. After three washes, anti-mouse IgG conjugated to
peroxidase (Sigma), and diluted at 1:4000 in 0.01M PBS-T, 100 mL/well was added, which
was followed by incubation at 37°C for 1 h. After five washes, 100 mL of the substrate (ophenylenediamine dihydrochloride; OPD tablets, Sigma) in phosphate–citrate buffer (0.4
mg/mL) containing 0.04% of 30% (v/v) hydrogen peroxide, pH 5.0, was added to each well,
and the plates were incubated in the dark, and at room temperature for 15 min, and then 50
mL of stop buffer (1 N H2SO4) was added. Mean optical density (OD) at 492 nm was
determined for all test wells using a microtiter plate reader (Multiskan MCC/340 MKII), and
intra-plate ELISA was performed.
43
Spleen cytokine transcripts
Thirty five days post-immunization, four mice per group were euthanized and the spleen
removed. The splenocytes were suspended in Hank’s solution, centrifuged and suspended in
cell lyses solution (chloride ammonia 0.8%). Another wash with Hank’s solution was
performed and the cells suspended in RPMI 1640 (Cultilab, Campinas, Brazil) with 10% fetal
bovine serum (Cultilab, Campinas, Brazil). The cells were incubated for 24 h at 37 °C in an
atmosphere of 5% CO2 and then stimulated with 2.5μg.mL-1: A) rNcSRS2; B) Concanavalin
A (Con A); C) Negative control. The cells were incubated for 24 h in the same conditions and
then, were collected in TRIzol (Invitrogen) and stored at -70 °C. Total RNA was extracted
from the cells and the cDNA synthesis was performed from 300ng/μL of RNA, according
manufacturer’s instructions (Applied Biosystems). The Quantitative Real-Time Polymerase
Chain Reaction (qPCR) (MxPro-Mx3005P) was used for the quantification of cytokines. The
reaction were performed in a final volume of 12.5μl containing 1 μL of cDNA, 6.25 μL of
SYBR Green (Invitrogen), 0.5 μM of each primer and 4.25 μL of RNase-free water (GibcoBRL). The samples underwent 1) desnaturation at 95°C, 5 min; 2) amplification in 40 cycles
under the following conditions: 95°C, 30s, 60°C, 60s and 72 0C, 60s; 3) final extension 72 °C,
5 min All samples were performed in duplicate. A control without cDNA was included to
eliminate contamination or unspecific reactions. The value of the threshold cycle (Cycle
Threshold - CT) was defined by the number of PCR cycles required for the fluorescence
signal exceeds the threshold value detection. The primer sequence is shown in table 1.
44
RESULTS
Expression of rNcSRS2 in P. pastoris
The protein NcSRS2 expressed in P. pastoris was recognized by bovine sera positive for
neosporosis diluted at 1:100 and anti-bovine IgG conjugated to peroxidase diluted at 1:4000,
showing that the antigenic properties were conserved when the eukaryotic system was used
for expression (figure 1).
Humoral immune response
At seven after vaccination specific antibodies anti-rNcSRS2 were detected in the group
vaccinated with the protein adjuvanted with the xanthan. Fourteen and twenty one day after
the initial immunization, specific antibodies were detected in the group’s oil, xanthan and
alumen respectively. Significant increases in antibodies response were observed after the
vaccine boost independent of vaccine group. On day 28 a significant difference in antibodies
level (p<0.05) were observed in the group vaccinated with rNcSRS2 adjuvanted with oil and
the other groups. By the day 35, the oil and xanthan groups had significant (p<0.05) increased
the antibodies titer whereas the alumen group had a decreased level compared with day 28
(Figure 2). Negative control not reacted to the antigen (ELISA values below 0,008)
throughout the experiment. In terms of IgG1 and IgG2a the group oil and alumen were similar
at 35th of experiment with a ratio IgG2a/IgG1 for oil of 0.47 and 0.411 for alumen. However,
this ratio was observed in alumen group, even with low levels, from day seven; in the oil
group the IgG2a increment was observed after the second vaccine dose (figure 3). The
45
xanthan group showed a ratio IgG2a/IgG1 at 35th of experiment of 0.13, and since the day 21
the IgG1 levels was significant higher than IgG2a. The protein alone had a ratio IgG2a/IgG1
at 35th of experiment of 0.364, and this tendency was kept during the time point’s studied.
Cytokine transcriptions
Cytokine transcript levels in spleen of all mice were assessed by quantitative PCR at the 35
day of the experiment. The protein alone and associated with the adjuvants demonstrated a
very distinct profile of studied cytokines. The rNcSRS2 alone induced a significant (p<0.05)
high expression level of IL-17 (120 fold increase), however when adjuvanted with oil,
xanthan or alumen it was significant (p<0.05) reduced. The association with oil induced a
significant (p<0.05) transcription of TNF-α (11 fold increase), and reduced the IL-17
expression by 50 times. The xanthan modulate a significant (p<0.05) increase in transcription
levels of IL-4 (60 fold increase), IL-10 (5.5 fold Increase), IL-12 (4 fold increase), and TNF-α
(2 fold increase), whereas for the IL-17 induced a reduction of approximately 9 times when
comparing with the protein alone. Alumen associated with the rNcSRS2 modulates the
transcription of IFN-y by 2.4, IL-4 by 4, and IL-12 by 2 fold increase respectively. This
association reduced the transcription level of IL-17 by 16 times, and do not show any effect in
the expression of TNF-α neither IL-10 (figure 3).
DISSCUSSION
The rational in design vaccine is guided by understanding the relations between
host/pathogen and the immune protection established by this interaction. Thus, the antigen
46
selection and the association of an adjuvant into a vaccine should achieve a immune
modulation that increase response to the type of immunity that effectively protected the host.
The present study determined the humoral immune response and mRNA transcripts of
cytokines from mice vaccinated with recombinant NcSRS2 of Neospora caninum adjuvanted
with oil, alumen, xanthan in BalbC mice.
Overall, mice vaccinated with rNcSRS2, independent of adjuvanted used, serum
converted and developed IgG level higher than the protein alone. We observed that the IgG
kinetics follows the same tendency independently of adjuvanted used. However, when
rNcSRS2 was associated with oil (montanide), higher IgG level was obtained and the level
was rising up to the 35th day of the experiment. When analyzing the IgG isotype, the data
suggest that after the boost (day 21) occur a modulation towards IgG2a that reach a ratio of
0.4 at day 35. Oil emulsion adjuvants are poorly immunomodulatory (in absence of local
irritant effect), provide good short term depots, are inexpensive, relatively simple to formulate
and induce good antibody responses. The mechanism of action of oil emulsion adjuvants is
poorly understood, although one study suggested a partial requirement for NOD2.19
Nevertheless, because these emulsions are likely to cause cellular damage upon injection, it is
tempting to speculate that endogenous signals released during necrotic cell death may also
contribute to their adjuvant activity. Oil emulsion adjuvants cause the innate immune system
to elicit the signal required for the initiation of an adaptive immune response. They act
forming a depot effect, and trapping the antigen at the site of administration, increasing the
surface area available to the antigen and attracting different kind of cells, principally antigenpresenting cells (APC) and macrophages. This kind of adjuvant is commonly associated with
Th2 responses; however, the increase ratio towards Th1 type of response observed in animals
vaccinated with adjuvant may be explained by the association with rNcSRS2 antigen. One
47
also may suggest that the cytokines (IFN-y, TNF-α and IL-17) up regulated at spleen, by this
association, might have a role in these observations.
Aluminium salts have been widely used in human and veterinary vaccines since 1930,
it has a good safety record of many decades been used successfully in vaccine programs.
15
Alum is known to be a relatively weak adjuvant for recombinant proteins, but works well for
conventional bacterial toxoids. Alum causes cell death and the subsequent release of host
DNA, wich acts as a potent endogenous adjuvant that triggers Th2 responses and strong IgE
responses are frequently reported.14 They are inexpensive, safe, and simple to formulate.16
Alum traditionally was thought to function primarily by forming a long-lasting depot for
antigen and by promoting their uptake by APCs, but it is now clear that innate immune
system plays role in its adjuvancity.11.12 In mice alum is used primarily to enhance antibody
production, with Th2 cell-dependent antibody isotypes, to nearly all protein antigens.
However, the mechanism by which pathogen-derived IFN-γ inducing proteins such as
rNcSRS2 as a protective antigen is intriguing, given that numerous studies suggest that IFN-γ
is one of the most critical cytokines mediating host protection against infection by N. caninum
and T. gondii .13
Xanthan is a polysaccharide derived from the Xanthomonas, the intrinsic adjuvant
properties of xanthan gum as a murine lymphocyte activator was originally described in
1980’s but underexplored later.17 Xanthan gum as biological response modifier enhances
antitumor activity in mice through TLR-4 recognition, this effect can mount an innate
immune response characterized by the production of pro-inflamatory cytokines.20 In other
study, superior IgG serum response was demonstrated in a influenza vaccine using in situ
gelling nasal inserts with xanthan.21 More recently, rLiAni protein associated to xanthan
conferred protection against lethal challenge in the standart Golden Syrian hamster model for
48
leptospirosis.18 So far, there is no evidence to demonstrate how rNcSRS2-induced IFN-γ
functions at the time of antigen priming and other immunoregulatory effects of rNcSRS2 on
antigen-presenting cells and T cells. Regardless of the overall role of rNcSRS2during immune
priming process, its function in enhancing IL-12 and IFN-γ production was taken into
consideration prior to these trials. First of all, it was intended to make use of rNcSRS2 as a
parasite antigen as well as an initiation immunoregulatory molecule by inducing IL-12 and
IFN-γ, which is expected to elicit an antigen-specific immune response to N. caninum and
skew the immune response towards a type 1 phenotype simultaneously.
In the current study, we successfully associate rNcSRS2 adjuvanted with oil, xanthan, and
alumen hydroxide. These showed immune response-enhancing properties and therefore a
potential as vaccine. This strategy presented here may be used to assess others vaccine targets
for the development of an effective subunit vaccine against neosporosis.
ACKNOWLEDGEMENTS
Funding for this study was provided by the Coordenação de Aperfeiçoamento de Pessoal
de Nível Superior (CAPES, grantAUX-PE-PNPD-1513/2008) and the Conselho Nacional de
Desenvolvimento Científico e Tecnológico (CNPq).
REFERENCES
1 Dubey, J.P. 2003. Review of Neospora caninum and neosporosis in animals. Veterinary
Parasitology, v.67, n.1, p. 1-59.
2 Trees, A.J.; Williams, D.J. 2005. Endogenous and exogenous transplacental infection in
Neospora caninum and Toxoplasma gondii. Trends in Parasitology, v.21, p.558-561.
49
3 Gondim, L.F.P; Pinheiro, A.M.; Almeida, M.A.O. 2007. Frequencia de anticorpos antiNeospora em búbalos (Bubalus bubalis) criados no estado da Bahia. Revista Brasileira de
Saúde e Proteção Animal, Salvador, v.8, n.2, p.92-96.
4 Weston, J.F., Heuer, C., & Williamson, N.B. 2012. Efficacy of a Neospora caninum
killed tachyzoite vaccine in preventing abortion and vertical transmission in dairy
cattle. Preventive Veterinary Medicine. 103(2-3), 136-144.
5 Aguado-Martínez, A.; Álvarez-García, G.; Fernández-García, A.; Risco-Castillo, V.;
Marugán-Hernández, V.; Ortega-Mora, L.M. 2009. Failure of a vaccine using
immunogenic recombinant proteins rNcSAG4 and rNcGRA7 against neosporosis in mice.
Vaccine. V. 27, Issue 52, p. 7331–7338.
6 Gonçalves, K.; Andreotti, A.; Paiva, F.; Pontes, J. C. E.; Junior, S. C. L.; Oshiro, L.,
Matos, M. F. 2008. INTERLEUKIN-12 RESPONSE TO NCSRS2 IMMUNIZATION OF
BALB/C MICE AGAINST Neospora caninum. Rev. Bras. Parasitol. Vet., 17, Supl. 1,
215-219.
7 Mckee AS, et al. 2008. Gr1+IL-4-producing innate cells are induced in response to Th2
stimuli and suppress Th1-dependent antibody responses. Int Immunol. 20(5):659–669.
8 Mccartney, S., Vermi. W, Gilfillan, S., Cella, M., Murphy, T.L., Schreiber, R.D.,
Murphy, K.M., Colonna, M. 2009. Distinct and complementary functions of MDA5 and
TLR3 in poly(I:C)-mediated activation of mouse NK cells. J Exp.Med. 206:2967-2976.
PM:19995959.
9 O'hagan DT, De Gregorio E. 2009. The path to a successful vaccine adjuvant--'the long
and winding road'. Drug Discov Today, p. 541-51.
10 Pinheiro, A. F., Borsuk, S., Berne, M. E. A., Pinto, L. S., Andreotti, R., Roos, T.,
Rollof, B. C., Leite, F. P. L. 2013. Expression of Neospora caninum NcSRS2 surface
protein in Pichia pastoris and its application for serodiagnosis of Neospora infection.
Pathogens and global health.
11 Lambrecht, B.N. et al. 2009. Mechanism of action of clinically approved adjuvants. Curr.
Opin. Immunol. 21, 23–29.
12 Marrack. P., Mckee, A.S., Munks, M.W. 2009. Towards na understanding of the
adjuvant action of aluminion. Nat. Ver. Immunol. V.9, p.287-293.
13 Tuo W, Fetterer R, Jenkins M, Dubey JP. 2005. Identification and characterization of
Neospora caninum cyclophilin that elicits gamma interferon production. Infect
Immun.73(8):5093-100.
14 Marichal et al. 2011. DNA released from dying host cells mediates aluminum adjuvant
activity. Nat. Med. 17, 996.
15 Clements CJ, Griffiths E. 2002. The global impact of vaccines containing aluminium
adjuvants. Vaccine 20, Suppl 3: S24-S33.
50
16 Baylor NW, Egan W, Richman P. Aluminium salts in vaccines-US perspective. Vaccine
20, Suppl 3: S18-S23.
17 Ishizaga S, Sugawara I, Hasuma T, Morisawa S, Moller G. Immune responses to
xanthan gum. I. The characteristics of lymphocyte activation by xanthan gum. Eur J
Immunol 13: 225-231. 10.1002/eji.1830130309 [doi].
18 Bacelo KL, Hartwig DD, Seixas KF, Schuch R, Moreira SA, Amaral M, Collares T,
Vendrusculo TC, Dellagostin AO. 2013. Xanthan as adjuvant in a LigA recombinant
subunit vaccine afford protection against leptospirosis. Unidade de Biotecnologia, UFPel.
19 Moreira, L.O., Smith, A.M., DeFreitas, A.A., Qualls, J.E., El Kasmi, K.C., Murray,
P.J. 2008. Modulation of adaptive immunity by different adjuvant-antigen combinations
in mice lacking Nod2. Vaccine 26, 5808-5813.
20 Takeuchi A, Kamiryou Y, Yamada H, Eto M, Shibata K, Haruna K, Naito S,
Yoshikai Y. 2009. Oral administration of xanthan gum enhances antitumor activity
through Toll-like receptor 4. Int. Immunopharmacol 9: 1562-1567.
21 Bertram U, Bernard MC, Haensler J, Maincent P, Bodmeier R. 2010. In situ gelling
nasal inserts for influenza vaccine delivery. Drug Dev Ind Pharm 36: 581-593.
51
Figure 1. Western Blot using recombinant NcSRS2 protein expressed in P. pastoris system.
The recombinant protein reacted with sera of animals naturally infected with N. caninum.
Marker molecular weight full range rainbow (GE). (1) Bovine positive sera diluted at 1:100.
Figure 2. Immune response induced by recombinant vaccines evaluated by ELISA (IgG
levels total).
Figure 3. Immune response induced by recombinant vaccines evaluated by ELISA (IgG1 and
IgG2 levels).
Figure 4. Evaluation by qPCR the cytokine expression pattern of different adjuvants used in
vaccination.
Table 1. Primer sequence of cytokines.
52
Table 1.
Primers
Forward
Reverse
IL-4
CCAAGGTGCTTCGCATATTT
ATCGAAAAGCCCGAAAGAGT
IL-10
TTTGAATTCCCTGGGTGAGAA
ACAGGGGAGAAATCGATGACA
IL-12
AGCACCAGCTTCTTCATCAGG
CCTTTCTGGTTACACCCCTCC
IL-17
GCTCCAGAAGGCCCTCAGA
AGCTTTCCCTCCGCATTGA
TNF-α
GCGGTGCCTATGTCTCAG
GCCATTTGGGAACTTCTCATC
INF-γ
GCGTCATTGAATCACACCTG
TGAGCTCATTGAATGCTTGG
β-actina
AACGCCCTTCATTGAC
TCCACGACATACTCAGCAC
53
Figure 1.
54
Figure 2.
55
Figure 3.
56
Figure 4.
57
5 Conclusões Gerais
a) a proteína recombinante NcSRS2 de Neopora caninum foi expressa na
forma solúvel em Pichia pastoris;
b) o ELISA indireto desenvolvido com a rNcSRS2 apresentou resultados de
especificidade e sensibilidade acima de 90% em ovinos e cães;
c) na forma de antígeno vacinal a proteína rNcSRS2 foi capaz de induzir
resposta imune celular e humoral específica em camundongos.
58
6 Referências
AGRONEGÓCIO BRASILEIRO. Brasil projeções do agronegócio. Disponível em:
<http://www.agricultura.gov.br/arq_editor/file/Ministerio/gestao/projecao/PROJECOE
%20DO%20AGRONEGOCIO%202010-11%20a%202020-21%20-%202_0.pdf>.
ANDREOTTI, R.; LOCATELLI-DITTRICH, R.L.; SOCCOL, V.T.; PAIVA, F.
Diagnóstico e controle da neosporose em bovinos. Campo Grande: Embrapa,
(Documentos 136), 51p. 2003.
BASSO W, SCHARES S, et al. Microsatellite typing and avidity analysis suggest a
common source of infection in herds with epidemic Neospora caninum-associated
bovine abortion. Vet. Parasitol. 173 (1-2): 24-31. 2010.
BJÖRKMAN, C.; UGGLA, A. Serological diagnosis of Neospora caninum infection.
International Journal for Parasitology, Oxford, v.29, p.1497-1507, 1999.
BOETTNER M., PRINZ B., HOLZ C., STAHL U., LANG C. High-throughput screening
for expression of heterologous proteins in the yeast Pichia pastoris. J. Biotechnol. 99:
51–62. 2002.
BORSUK, S.; ANDREOTTI, R.; LEITE, F. P. L.; PINTO, L. da S.; SIMIONATTO, S.;
HARTEBLEN, C. P.; GOETZEC, M.; OSHIROB, L. M.; MATOS, M. de F. C.; BERNE,
M. E. A. Development of an indirect ELISA-NcSRS2 for detection of Neospora
caninum antibodies in cattle. Veterinary Parasitology, v.177, p. 33-38. Issues 1-2.
2011.
CHOI D.B., PARK, E.Y. Enhanced production of mouse α-amilase by feeding
combined nitrogen and carbon sources in fed-batch culture of recombinant Pichia
pastoris. Process Biochemistry - In press- 2005.
COS, O., SERRANO, A., MONTESINOS, J.L., FERRER, P., CREEG, J.M.,
VALERO, F. Combined effect of the methanol utilization (Mut) phenotype and gene
dosage on recombinant protein production in P. pastoris fed-batch culture. Journal of
Biotechnology, 116: 321 – 335. 2005.
CREEG, J. M. Expression in the methilotrophic yeast Pichia pastoris. Gene
expression systems: using nature for the art of expression. Edited by Joseph M.
Fernandez and James P Hoeffler. Academic Press, p. 157-209. 1999.
DAMASCENO, L. M. Produção de estreptavidina em Pichia pastoris e sua
imobilização em sílica biotinilada. Dissertação. Viçosa, UFV. 2001.
HALDORSON, G. J.; MATHISON, B. A.; WENBERG, K.; CONRAD, P.A.; DUBEY,
J.P.; TREES, A. J.; YAMANE, I.; BASZLER, T. V. Immunization with native surface
59
protein NcSRS2 induces a Th2 immune response and reduces congenital Neospora
caninum transmission in mice. International Journal for Parasitology, v. 35, p.14071415. 2005.
HEMPHILL, A. & GOTTSTEIN, B. Identification of a major surface protein on
Neospora caninum tachyzoites. Parasitol Res 82, 497-504. 1996.
HEMPHILL, A.; FELLEISEN, R.; CONNOLLY, B.; GOTTSTEIN, B.; HENTRISH, B.;
MULLER, N. Characterization of a cDNA-clone encoding Nc-p43, a major Neospora
caninum tachyzoite surface protein. Parasitology 115 p.581-590, 1997.
INNES, E.A. et al. Immune responses to Neospora caninum and prospects for
vaccination. Trends in Parasitology, v.18, p.497- 504, 2002.
INNES, E. A. et al. The host-parasite relationship in bovine neosporosis. Veterinary
Immunology and Immunopathology, v. 108, n. 1-2, p. 29-36. 2005.
INSTITUTO BRASILEIRO DE GEOGRAFIA E ESTATISTICA Pesquisa pecuária
municipal, efetivo dos rebanhos brasileiros. Disponível em: <http://www.ibge.gov.br/
home/estatistica/pesquisas/pesquisa_resultados.php?id_pesquisa=21>. Acesso em
5 jan. 2012.
MOORE, D.P., et al. Immune response to Neospora caninum native antigens
formulated with immune stimulating complexes in calves. Veterinary Parasitology.
Amsterdam, v. 175, n. 3/4, p. 245-251. Feb. 2011.
NISHIKAWA Y, KOUSAKA Y, TRAGOOLUA K, XUAN X, MAKALA L, FUJISAKI K,
MIKAMI T, & NAGASAWA H. Characterization of Neospora caninum surface protein
NcSRS2 based on baculovirus expression system and its application for
serodiagnosis of Neospora infection. J Clin Microbiol 39, 3987-3991. 2001.
NISHIKAWA Y, CLAVERIA FG, FUJISAKI K, & NAGASAWA H. Studies on
serological cross-reaction of Neospora caninum with Toxoplasma gondii and
Hammondia heydorni. J Vet Med Sci 64, 161-164. 2002.
NISHIKAWA, Y., INOUE, N., MAKALA, L. & NAGASAWA, H. A role for balance of
interferon-gamma and interleukin-4 production in protective immunity against
Neospora caninum infection. Veterinary Parasitology 116, 175-84. 2003.
PINHEIRO, A. F., BORSUK, S., BERNE, M. E. A., PINTO, L. S., ANDREOTTI, R.,
ROOS, T., ROLLOF, B. C., LEITE, F. P. L. Expression of Neospora
caninum NcSRS2 surface protein in Pichia pastoris and its application for
serodiagnosis of Neospora infection. Pathogens and global health. Apr. 2013.
ROJO-MONTEJO, S. et al. Isolation and characterization of a bovine isolate of
Neospora caninum with low virulence. Veterinary Parasitology. Amsterdam. V.159,
n.1, p. 7-16, Jan. 2009.
SCHARES, G.; RAUSER, M.; SÖNDGEN, P.; REHBERG, P.; BÄRWALD, A.;
DUBEY, J. P.; EDELHOFER, R.; CONRATHS, F. J. Use of purified tachyzoite
60
surface antigen p38 in an ELISA to diagnose bovine neosporosis. International
Journal for Parasitology, v. 30, p. 1123-1130, 2000.
SON, E. S.; AHN, H. J.; KIM, J. H.; KIM, D. Y.; NAM, H. W. Determination of
antigenic domain in GST fused major surface protein (Nc-p43) of Neospora caninum.
The Korean Journal of Parasitology, v. 39, n. 3, p. 241-246, 2001.
SONDA, S.; FUCHS, N.; CONNOLLY, B.; FERNANDEZ, P.; GOTTSTEIN, B.;
HEMPHILL, A. The major 36Kda Neospora caninum tachyzoite surface protein in
closely related to the major Toxoplasma gondii surface antigen. Molecular and
Biochemical Parasitology, v. 97, p. 97-108, 1998.
STASKA, L.M. et al. Identification of vaccine candidate peptides in the NcSRS2
surface protein of Neospora caninum by using CD4+ cytotoxic T lymphocytes and
gamma interferon-secreting T lymphocytes of infected holstein cattle. Infect. Immun.
73, 1321-1329. 2005.
TREES, A.J., WILLIAMS, D.J. Endogenous and exogenous transplacental infection
in Neospora caninum and Toxoplasma gondii. Trends in Parasitology, v.21, p.558561. 2005.
YILDS, K. et al. Seroprevalence of Neospora caninum in dairy cattle ranches with
high abortion rate: special emphasis to serologic co-existence with Toxoplasma
gondii, Brucella abortus and Listeria monocytogenes. Veterinary Parasitology.
Amsterdam. V. 164, n 2/4, p. 306-310, Oct. 2009.
WAPENAAR, W. et al. Comparison of serological methods for the diagnosis of
Neospora caninum infection in cattle. Veterinary Parasitology. Amsterdam. V. 143, n.
2, p. 166-173, Jan. 2007.
WILLIAMS, D. J., C. S. GUY, J. W. McGARRY, F. GUY, L. TASKER, R. F. SMITH, K.
MacEACHERN, P. J. CRIPPS, D. F. KELLY, and A. J. TREES. Neospora caninumassociated abortion in cattle: The time of experimentally-induced parasitaemia during
gestation determines foetal survival. Parasitology 121:347–358. 2000.
61
62