ISSN 0103-4065
ISSN ON-LINE 2177-8264
Jornal Brasileiro de Doenças Sexualmente Transmissíveis
Volume 25
No 1
www.dst.uff.br
2013
Brazilian Journal of Sexually Transmitted Diseases
BJSTD
25 years publishing
new scientific
knowledge.
Official Organ of the Brazilian Society for Sexually Transmitted Diseases
Official Organ of the Latin American and Caribbean for Control of STDs
official organ for Latin America Union Against International Sexually Transmitted Infections
Official Organ of the Sector Sexually Transmitted Diseases / MIP / CMB / CCM / Fluminense Federal University
VOLUME 25
No 1 2013
Contents
Editorial
Neisseria gonorrhoeae Is Evolving into a ‘Superbug’ – what Measures Can Be Implemented to Combat the
Emergence of Multi-drug and Extensively-drug Resistant Gonorrhoea in Latin America and Globally?....................3
Magnus Unemo, Jo-Anne R Dillon, Davd Lewis
notE OF THE editors..............................................................................................................................................................................................6
Mauro Romero L Passos, Angelica E Miranda, José Eleutério Junior, Mariangela Silveira, Paulo César Giraldo, Newton Sergio de Carvalho
ARTICLES
Epidemiological Analysis of Congenital Syphilis in the State of Ceará, Brazil...............................................................7
Hellen Lívia O Catunda, Igor C Mendes, Erison T Oliveira, Elizian BR Bernardo, Karine C Bezerra, Deise Maria N Sousa,
Lara L Oliveira, Camila C Costa, Ana Kelve C Damasceno
Comparison Between Two Methods for Molecular Characterization of Human Papillomavirus......................13
Ludmila Entiauspe, Emily Nunes, Tiago Collares, Mariângela F Silveira, Fabiana Seixas
Behavioural Differences between Users Seeking HIV Testing at Testing and Counseling
Center in the Montes Claros City, Minas Gerais................................................................................................................................16
Ana Paula F Holzmann, Sônia Maria O Barros, Maria José R Vaz, Valdete da Silva, Clara de Cássia Versiani, Edna FG Ruas
Incidence of Congenital Syphilis in a Metropolitan Region of Rio de Janeiro State: Social Inequalities.......21
Sandra C Fonseca, Letícia M Oliveira, Natalia MR Almeida, Katia S Silva, Pauline Lorena Kale
HIV Pregnant Women with More than One Pregnancy and the Use of Antiretroviral During
Pre-natal Care and Childbirth....................................................................................................................................................................26
Dai Chengyao & Lucia YI Nichiata
Antimicrobial Resistance in Neisseria gonorrhoeae Isolates from Ribeirão Preto, São Paulo, Brazil...............31
Marta Inês C Medeiros, Jaqueline O Silva, Ana Maria M Carneiro, Silvia Helena C Reche, Luiz Sérgio D´O Rocha, Paulo da Silva
Vulvovaginitis and the Treatment of Asymptomatic Partners: A Systematic Review and Metanalisis.............36
Paulo César Giraldo, Hugo Marcus Rodrigues, Amanda G Melo, Rose Luce do Amaral, Mauro Romero L Passos, José Eleutério Junior,
Ana Katherine Gonçalves
Virological and Epidemiological Aspects of Anal Carcinoma: Current and Future Challenges.......................41
Elisabete Aida R Dobao & Silvia Maria B Cavalcanti
SHORT COMMUNICATION
Genital Ulcer Signaling Recent Syphilis in an HIV Infected Patient: the Diagnosis Challenge............................46
Eliane de Dios Abad, Ana Beatriz A Queiroz, Aline DT Oliveira, Fernanda S Cavalcante, Hercília Regina A Montenegro,
Márcia Ribeiro, Dennis C Ferreira
EVENTS
ADS...............................................................................................................................................................................................................................47
DST - J bras Doenças Sex Transm 2013;25(1):1-2 - ISSN: 0103-4065 - ISSN on-line: 2177-8264
Official Organ of the
Sector Sexually Transmitted
Diseases
Official Organ of the Latin American and
Caribbean for Control of STDs
President: Patrícia J. Garcia (Peru)
Official Organ of the Brazilian
Society for Sexually Transmitted
Diseases
Av. Roberto Silveira, 123 - Niterói - RJ - Brasil
CEP: 24230-150 - Tel.: + 55 (21) 2710-1549
www.dst.uff.br
SBDST Board (2013-15)
President:
Angelica Espinosa Miranda (ES)
Vice-President:
Sinesio Talhari (AM)
1o Secretary:
Valeria Saraceni (RJ)
Outeiro de S. João Batista, s/no
Campus do Valonguinho - Centro
Niterói - RJ - 24210-150 - Brasil
Tel.: +55 (21) 2629-2495 - 2629-2494
Fax: +55 (21) 2629-2507
E-mail: [email protected]
www.dst.uff.br
DST - BJDST is the official organ
for Latin America
Union Against International
Sexually Transmitted Infections (IUSTI)
President:
David Lewis
Secretary General:
Janet D. Wilson
Affiliated to the
Brazilian Association
of Scientific Editors
Rector of UFF:
Roberto de Souza Salles
Vice-Rector:
Sidney Mello
Provost of Research, Post-Graduate and Innovation:
Antonio Claudio Lucas da Nóbrega
Chief of DST Sector:
Mauro Romero Leal Passos
2o Secretary:
Valdir Monteiro Pinto (SP)
1o Treasurer:
Tomas Barbosa Isolan (RS)
2o Treasurer:
Roberto José Carvalho Silva (SP)
Scientific Director:
Mariangela Freitas da Silveira (RS)
Supervisory Board:
Mauro Romero Leal Passos (RJ)
Teresinha Tenorio da Silva (PE)
Rosane Figueiredo Alves (GO)
REGIONAL SBDST:
REGIONAL AMAZONAS
President: José Carlos Gomes Sardinha
REGIONAL BAHIA
President: Roberto Dias Fontes
REGIONAL DISTRITO FEDERAL
President: Luiz Fernando Marques
REGIONAL ESPÍRITO SANTO
President: Sandra Fagundes Moreira Silva
REGIONAL GOIÁS
President: Waldemar Tassara
REGIONAL PARANÁ
President: Newton Sergio de Carvalho
Editorial Board
Editor-in-Chief:
Mauro Romero Leal Passos (RJ)
Editors:
José Eleutério Junior (CE)
Angelica Espinosa Miranda (ES)
Mariângela Silveira (RJ)
Newton Sérgio de Carvalho (PR)
Paulo César Giraldo (SP)
Assistant Editors:
Dennis de Carvalho Ferreira (RJ)
Felipe Dinau Leal Passos (RJ)
Mariana Dinau Leal Passos (RJ)
Editorial Board:
Adele Schwartz Benzaken (AM)
Geraldo Duarte (SP)
Gesmar Volga Haddad Herdy (RJ)
Gutemberg Leão de Almeida Filho (RJ)
Iara Moreno Linhares (SP)
Ivo Castelo Branco Coêlho (CE)
Ledy do Horto dos Santos Oliveira (RJ)
Maria Luiza Bezerra Menezes (PE)
Mauro Cunha Ramos (RS)
Rosane Figueiredo Alves (GO)
Tomaz Barbosa Isolan (RS)
Vandira Maria dos Santos Pinheiro (RJ)
Walter Tavares (RJ)
REGIONAL RIO DE JANEIRO
President: Mauro Romero Leal Passos
International Editorial Board:
Alícia Farinati (Argentina)
Enrique Galbán García (Cuba)
Peter Piot (UNAIDS-Suíça)
Rui Bastos (Moçambique)
Steven Witkin (EUA)
REGIONAL RIO GRANDE DO NORTE
President: Ana Katherine Goncalves
Edition Assistant:
Priscilla Madureira (RJ)
REGIONAL PERNAMBUCO
President: Iara Coelho
REGIONAL RIO GRANDE DO SUL
President: Mauro Cunha Ramos
REGIONAL SÃO PAULO
President: Valdir Pinto
DST - J bras Doenças Sex Transm 2013;25(1):1-2
Secretary:
Dayse Felício (RJ)
Publication and Copydesk:
Milton Pereira (RJ)
Priscila Vieira Cardoso (RJ)
Editora da Universidade Federal Fluminense
www.editora.uff.br
Matters signed and published in
DST - Brazilian Journal of Sexually Transmitted Diseases
are solely the responsibility of their respective authors and
do not necessarily reflect the opinion of the editors.
Targeting and Distribution:
DST - Brazilian Journal of Sexually Transmitted Diseases
is directed to members of SBDST, subscribers, libraries,
reference centers, gynecologists, urologists, infectious
disease specialists, dermatologists, clinicians, family health
programs and entities with an agreement. It is quarterly
with a circulation of 3,000 copies.
Exchange requested - Pode-se permuta
On prie l’échange - Se solicita ei caxzje
Mau bitet nu Austausch - Si prega lo escambo
All content of the whole collection since 1989 is
available for free on the World Wide Web at
www.dst.uff.br
Indexing:
LILACS EXPRESS Latin American Literature in
Health Sciences, The Library of Congress
WC – 140
Since the references are given in full (name of the article,
all authors names, journal name, year, volume, page
numbers and the site: www.dst.uff.br), the reproduction is
allowed in whole or in part, just one copy of this journal,
for personal use only, never for commercial purposes.
Editorial
Neisseria gonorrhoeae Is Evolving into a ‘Superbug’ – what
Measures Can Be Implemented to Combat the Emergence
of Multidrug and Extensively-drug Resistant Gonorrhoea in
Latin America and Globally?
Infections with Neisseria gonorrhoeae remains an important
public health concern worldwide. In 2008, the World Health Organization (WHO) estimated the global burden of gonorrhoea among
adults to be 106 million cases, which represented a 21% increase
since 2005. Most of those cases (64%) were in the WHO Western
Pacific Region (42 million cases) and WHO South-East Asia Region (25 million cases), however, 11 (10%) million cases were in
the WHO Region of the Americas (including both North America
and Latin America)(1). Gonorrhoea may result in pelvic inflammatory disease, ectopic pregnancy, infertility and enhanced transmission of HIV. These complications cause substantial morbidity and
economic costs, particularly in those resource-poor regions of the
world where gonorrhoea is most prevalent.
Public health control of gonorrhoea requires treatment with
appropriate antimicrobials, as well as generalized and targeted
prevention efforts, use of reliable diagnostics, effective partner
notification processes and quality-assured surveillance activities.
Antimicrobial therapy should cure individual cases in order to reduce the risk of complications and prevent further transmission of
the infection. However, from the beginning of the antimicrobial
era (1930s), N. gonorrhoeae has consistently shown its extraordinary genetic capacity to develop antimicrobial resistance (AMR)
to all drugs introduced for treatment of gonorrhoea(2-4). Currently,
in most countries globally the extended-spectrum cephalosporins
(ESCs) cefixime (oral) and ceftriaxone (injectable) are the only
remaining antimicrobials recommended for monotherapy. However, treatment failures, particularly with cefixime but also more
rarely with ceftriaxone, have been verified in Japan, Australia,
several European countries, South Africa and Canada(4-7).
Furthermore, it is of most grave concern that the three first
extensively-drug resistant (XDR)(2) N. gonorrhoeae strains, which also display high-level ceftriaxone resistance, have now been
verified. These XDR N. gonorrhoeae strains were identified in
high-risk frequently transmitting populations, i.e. a commercial
sex worker (CSW) and men-who-have-sex-with-men (MSM),
and their isolation raises concern that gonorrhoea may become
untreatable in the future(4). The gonococcus may thus be evolving into a ‘superbug’ and, in order to meet the many public
health challenges associated with the emergence and spread of
DOI: 10.5533/DST-2177-8264-201325101
both multidrug resistant (MDR) and XDR N. gonorrhoeae, the
WHO has recently published a global action plan(8). In addition,
the European Centre for Disease Prevention and Control(9) and the
US Centers for Disease Control and Prevention(10) have published
regional response plans. Furthermore, dual antimicrobial treatment regimens for uncomplicated anogenital gonorrhoea have
been introduced in the USA(11) and Europe(12). Those dual antimicrobial therapies mainly recommend single-dose combinations of
intramuscular ceftriaxone (250-500 mg) together with oral azithromycin (1-2 g).
One key component of the international action/response
plans(8-10) is to enhance the timely and quality-assured surveillance of AMR (preferably using WHO gonococcal control
strains(13)) and treatment failures. This is imperative because
gonococcal AMR data are lacking in many settings and the true
global problem remains unknown. In 2009, the WHO’s Global
Gonococcal Antimicrobial Surveillance Programme (GASP) was
revitalized, in close liaison with other existing AMR surveillance
programmes. The WHO Global GASP network aims to recruit
laboratories worldwide to monitor quality-assured gonococcal
AMR data (with particular attention to ESCs), to provide support
to establish gonococcal culture and AMR testing, to inform public health authorities and treatment guidelines on trends in gonococcal AMR, to optimize early detection of emerging resistance
and, finally, to identify and verify treatment failures with ESCs.
Worryingly, longitudinal quality-assured gonococcal AMR surveillance programmes remain sporadic, limited or even lacking
in large parts of many regions worldwide, including Eastern Europe, Central Asia and Africa as well as Latin America and the
Caribbean (LAC). These regions also suffer from a high burden
of gonorrhoea, creating the prerequisites for rapid emergence and
spread of gonococcal AMR.
In LAC, a strong and quality-assured GASP was established
in the 1990s(14) and there have been recent attempts to revitalize this GASP network. The connections and programmes of the
GASP-LAC have been maintained in many LAC countries, and,
in response to the WHO 2009 call for revitalization, the GASP-LAC regional network has been renewed(15,16). Several countries
in Latin America have on-going national GASP networks. Gono-
DST - J bras Doenças Sex Transm 2013;25(1):3-5 - ISSN: 0103-4065 - ISSN on-line: 2177-8264
4
coccal AMR surveillance efforts, such as the one reported from
Brazil in the current issue by Medeiros et al., will help catalyse
enhanced regional and national GASP networks that are important not only for Brazil, but also for the entire LAC region. Recent GASP-LAC surveillance established that several countries
in the region, including Brazil, still recommend ciprofloxacin for
the treatment of gonococcal infections(15). The paper by Medeiros
et al., which reports on high percentages of isolates resistant to
ciprofloxacin, underscores the importance of GASP surveillance
to inform the development and implementation of updated treatment guidelines for gonorrhoea infections. It is also notable that
early GASP regional surveillance in Brazil also reported the first
emerging resistance to azithromycin, a trend that has continued
and is reflected in the Medeiros paper(17). Based on the results reported by Medeiros et al., although the sample size of isolates was
low, it appears that ceftriaxone might be the only antimicrobial that
can be recommended for national first-line empiric monotherapy of
gonorrhoea in Brazil.
Recently, Brazil banned the sale of over-the counter antibiotics,
an essential first step in ensuring the prudent use of antibiotics for
treatment. In addition, well-conducted microbiological surveys or,
ideally, a sustainable national GASP network, testing substantial
numbers of consecutive non-selected gonococci from multiple
sites within a country, should provide the evidence base for local and national treatment guidelines. To achieve this, it is essential to strengthen and further develop regional and national capacity
to undertake gonococcal culture and AMR testing. This requires
substantial political will and funding as well as an investment in
laboratory infrastructure and staff training. Brazil may now be ready to undertake this national challenge (Franchini M, personal
communication).
Although enhanced surveillance of gonococcal AMR and treatment failures are critical, more holistic views and actions are
required to truly combat the emergence and spread of possibly untreatable gonorrhoea nationally and internationally. Substantially
enhanced and broad disease control activities (i.e., improved prevention, better diagnostics, effective treatment and surveillance) are
needed to reduce the global burden of gonorrhoea combined with
the implementation of wider strategies for general antimicrobial
control (such as guidelines for antimicrobial use, appropriate selection of therapeutic agents, uninterrupted supplies and quality of
generic drugs), sustainable implementation of most components
of the action/response plans and an increased awareness among
clinicians, microbiologists, epidemiologists and policy-makers
in respect of the public health threat of MDR/XDR gonorrhoea.
Internationally, there is an urgent need for an enhanced focus on
reducing gonorrhoea burden in high-risk frequently transmitting
populations (such as CSWs and MSM) as well as appropriate diagnosis and treatment of pharyngeal gonorrhoea, which is harder to
eradicate and is an asymptomatic reservoir for gonorrhoea and
emergence of AMR.
DST - J bras Doenças Sex Transm 2013;25(1):3-5
UNEMO et al.
In conclusion, essential public health actions are required to retain gonorrhoea as a treatable infection including enhanced awareness; implementing action/response plans for potentially untreatable gonorrhoea infections nationally and globally; enhancing
surveillance of gonococcal antimicrobial resistance, treatment
failures and antimicrobial use/misuse; and improving both prevention and early diagnosis and treatment of gonorrhoea in index cases
and their sexual contacts. Unfortunately, all these actions are likely
only to mitigate the spread of MDR and XDR N. gonorrhoeae in
the short-term. It thus remains imperative to develop novel treatment strategies, new antimicrobial agents (or other compounds)
and ideally a vaccine for effective treatment and prevention of gonorrhoea in the longer term.
MAGNUS UNEMO
Assoc. Professor, Director
WHO Collaborating Centre for Gonorrhoea and other STIs
Örebro University Hospital
Örebro, Sweden
E-mail: [email protected]
JO-ANNE R DILLON
Professor
Department of Microbiology and Immunology,
College of Medicine
Director Focal Point for the GASP in
Latin America and the Caribbean
University of Saskatchewan
Saskatoon, Saskatchewan
Canada
E-mail: [email protected]
DAVID LEWIS
Professor, Head
Centre for HIV and Sexually Transmitted Infections
National Institute for Communicable Diseases
National Health Laboratory Service
Johannesburg, South Africa
E-mail: [email protected]
REFERENCES
1.
2.
World Health Organization: Global incidence and prevalence of selected curable sexually transmitted infections - 2008. Geneva: World
Health Organization; 2012. Available from: http://www.who.int/reproductivehealth/publications/rtis/2008_STI_estimates.pdf (accessed 25
September, 2013).
Tapsall JW, Ndowa F, Lewis DA, Unemo M. Meeting the public health
challenge of multidrug- and extensively drug-resistant Neisseria gonorrhoeae. Expert Rev Anti Infect Ther. 2009;7:821-34.
Neisseria gonorrhoeae Is Evolving into a ‘Superbug’ – what Measures Can Be Implemented to Combat the Emergence of Multi-drug...
3.
Lewis DA. The gonococcus fights back: is this time a knock out? Sex
Transm Infect. 2010;86:415-21.
4. Unemo M, Nicholas RA. Emergence of multidrug-resistant, extensively drug-resistant and untreatable gonorrhea. Future Microbiol.
2012;7:1401-22.
5. Lewis DA, Sriruttan C, Müller EE, Golparian D, Gumede L, Fick D et
al. Phenotypic and genetic characterization of the first two cases of extended-spectrum-cephalosporin-resistant Neisseria gonorrhoeae infection
in South Africa and association with cefixime treatment failure. J Antimicrob Chemother. 2013;68:1267-70.
6. Allen VG, Mitterni L, Seah C, Rebbapragada A, Martin IE, Lee C et al.
Neisseria gonorrhoeae treatment failure and susceptibility to cefixime in
Toronto, Canada. JAMA. 2013;309:163-70.
7. Chen YM, Stevens K, Tideman R, Zaia A, Tomita T, Fairley CK et al. Failure of ceftriaxone 500 mg to eradicate pharyngeal gonorrhoea, Australia.
J Antimicrob Chemother. 2013;68:1445-7.
8. World Health Organization (WHO). Global action plan to control the
spread and impact of antimicrobial resistance in Neisseria gonorrhoeae.
WHO, Geneva, Switzerland. 2012. Available from: http://whqlibdoc.who.
int/publications/2012/9789241503501_eng.pdf (accessed 25 September
2013).
9. European Centre for Disease Prevention and Control (ECDC). Response
plan to control and manage the threat of multidrug-resistant gonorrhoea
in Europe. ECDC, Stockholm, Sweden. 2012. Available from: www.ecdc.
europa.eu/en/publications/Publications/1206-ECDC-MDR-gonorrhoea-response-plan.pdf (accessed 25 September 2013).
10. Centers for Disease Control and Prevention (CDC). A public health response plan for the United States. CDC, Atlanta, Georgia, USA. 2012.
Available from: www.cdc.gov/std/gonorrhea/default.htm (accessed 25
September 2013).
5
11. Centers for Disease Control and Prevention (CDC). Update to CDC’s
sexually transmitted diseases treatment guidelines, 2010: Oral cephalosporins no longer recommended for treatment of gonococcal infections.
MMWR Morb Mortal Wkly Rep. 2012;61:590-4.
12. Bignell C, Unemo M; on behalf of the European STI Guidelines Editorial
Board. 2012 European guideline on the diagnosis and treatment of gonorrhoea in adults. Int J STD AIDS. 2013;24:85-92.
13. Unemo M, Fasth O, Fredlund H, Limnios A, Tapsall J. Phenotypic and genetic characterization of the 2008 WHO Neisseria gonorrhoeae reference
strain panel intended for global quality assurance and quality control of
gonococcal antimicrobial resistance surveillance for public health purposes. J Antimicrob Chemother. 2009;63:1142-51.
14. Dillon JR, Ruben M, Li H, Borthagaray G, Marquez C, Fiorito S et al.
Challenges in the control of gonorrhea in South America and the Caribbean: monitoring the development of resistance to antibiotics. Sex Trans
Dis. 2006;333:87-95.
15. Starnino S, Galarza P, Carvallo ME, Benzaken AS, Ballesteros AM et
al.; GASP-LAC Working Group. Retrospective analysis of antimicrobial
susceptibility trends (2000-2009) in Neisseria gonorrhoeae isolates from
countries in Latin America and the Caribbean shows evolving resistance
to ciprofloxacin, azithromycin and decreased susceptibility to ceftriaxone.
Sex Transm Dis. 2012;39:813-21.
16. Dillon JR. Sustainable antimicrobial surveillance programs essential for controlling Neisseria gonorrhoeae superbug. Sex Transm Dis.
2011;38:899-901.
17. Dillon JR, Rubabaza JP, Benzaken AS, Sardinha JCG, Li H, Bandeira
MGC et al. Reduced susceptibility to azithromycin and high percentages
of penicillin and tetracycline resistance in Neisseria gonorrhoeae isolates
from Manaus, Brazil, 1998. Sex Trans Dis. 2001;28:521-6.
DST - J bras Doenças Sex Transm 2013;25(1):3-5
Note of the Editors
From this issue, 25 (1), 2013, we will publish the Brazilian Journal of STD, online edition, ISSN: 2177-8264,
all in English.
In the printed version, ISSN: 0103-4065, we will continue to publish in the original language of submission of
articles (Portuguese, Spanish, English).
Thus, we are working to expand our indexes, in order to increase the visibility of our authors and our articles.
We would like to ask the readers and contributors to disseminate this initiative.
Sincerely,
Mauro Romero Leal Passos
Angelica Espinosa Miranda
José Eleutério Junior
Mariangela Silveira
Paulo César Giraldo
Newton Sergio de Carvalho
DST - J bras Doenças Sex Transm 2013;25(1):6 - ISSN: 0103-4065 - ISSN on-line: 2177-8264
ARTICLE
Epidemiological Analysis of Congenital Syphilis in the State
of Ceará, Brazil
Hellen Lívia O Catunda1, Igor C Mendes1, Erison T Oliveira1, Elizian BR Bernardo1, Karine C Bezerra1, Deise
Maria N Sousa2, Lara L Oliveira2, Camila C Costa3, Ana Kelve C Damasceno4
ABSTRACT
Introduction: congenital syphilis is a systemic infectious disease of chronic evolution caused by the Treponema pallidum bacterium dissemination to
the fetus through the placenta of infected pregnant women untreated or treated improperly, occurring at any stage of pregnancy or clinical stage of the
disease. Objective: epidemiological analysis of congenital syphilis in the State of Ceará from 2007 to 2010. Methods: documentary study conducted in
March, 2013, through the database available at the Center for Information and Analysis in Health which keep the information about the National System
of Notifiable Diseases records. There were 1,577 notifications of congenital syphilis cases. Results: the following results were observed: 71.78% (n =
1,132) of women who had their children diagnosed with congenital syphilis attented to prenatal consultation; 46.16% (n = 728) had a diagnosis of syphilis
identified only during delivery/curettage; about 69.5% (n = 1,096) of pregnant women partners did not undergo any treatment for congenital syphilis. It
was noted that over 90% of children were diagnosed with congenital syphilis until the sixth day of birth, and the most prevalent final classification was
recent syphilis with 83.83% (n = 1,322) of cases. The most common clinical evolution for children had a favorable outcome, as more than 75% of them
underwent treatment and remained alive during the studied period. Conclusion: the thorough analysis of congenital syphilis cases and the factors involved
in the process are of fundamental importance to support the actions to prevent and control the disease.
Keywords: syphilis, congenital syphilis, health surveillance, STD, prenatal.
INTRODUCTION
Congenital syphilis is a systemic infectious disease of chronic
evolution subject to acute outbreaks and latency periods when left
untreated. It is caused by the dissemination of Treponema pallidum
bacterium to the fetus by placental route through the untreated or
improperly treated infected mother, and may occur at any phase of
gestation or clinical stage of the disease(1).
Although syphilis is a disease of easy diagnosis and effective
treatment of pregnant women, its mother-to-child transmission is
still considered a public health problem due to the high frequency
of serious effects on the pregnancy and on the child, such as miscarriage, stillbirth, or perinatal death(2), with a chance of transmission from 70 to 100% in the primary and secondary stages of the
disease, and of 30% in the late stages of maternal infection(3).
Therefore, in order to facilitate the epidemiological surveillance of congenital syphilis, the disease was included in the notifiable illnesses list since 1986. In addition, the Ministry of Health
set up a goal to be accomplished: the improvement in the quality
of prenatal care and timely diagnosis and treatment of gestational
syphilis cases in order to prevent the vertical transmission of the
disease(3).
Despite all efforts for the prevention of congenital syphilis and
its control, 16,911 cases of the disease were reported in Brazilian
States between 2007 and 2009, showing that the incidence remains
This study was developed at the Federal University of Ceará (UFC).
1 Nursing graduates from the Federal University of Ceará.
2 Nurses. Master’s degree graduates in Nursing by the Postgraduation
Nursing Program at the Federal University of Ceará.
3 Nurse. Doctorate in Nursing graduate by the Postgraduation Nursing
Program at the Federal University of Ceará.
4 Nurse. PhD in Nursing. Professor at the Federal University of Ceará.
No funding support was received in terms of financing, equipment or drugs
supply. All materials used in this study were financed by researchers.
DOI: 10.5533/DST-2177-8264-201325102
high(4). In the State of Ceará between 2001 and 2006 1,203 cases
of congenital syphilis were reported, and a growing increase in the
course of this period has occurred(5).
It is recommended that all pregnant women carry out the syphilis test at the beginning of pregnancy, being the serologic tests the
main way to establish the diagnosis. Among them, there are non-treponemal tests such as VDRL, in which the result is described
qualitatively in “reagent” and “not” reagent, and quantitatively by
means of titrations, for example 1:2 and 1:32, and treponemal tests
such as TPHA, FTA-Abs and ELISA, which are specific tests used
to confirm the infection(3).
However, the elimination of congenital syphilis as a public health problem requires the reduction of its incidence through an organized and quality prenatal care, and its emergence is considered
an event that exposes the limitations of health services, especially
in the basic attention(6).
It is known that the congenital syphilis can be controlled
through appropriate diagnosis and treatment of pregnant women
during prenatal follow-up. Thus, educational strategies should
be developed on prenatal care and childbirth to ensure the promotion and prevention of health and appropriate diagnoses and
treatment(7), i.e., a humanized and capable prenatal care and childbirth aiming at the health and well-being of both the mother and
the baby.
Prenatal examination is a right of every pregnant woman and a
duty of health professionals, including nurses, who should do so in
their best way in order to reduce the syphilis vertical transmission,
also including sexual partners of positive VDRL women to prevent
their reinfection.
The importance of epidemiological identification of congenital
syphilis is then verified, and both maternal and neonatal characteristics noted as well, so that health professionals could be able to
perform interventions that prioritize not only the early identification but also the treatment of syphilis in pregnant women.
DST - J bras Doenças Sex Transm 2013;25(1):7-12 - ISSN: 0103-4065 - ISSN on-line: 2177-8264
8
OBJECTIVE
Epidemiological analysis of congenital syphilis in the State of
Ceará, verifying the prenatal care for pregnant women who had
their children diagnosed with congenital syphilis, as well as treatment for syphilis by these pregnant women partners, the diagnosis period of syphilis in pregnant women and the age group, the
classification of syphilis and the clinical evolution of children with
congenital syphilis from 2007 to 2010.
METHODS
This is a transverse type and documentary study with a quantitative approach held in the city of Fortaleza, State of Ceará, in
the Center for Information and Analysis in Health (NUIAS) of the
Health Office of Ceará (SESA-CE).
NUIAS is the SESA’s area responsible for storage and processing of information from the National System of Notifiable Diseases (SINAN). The study population was composed of all notified
cases of congenital syphilis in SINAN from 2007 to 2010, consisting of 1,577 cases. Data were collected in March, 2013, from the
State database available in the NUIAS SESA-CE, which contains
the information compiled from SINAN’s records.
The variables investigated in this study are the following: pregnant women prenatal care; period of syphilis diagnosis in pregnant women, treatment for syphilis by pregnant woman partner,
age group of syphilis diagnosis in children, final classification of
disease and clinical evolution.
Data obtained were organized and presented in graphs and charts
and analysed according to the absolute and relative frequencies.
The research project was submitted to the Research Ethics
Committee of the Federal University of Ceará, and approved under
protocol no. 139/10. All ethical and legal aspects of the resolution
no. 196/96 of the National Health Council-CNS on research involving human subjects(8) were fulfilled.
RESULTS
In the historical series evaluation it was observed that between 2007 and 2010 1,577 cases of congenital syphilis were notified
in the State of Ceará. The analysis of Figure 1 showed that most
women who had their children diagnosed with congenital syphilis attended to some prenatal consultation during the gestational
period, equal to 71.78% (n = 1,132) of cases. However, there was
still a considerable percentage of women who did not attend to any
prenatal consultation, i.e. 23.84% (376) of cases.
When a percentage analysis of each year under study was carried out, it was noted that there was no regularity in the frequency
of these prenatal pregnant women consultations. In 2007 and 2008
there was an increase of the percentage of these prenatal visits,
73.92% and 79.36%, respectively. In 2009 this percentage dropped
to 66.93%, and in 2010 reached 70.64% of pregnant women with
children diagnosed with congenital syphilis who attented to prenatal care.
Other identified results are related to the period of syphilis diagnosis in pregnant women, and it was verified that 46.16% (n = 728)
of women had the diagnosis of syphilis identified only during childbirth or curettage, whereas 41.34% (n = 652) were diagnosed on
prenatal care according to Figure 2.
DST - J bras Doenças Sex Transm 2013;25(1):7-12
CATUNDA et al.
In the course of each year, an increase in the percentage of cases
of syphilis diagnosis was observed during the childbirth/curettage
in women who had children with congenital syphilis in 2009 and
2010 when compared to previous years. While in 2007 and 2008
the percentage of diagnoses of the disease during childbirth/curettage were around 40%, in 2009 and 2010 the percentage surpassed
50% of cases, ahead of what would be the appropriate moment of
the prenatal diagnosis of syphilis in pregnant women.
Regarding the treatment for syphilis by the pregnant women partner, a disturbing data was noted: about 69.5% (1,096) of women’s
partners did not carry out the treatment, according to Figure 3.
Evaluating each year’s percentage, it was noted that the rates
of treatment for syphilis by the partner remained below 25%. It
should also be noted that theses data obtained lower numbers,
equal to 13.76% (n = 70) of cases in 2010.
Table 1 analysis evidenced that most children was diagnosed
with congenital syphilis until the sixth day of birth, surpassing
90% of cases during all years evaluated in this research. The final ranking of the most prevalent syphilis strain was the recent
syphilis, equivalent to 83.83% (1,322) of cases. In addition, the
most common clinical evolution presented a favorable outcome,
in which more than 75% of children during each year of the study
received treatment and remained alive.
It is worth mentioning the considerable number of subentries
identified in the following variables: final classification and clinical evolution. In the first variable, the ignored cases represented
23,49% (n = 74) of cases in 2008. Concerning the clinical evolution variable, the number of subentries remained above 10% throughout the analysed period under review, especially in 2010, when
21.56% (n = 47) of ignored cases were identified.
DISCUSSION
This study identified that although most women who had their
children diagnosed with congenital syphilis received prenatal care,
a considerable number of them did not have any prenatal consultation or these data were registered as an ignored information. Given this fact, the quality of prenatal consultations is questioned,
as even for those who attended to consultations it is observed that
neither treatment nor interventions occurred properly, considering
the amount of cases of syphilis vertical transmission.
Due to the above mentioned, it appears that rates related to
prenatal care percentage remained high. However, they are still
below the Ministry of Health recommendations, which advocates
that antenatal coverage must be performed properly, with quality,
covering 100% of pregnant women. The main purpose of prenatal
care is to attend woman since early pregnancy in a qualified and
humanized way, adopting a cozy procedure and timely interventions. The prenatal care should ensure the early assistance to pregnant woman (up to 120 days of gestation), with at least six prenatal
consultations and the provision of basic laboratory tests, especially
VDRL(9).
According to data from the National System of Notifiable Diseases (SINAN) of the National Program for STD and Aids of the
Ministry of Health, only 75% of nearly three million women who
conceive annually in Brazil carry out prenatal care. Only 50% of
these are tested for VDRL at the beginning of prenatal period and
9
Epidemiological Analysis of Congenital Syphilis in the State of Ceará, Brazil
Prenatal ignored
2010 13
2009
154
Prenatal not accomplished
51
33
419
2008 7
2007
Prenatal accomplished
250
17
174
58
309
0
100
93
200
300
400
500
600
700
Figure 1 – Number of newborns diagnosed with congenital syphilis according to prenatal care by pregnant women – Ceará, 2013.
Period ignored
2010 5
82
115
2009 12
2008 5
2007
24
0
During prenatal
During delivery/curettage
16
242
140
321
123
188
100
After delivery
200
51
47
169
37
300
400
500
600
700
Figure 2 – Number of newborns diagnosed with congenital syphilis according to period of syphilis diagnosis in pregnant women – Ceará, 2013.
only 23% repeat this test in the third quarter of pregnancy, as recommended by Brazilian standards(9).
Study of 46 recent mothers who had a history of syphilis or positive VDRL assisted in a maternity ward in the State of Pará, pointed out that only 55.6% of VDRL tested pregnant women received
prenatal care and only 13.9% repeated the test in the third quarter.
The study also showed that only 53.8% of mothers who had a diagnosis of syphilis during prenatal period received appropriate treatment, data that also denounces the low quality of the prenatal care.
Incomplete or even incorrect prenatal care, either by late beginning
or nonattendance at consultations, impedes the implementation of
a routine for the diagnosis of syphilis and its early intervention, and
can explain many cases of congenital syphilis(10).
It also became evident in a study conducted with 16,158 parturients that despite the availability of cheap and efficient prophylactic
resources for the reduction of mother-to-child transmission, 75.1%
of pregnant women showed at least one syphilis test result during the
hospitalization for childbirth, but only 16.9% presented the results of
two tests; 11.8% had prenatal card, but had no result of syphilis. Moreover, even among women who have six or more prenatal consultations, the coverage of two tests for syphilis in pregnancy is low, only
26.2%, and 2.6% of women were completely excluded since syphilis
DST - J bras Doenças Sex Transm 2013;25(1):7-12
10
CATUNDA et al.
Treatment ignored
2010
18 30
2009
41
2007
Treatment not accomplished
170
96
2008
Treatment accomplished
94
436
73
56
201
73
0
100
289
200
300
400
500
600
700
Figure 3 – Number of newborns diagnosed with congenital syphilis according to treatment of syphilis by partners of pregnant women – Ceará,
2013.
Table 1 – Number of newborns diagnosed with congenital syphilis according to children age group, final classification and clinical evolution
of syphilis in newborns – Ceará, 2013.
Period
Age Group
2007
%
2008
%
2009
%
2010
%
Up to 6 days
402
96.17
294
93.33
608
97.12
214
98.16
7 to 27 days
8
1.91
8
2.54
6
0.96
3
1.38
28 days to 365 days
6
1.44
12
3.81
9
1.44
1
0.46
1 year or more
2
0.48
1
0.32
3
0.48
0
0
361
86.36
227
72.06
509
81.31
175
80.28
Late syphilis
1
0.24
4
1.27
6
0.96
0
0
Miscarriage by syphilis
4
0.96
10
3.18
49
7.83
23
10.55
Ignored
52
12.44
74
23.49
62
9.9
20
9.17
Alive
325
77.75
269
85.39
488
77.95
165
75.68
Death by syphilis
38
9.09
9
2.86
9
1.44
4
1.83
Death – another aggravation
9
2.15
4
1.27
3
0.48
2
0.92
Ignored
46
11.01
33
10.48
126
20.13
47
21.56
Total
418
Final classification
Recent syphilis
Clinical evolution
testing did not occur during prenatal care or childbirth. Therefore,
it is necessary to point out that the absence of detection of syphilis
during the prenatal period means a lost opportunity for intervention
in infected pregnant women, limiting the possibilities for reducing
the incidence of cases of congenital syphilis(11).
It was observed that between 2007 and 2010 most syphilis diagnoses was held at time of delivery or curettage, the phase woman
DST - J bras Doenças Sex Transm 2013;25(1):7-12
315
626
218
should have had the proper prenatal care, should have made at least
two VDRL tests and should have received the diagnosis, together
with the proper treatment for her and her partner as well, thus avoiding the exorbitant increase of congenital syphilis cases.
More than 95% of childbirths in Brazil occur in a hospital environment. If the health network is not able to detect and treat
syphilis in pregnant women, there is one more opportunity to dis-
11
Epidemiological Analysis of Congenital Syphilis in the State of Ceará, Brazil
cover it during delivery. And the most important at this stage is
to verify the vertical transmission of syphilis and treat infected
newborns to prevent the manifestation of the disease or reduce
its consequences(12).
Some reference maternity wards of the city of Fortaleza offer
VDRL test during childbirth, according to Projeto Nascer, but there
is a need for its expansion to ensure the supply of VDRL to all parturients and provide a maternal-fetal health adequate to the whole
State of Ceará.
In a study developed in Rio de Janeiro with the purpose of evaluating the effectiveness of campaigns for the elimination of congenital syphilis, it was observed that prenatal care for over 80% of
the cases of congenital syphilis mothers does not ensure early diagnosis of pregnant women nor the proper treatment, which would
prevent cases of congenital syphilis(13).
As for treatment for syphilis by partners of pregnant women
who had their children diagnosed with congenital syphilis, our
study noted that most of them did not carry out the treatment for
syphilis, consisting in a means of reinfection by pregnant women.
Thus, although pregnant women receive prenatal care properly
and follow the treatment for syphilis effectively, they will still be
susceptible to reinfection by partners who did not perform the treatment for syphilis, contributing to the elevation of the rates of
congenital syphilis.
It should be emphasized the importance of notification at SINAN as one of the ways for the congenital syphilis control, because when collecting, transmitting and disseminating data on reportable diseases, SINAN becomes a relevant instrument to support
health planning, setting priorities for action, besides allowing the
evaluation of their impact(1).
Thus, it is evident the negligence of health services for the treatment of syphilis of pregnant women partners, which should be a
priority, considering the risk of vertical transmission of the disease. Health professionals’ unpreparedness is manifested both by
the high number of cases in which there was no treatment of the
partner and the high amount of treatments ignored, because it is
the professional’s duty to ensure the active search of partners, to
advice and to treat properly.
According to a research, one criterion to define the cases of
congenital syphilis is the untreated partners, including cases where
there was inadequate treatment for pregnant women and also those who were not treated in accordance with the current treatment
guidelines, or when the father is unknown or there is no documentation of his treatment(14).
A research conducted in 2007 in the State of Ceará supports the
data found in this study, confirming the high number of untreated
partners and ignored treatments, in addition to the existing problem
of underreporting of cases through SINAN(5).
It was observed that the age group concentrating the largest
number of diagnoses of congenital syphilis is the first days of the
neonate life. In accordance with the data of the documentary study,
a research conducted in the city of Natal, State of Rio Grande do
Norte, in order to trace the epidemiological profile of congenital
syphilis identified that in most cases (90%) the disease was diagnosed in the first two days of life of the newborn, while only 9.1%
of them were diagnosed between two and 28 days of life, and only
0.9% after 28 days of life(15).
As for the final classification of congenital syphilis, it was identified a prevalence of syphilis considered recent throughout the
period of this study. Confirming this data, a research developed in
the city of Carapicuíba, State of São Paulo, observed that 94.0%
of reported cases had the final classification as suspected congenital syphilis (31 cases), 3.0% of congenital syphilis confirmed (one
case) and 3.0% dropped (one case). Of cases classified as congenital syphilis 100% were diagnosed as recent type(16).
Regarding the clinical development of children identified with
congenital syphilis, this study observed the prevalence of favorable
outcomes. In a study published in Portugal, similar results have
been observed, indicating that most newborns, 361 (77%), completed treatment with procaine or crystallized penicillin. Thirty-one
(6%) were treated with benzathine penicillin. Finally, 75 NB (16%)
did not adhere to any therapy, because the latter had less infectious
risk. Thus, in the above mentioned cases NB had conditions to survive, grow and develop healthy(17).
CONCLUSION
Congenital syphilis is still considered an important public
health problem, although it is a disease of easy diagnosis and
completely avoidable when treatment of pregnant women and her
partner is performed properly. However, the occurrence rates of
this aggravation remain high, constituting therefore a determining factor in the rise of maternal and perinatal morbidity and
mortality indicators.
We then emphasize the importance of a thorough analysis of
congenital syphilis cases, as well as of factors involved in the
process of occurrence of the disease vertical transmission, such
as prenatal care and testing recommended by the Ministry of Health, the early diagnosis in infected pregnant women and the development of their immediate treatment, because the implementation of these measures ensures the prevention and control of
congenital syphilis.
In addition, it appears that mothers of children who caught congenital syphilis are at risk due to the lack of development of actions
that prevent the occurrence of this disease, making them vulnerable to contract sexually transmitted diseases. It was also noted that
there was a deficiency in healthcare in all cases, contributing to the
incidence of CS.
Consequently the development of similar studies in other regions of the country becomes relevant, in order to analyse and
evaluate the real situation of information and practices of health
professionals in the prevention of vertical transmission of syphilis,
as well as monitoring the effectiveness of educational programs
and training of these professionals.
Conflict of interest
There is no conflict of interest to declare.
REFERENCES
1.
2.
Brasil, Ministério da Saúde, Secretaria de Vigilância em Saúde, Boletim
Epidemiológico eletrônico. Avaliação da notificação da sífilis congênita
no Brasil, 2000 a 2003. Ano 07, no 07. Brasília, 2007.
Costa CC, Freitas LV, Sousa DMN, Oliveira LL, Chagas ACMA, Lopes
MVO et al. Sífilis congênita no Ceará: análise epidemiológica de uma
década. Rev Esc Enferm USP. 2013;47(1):152-9.
DST - J bras Doenças Sex Transm 2013;25(1):7-12
12
CATUNDA et al.
3.
13. Saraceni V, Vellozo V, Lauria LM, Dias MAB, Ratto KMN, Durovni B.
Vigilância da sífilis na gravidez. Epidemiol Serv Saúde. 2007;16(2):103-11.
14. Paz LC, Pereira GF, Pinto VM, Medeiros MGPF, Matida LH, Saraceni V
et al. Nova definição de casos de Sífilis Congênita para fins de vigilância
epidemiológica no Brasil, 2004. Rev Bras Enferm. 2005;58(4):486-7. 15. Holanda MTCG, Barreto MA, Machado KMM, Pereira RC. Perfil epidemiológico da sífilis congênita no Município do Natal, Rio Grande do
Norte - 2004 a 2007. Epidemiol. Serv Saúde. 2011;20(2):203-212.
16. Vieira AA. Contribuição ao Estudo Epidemiológico de Sífilis Congênita
no Município de Carapicuíba-SP: ainda uma realidade em 2002. DST - J
bras Doenças Sex Transm. 2005;17(1):10-17. 17. Jacinto S, Henriques M, Ferreira T, Carvalhosa G, Costa T, Marques Valido AM. A sífilis congénita ainda existe! Análise retrospectiva de 12 anos
de uma grande maternidade. Acta Pediatr Port. 2007;38(2):65-8.
Brasil, Ministério da Saúde, Secretaria de Vigilância em Saúde, Programa
Nacional de DST/AIDS, Diretrizes para controle da sífilis congênita: manual de bolso. Ministério da Saúde. 2. ed. Brasília: Ministério da Saúde,
2006.
4. Galatoire PSA, Rosso JA, Sakae TM. Incidência de sífilis congênita nos estados do Brasil no período de 2007 a 2009. Arq Catarin Med.
2012;41(2):26-32.
5. Ximenes IPE, Moura ERF, Freitas GL, Oliveira NC. Incidência e controle
da sífilis congênita no Ceará. Rev RENE. 2008;9(3):74-80.
6. Mesquita KO, Lima GK, Filgueira AA, Flôr SMC, Freitas CASL, Linhares MSC et al. Análise dos Casos de Sífilis Congênita em Sobral, Ceará: Contribuições para Assistência Pré-Natal. DST - J bras Doenças Sex
Transm. 2012;24(1):20-27.
7. Figueiró-Filho EA, Freire SSA, Souza BA, Aguena GS, Maedo CM.
Sífilis e Gestação: Estudo Comparativo de Dois Períodos (2006 e
2011) em População de Puérperas. DST - J bras Doenças Sex Transm.
2012;24(1):30-35.
8. Conselho Nacional de Saúde. Resolução n. 196, de 10 de outubro de 1996.
Dispõe sobre diretrizes e normas regulamentadoras de pesquisas envolvendo seres humanos. Bioética. 1996;4(2 Supl):15-25.
9. Brasil. Ministério da Saúde; Secretaria de Atenção à Saúde, Departamento
de Ações Programáticas Estratégicas. Área Técnica de Saúde da Mulher.
Pré-Natal e Puerpério: atenção qualificada e humanizada. Brasília; 2005.
10. Araújo EC, Costa KSG, Silva RS, Azevedo VNG, Lima FAZ. Importância do pré-natal na prevenção da sífilis congênita. Rev Paraense Med.
2006;20(1):47-51.
11. Szwarcwald CL, Barbosa Junior A, Miranda AE, Paz L C. Resultados do
estudo sentinela-parturiente, 2006: desafios para o controle da sífilis congênita no Brasil. DST J Bras Doenças Sex Transm. 2007;19(3-4):128-133.
12. Donalísio MR, Freire JB, Mendes ET. Investigação da sífilis congênita
na microrregião de Sumaré, Estado de São Paulo, Brasil: desvelando a
fragilidade do cuidado à mulher gestante e ao recém-nascido. Epidemiol
Serv Saúde. 2007; 16(3):165-73.
DST - J bras Doenças Sex Transm 2013;25(1):7-12
Address to correspondence:
HELLEN LÍVIA OLIVEIRA CATUNDA
Rua Osvaldo Cruz - no 1.772, apto. 602, Aldeota
CEP: 60125-150. Fortaleza - Ceará
E-mail: [email protected]
Received in: 12.05.2013
Approved in: 29.06.2013
ARTICLE
Comparison between Two Methods for Molecular
Characterization of Human Papillomavirus
Ludmila Entiauspe1,3,5, Emily Nunes2,5, Tiago Collares3,5, Mariângela Freitas da Silveira4, Fabiana Seixas1,3,5
ABSTRACT
Introduction: a sensitive method of detection for Human Papillomavirus (HPV) is important to facilitate the early treatment of cervical cancer precursors.
Objective: to analyze the spectrum of HPV infection and compare the sensibility of DNA HPV detection using polymerase chain reaction (PCR) and nested
PCR (nPCR) methods in a group of 251 women of Pelotas-RS. Methods: genomic DNA was extracted from the collected samples and was submitted to
PCR methods with the primers MY09/11 and nPCR with the pair of primers MY09/MY11 and GP5+/6+. The results were applied to the softwares EpiInfo v.3.5.1® and STATA v.11 ® for analyzes. Results: the prevalence of HPV infection was 6.8% with the use of primers MY09/11. When associated with
primers GP5/6, this result increased to 29.9% (p < 0.001). Conclusion: the increase founded in HPV DNA detection from 6.8 to 29.9% suggests that the
technique of nPCR MY09/11 followed by GP5/6 is the most sensitive method to detect HPV DNA from cervical specimens.
Keywords: HPV, molecular diagnostics, nested PCR
INTRODUTION
Estimates show that about 291 million women worldwide are
infected with human papilloma virus (HPV)(1). According with the
Brazilian Ministry of Health, Brazil is one of the world leaders in
the incidence of HPV, with 137,000 new cases of infection each
year(2). With the introduction of biomolecular techniques, it was
possible to confirm that the cervical cancer (CC) development is
closely associated with the HPV, showing the significance of the
HPV infection for the dysplasia development and the transformation of normal cervical cells into cancerous(3,4). This type of cancer
is the responsible for the death of 31.400 women in Latin America,
11.000 only in Brazil(5,6) each year. Even though HPV infection can
be detected by preventive examinations for CC (Pap test), or pathological (by colposcopic directed cervical biopsy), this is often
not possible. However, the presence of HPV can be confirmed with
high accuracy, by identifying the viral genome present in cervical
lesions(7).
There are currently several techniques for the molecular diagnosis of HPV, ranging from a conventional Polymerase Chain
Reaction (PCR) methods complex, such as real-time PCR, hybrid capture (HC) and microarray(8,9). The PCR technique is
still considered the “gold standard” for HPV diagnosis, as the
DNA-target is selectively amplified. However, this characteristic
makes the method susceptible to contamination by exogenous or
amplified nucleic material from another sample(10). A variation of
this technique called nested-PCR (nPCR) with the MY09/11 and
GP5+/6+ primer sets, is a high sensitive specific method for HPV
DNA detection(11), whith both targeting the L1 conserved region
of the viral genome, allowing the detection of a broad range of
HPV types(12).
The widely used MY09/11 consensus primers set is synthesized
with several degenerated nucleotides in each primer and is thus a
1 Functional Genomics Laboratory, Technology Development Centre
(CDTec), Federal University of Pelotas (UFPel), Pelotas, RS, Brazil.
2 Graduate student in Biotechnology, CDTec, UFPel, Pelotas, RS, Brazil.
3 Post-Graduate Programme in Biotechnology, CDTec, UFPel, Pelotas, RS,
Brazil.
4 Post-Graduate Programme in Epidemiology, UFPel, Pelotas, RS, Brazil.
5 Cellular and Molecular Oncology Research Group, CDTec, UFPel.
Financial support: Brazilian National Research Council (CNPq).
DOI: 10.5533/DST-2177-8264-201325103
mixture of 25 primers, targets a 450bp conserved sequence in the
HPV L1 gene, and is therefore able to amplify a broad spectrum
of HPV types(13). The GP5 and GP6 primer set consists of a fixed
nucleotide sequence for each primer and detects a wide range of
HPV types by using a lowered annealing temperature during PCR,
and targets a 140bp sequence of HPV L1 gene, located inside the
sequence recognized by the MY primers(12).
OBJECTIVE
Considering that HPV infection is an integral part of CC development, the viral genome detection can be used as a surveillance strategy, to identify HPV infected women and to monitor the progression of cervical lesions, as it is a disease of high
mortality that can be prevented(7). Based on these data, this study
aimed to analyze the spectrum of HPV infection and compare the
sensibility of DNA HPV detection using polymerase chain reaction (PCR) and nested PCR (nPCR) methods in a group of 251
women of Pelotas-RS.
METHODS
Study population
This is a cross-sectional study. From July to October 2010, 251
women seeking gynecologic care at the clinic of the Faculty of
Medicine – Federal University of Pelotas (UFPel) were sequentially selected. The study was approved by the Ethics Committee
of the Faculty of Medicine – Federal University of Pelotas in June
2009, and informed consent was obtained from all participants. All
procedures were carried out in accordance with the guidelines of
the Helsinki Declaration.
Statistical analyses
Chi-square (χ2) test was used to evaluate the HPV presence by
PCR and nPCR detection techniques. The analysis was performed
using SPSS 16.0 software (SPSS, Chicago, IL). Significancy was
cosidered if the P value was bellow 0.05.
Sample collection and processing
Cervical samples were collected from each patient with a cytobrush, and placed into 1.5 mL Eppendorf tubes containing 300
DST - J bras Doenças Sex Transm 2013;25(1):13-15 - ISSN: 0103-4065 - ISSN on-line: 2177-8264
14
entiauspe et al.
mL of Cell Lysis Solution (PuregeneTM DNA Extraction Kit, Gentra Systems Minneapolis, MN). The tubes were submitted to digestion using 1.5 µL of Proteinase K (10 mg/mL, New England
Biolabs, MA), and incubated overnight at room temperature. The
genomic material (DNA) was extracted, according to manufacturer
specifications. As a control for extracted DNA quality, the human
TP53 gene PCR was performed, using the primers previously described(14). PCR were performed in a final reaction volume of 12
µL, and was carried out with one cycle 94ºC for 3 min, followed
by 40 cycles at 94ºC for 30 sec, 57ºC for 30, 72ºC for 30 sec and a
final extension for 3 min at 72ºC (24).
HPV detection by polymerase chain reaction (PCR)
method
Were used the MY09/11 external primers (Table 1), previously
described by Manos et al.(15). The MY90/11 PCR reaction was performed in a final volume of 25 µL, and the conditions were as
follows: 40 cycles of denaturation (1 min at 95ºC), annealing (1
min at 55ºC), and extension (1 min at 72ºC)(16,17). Cervix carcinoma
cell line HeLa was used as positive control, and amplification mix
without DNA as negative control.
HPV detection by the nested polymerase chain reaction (nPCR) method
HPV detection was carried out using nested-PCR (nPCR)
technique, which is performed in two rounds: the first using
MY09/11 primers, described previously. The second used GP5/6
internal primers (Table 1), which amplify the 140 pb fragment(18). The conditions were 40 cycles of denaturation (30 sec at
94ºC), annealing (30 sec at 45ºC), and extension (30 sec at 72ºC)
(7). Both PCR reactions were preheated for 9 min at 95ºC, and a
final extension for 5 min at 72ºC. All PCR products were visualized
on a 2.0% agarose gel with GelRedTM (Biotium Inc., CA)(19).
RESULTS
All 251 samples were amplified for the TP53 gene, checking
DNA quality for HPV detection by PCR and nPCR methods. The
HPV-DNA analysis by PCR MY09/11 was observed in 17 samples,
whereas nPCR technique found HPV positivity in more 58 samples
(24.8%) shown in Table 2, increasing up to 4 times the detection of
viral DNA (p < 0.001). The comparative test showed 100% sensitivity in conventional PCR, and a specificity of 75.2% when compared to nPCR (Table 3).
Table 1 – General primers sequences for HPV DNA detection
Primer
Sequences* (5’-3’)
MY11
GCMCAGGGWCATAAYAATGG
MY09
CGTCCMARRGGAWACTGATC
GP5
TTTGTTACTGTGGTAGATAC
GP6
GAAAAATAAACTGTAAATCA
* M = A+C; R = A+G; W = A+T; Y = C+T.
DST - J bras Doenças Sex Transm 2013;25(1):13-15
Size (bp)
~ 450(17)
~ 140(19)
Table 2 – Comparison between PCR MY09/11 and nPCR MY09/11
and GP5/6 methods
nPCR MY09/11 e GP5/6
PCR MY09/11
Negative (%)
Negative
Positive
Total
Positive (%)
Total (%)
176 (75.21)
58 (24.8)
234 (100.00)
0 (0.00)
17 (100.00)
17 (100.00)
176 (70.12)
75 (29.9)
251 (100.00)
Qui-square (χ ) = 42.7916 Pr = < 0.001.
2 (1)
Table 3 – Sensitivity and specificity of MY09/11 PCR compared
with nPCR
PCR MY09/11
nPCR Negative
nPCR Positive
Positive
0%
100.0%
Negative
75.2%
24.8%
176
75
Total
Qui-square (χ ). p < 0.001.
2
DISCUSSION
There are several comparative studies of different methods for
HPV-DNA detection. Husnjak et al.(17), also with cervical samples,
using conventional PCR with primers MY09/11 compared with
nPCR, observed 38.8% of increase in the rate of positivity for
HPV DNA by nPCR method, showing that it is more effective
in HPV detection. Evander et al.(20) reported 5,9% of HPV-DNA
detection by the MY09/11 PCR technique. When the nPCR with
MY09/11 and GP5/6 was performed, the rate of HPV detection increased to 20,3%, suggesting that GP5/6 primers may result in increased amplification efficiency for not contain any degenerate bases,
and for cover a small region compared with MY09/11 primers. However, in a similar study, the authors do not find significant difference: the HPV-DNA detection with MY09/11 primers was 45,2%,
and 42,8% for GP5+/6+ primers12 (Qu et al., 1997).
According to Demathe et al.(21), the variations of HPV-DNA
detection suggest a potential difference in the ability to amplify
fragments of different sizes and specific HPV types, in accordance with the methods of DNA detection used, and also the types
of material (smears, frozen material, paraffin or formalin embedded), anatomical location, population issues and the design of
primers. The authors evaluated samples from lip squamous cell
carcinoma, and observed that the use of nPCR increased by up
to 6 times the rate of HPV DNA detection, when compared to
MY09/11 PCR.
This study aimed to compare the detection rate of HPV-DNA
by PCR method through MY09/MY11 oligonucleotides and
nPCR through MY09/MY11 oligonucleotides in the first stage
and GP5+/GP6+ in the second stage. This results suggests nPCR
technique for HPV-DNA detection is as an alternative to early identification of women at high risk for CC development,
showing that the nPCR MY09/11 followed by GP5/6 technique
is the most sensitive method to detect HPV DNA from cervical
specimens. Moreover, it emphasizes the importance of molecular
diagnostic methods as a complementary tool to conventional preventive screenings.
15
Comparison Between Two Methods for Molecular Characterization of Human Papillomavirus
CONCLUSION
The increase in HPV DNA detection from 6.8 to 29.9% suggests
that the technique of nPCR MY09/11 followed by GP5/6 is the
most sensitive method to detect HPV DNA from cervical specimens.
Acknowledgements
The authors are grateful to Brazilian National Research Council
(CNPq).
Conflict of interest
The authors declared no conflict of interest
REFERENCES
1.
De Sanjosé S, Almirall R, Lloveras B, Font R, Diaz M, Muñoz N et al.
Cervical Human Papillomavirus Infection in the Female Population in
Barcelona, Spain. Sex Transm Dis. 2003;30(10):788-793.
2. Ministério da Saúde do Brasil. Instituto Nacional do Câncer (INCA).
Estimativas 2010: Incidência de Câncer no Brasil. Rio de Janeiro. 2009.
p. 94.
3. Cox JT. The development of cervical câncer and its precursors: whait is
the role of human papillomavirus infection? Cur Opin Obstet Gynecol.
2006;18(suppl 1):S5-S13.
4. Muñoz N, Castellsagué X, De Gonzaléz AB, Gissman L. Chapter 1: HPV
in the etiology of human cancer. Vaccine. 2006;24(S3):S3/1-S3/10.
5. World Health Organization. Information Centre on HPV and Cervical
Cancer (HPV Information Centre). Summary report on HPV and cervical cancer statistics in Brazil. 2007, P.28. Available at: www. who. int/
hpvcentre. Accessed in: 09 Ago 2012.
6. Ministério da Saúde do Brasil. Portal da Saúde, SUS. Papilomavírus Humano. 2010. Available at: http://portal.saude.gov.br. Accessed in: 09 Ago
2012.
7. Fernandes APM, Gonçalves MAG, Simões RT, Quintana SM, Duarte G,
Donadi EA. Influência da infecção pelo HIV-1 sobre a presença do HPV
em lesões do colo uterino. J Bras Doenças Sex Transm. 2004;16(1):21-25.
8. Gravitt PE, Peyton CL, Alessi TQ, Wheeler CM, Coutlée F, Hildesheim
A et al. Improved amplification of genital human papillomaviruses. J Clin
Microbiol. 2000;38(1):357-361.
9. Choi YD, Jungc WW, Nama JH, Choi HS, Park CS. Detection of HPV
genotypes in cervical lesions by the HPV DNA Chip and sequencing. Gynecol Oncol. 2005;98:369-375.
10. Trofatter KF. Diagnosis of human papillomavirus genital tract infection.
Am J Med. 1997;102(5A):21-27.
11. Souza NST, Melo VH, Castro LFP. Diagnóstico da infecção pelo HPV em
lesões do colo do útero em mulheres HIV+: acuidade da histopatologia.
Rev Bras Ginecol Obstet. 2001;3(6):355-361.
12. Qu W, Jian GG, Cruz Y, Chang CJ, Ho GYF, Klein RS et al. PCR Detection of Human Papillomavirus: Comparison between MY09/MY11 and
GP51/GP61 Primer Systems. J Clin Microbiol. 1997;35(6):1304-10.
13. Van Doorn LJ, Kleter B, Quint WGV. Molecular detection and genotyping
of human papillomavirus. Expert Rev Mol Diagn. 2001;4:394-402.
14. Lin YC, Huang HI, Wang LH, Tsai CC, Lung O, Dai CY et al. Polymorphisms of COX-2-765 G>C and p53 codon 72 and risks of oral squamous
cell carcinoma in a Taiwan population. Oral Oncol. 2008;44:798-804.
15. Manos MM, Ting Y, Wright DK, Lewis AI, Broker TR, Wolinsky SM.
The use of polymerase chain reaction amplification for the detection of
genital human papillomaviruses. Cancer Cells. 1989;7:209-214.
16. Gravitt PE, Burk RD, Lorincz A, Herrero R, Hildesheim A, Sherman ME
et al. A Comparison between Real-Time Polymerase Chain Reaction and
Hybrid Capture 2 for Human Papillomavirus DNA Quantitation. Cancer
Epidemiol Biom Prev. 2003;12:477-484.
17. Husnjak K, Grce M, Magdic L, Pavelic K. Comparison of five different
polymerase chain reaction methods for detection of human papilomavírus
in cervical cell specimens. J Virol Meth. 2000;88:125-134.
18. Molijn A, Kleter B, Quint W, van Doorn LJ. Molecular diagnosis of human papillomavirus (HPV) infections. J Clin Virol. 2005;32S:S43-S51.
19. Snijders PJF, Van Den Brule AJC, Schrijnemakers HFJ, Snow G, Meijer
CJLM, Walboomers JMM. The use of general primers in the polymerase
chain reaction permits the detection of a broad spectrum of human papillomavirus genotypes. J Gen Virol. 1990;71:173-181.
20. Evander M, Edlund K, Boden E, Gustafsson A, Jonsson M, Karlsson R et
al. Comparison of a One-Step and a Two-Step Polymerase Chain Reaction
with Degenerate General Primers in a Population-Based Study of Human
Papillomavirus Infection in Young Swedish Women. J Clin Microbiol.
1992;987-992.
21. Demathe A, Bernabé DG, Garcia JF, Nunes CM, Miyahar GI. Comparação entre dois métodos de detecção de DNA de papilomavírus
humano em carcinoma epidermoide de lábio. J Bras Patol Med Lab.
2010;46(2):85-90.
Endereço para correspondência:
Mariângela Freitas da Silveira
Centro de Pesquisas Epidemiológicas
Universidade Federal de Pelotas
Rua Marechal Deodoro, 1.160 - 3° Piso
Bairro Centro, Cep: 96020-220
Caixa Postal 464 – Pelotas, RS – Brasil
Tel/fax: +55 (53) 3284-1300
E-mail: [email protected]
Received in: 03.04.2013
Approved in: 09.06.2013
DST - J bras Doenças Sex Transm 2013;25(1):13-15
ARTICLE
Behavioural Differences between Users Seeking HIV-Testing
at the Testing and Counseling Center in the city of Montes
Claros, State of Minas Gerais
Ana Paula F Holzmann1, Sônia Maria O Barros2, Maria José R Vaz3, Valdete da Silva4,
Clara de Cássia Versiani5, Edna FG Ruas6
Best Full Paper Award at the IX Congress of SBDST - DST 9/AIDS 5, 2013 Salvador
ABSTRACT
Introduction: the human immunodeficiency virus (HIV) epidemic is a global, dynamic and unstable phenomenon, whose form of occurrence depends
on the individual and collective human behavior, among other factors. Objective: to identify the social and behavioral differences related to the risk of
HIV infection, prevalence of HIV and the rate between genders in users of the Testing and Counseling Center (CTA) of the city of Montes Claros, Minas
Gerais State. Methods: this is a cross-sectional study. The sample included 1,409 users’ records (716 men, 693 women) from the CTA of Montes Claros,
from December 2007 to March 2009. For organization and statistical analysis, the Statistical Package for Social Sciences (SPSS) 15.0 was used and a
significance level of 5% (p < 0,05) was considered. Results: significant differences (p < 0.05) between genders were found, indicating a higher percentage
of singles (65.3%), drug users (73.5%) and those who have had three or more sexual partners (41.9%) during the past year among men. Men used condoms
more regularly in fixed (20.1%) and eventual (44.4%) partners. HIV prevalence was of 2% and the rate between the genders was of 1:1. Conclusion: men
were engaged in more risk behaviors for HIV, but women were infected in the same proportion. Prevention programs must consider social and cultural
components to structure gender inequalities.
Keywords: sexual behavior, prevalence, HIV, gender and health, condoms, cross-sectional studies.
INTRODUCTION
Throughout its evolution, the epidemiological profile of the infection by HIV/Aids underwent deep transformations, marked by
processes of heterossexualization, feminization, impoverishment
and internalization. Despite the current tendency towards stabilization, the epidemic continues to be a public health problem in Brazil
and in the world as well(1).
According to data from the Epidemiological Bulletin published in 2011, a total of 608,230 cases of Aids have been notified
in the country from 1980 to June 2011. Throughout these years,
there was also a decrease in the infection rate between genders.
In 1985, for every 26 cases among men there was 1 case between
women. In 2010, this rate became 1.7 man for each case in women. The Southeast region continues to focus the largest number
of cases in the country, and the State of Minas Gerais, in the Southeast region, held the third place in notifications in 2010, representing 16.6 of the total cases in the region(2). Aids expansion in
Research performed at the Testing and Counceling Center (CTA) in the
city of Montes Claros, Minas Gerais State.
1 Master of Science. Montes Claros State University (UNIMONTES)
Professor. STD/Aids Municipal Program Nurse, Montes Claros, Minas
Gerais State.
2 University Lecturer. Director of São Paulo Federal University (UNIFESP)
Nursing School, São Paulo State.
3 PhD in Nursing. Nurse of the Multidisciplinary Center of Infectious
Diseases in Pregnancy at São Paulo Federal University (UNIFESP), São
Paulo State.
4 Master of Science. Professor at Montes Claros State University
(UNIMONTES), Minas Gerais State.
5 Master of Science. Professor at Montes Claros State University
(UNIMONTES). Nurse at Maternidade Maria Barbosa - HUCF/
UNIMONTES, Montes Claros, Minas Gerais State.
6 Master of Science. Professor at Montes Claros State University
(UNIMONTES), Minas Gerais State.
the small and medium cities, as Montes Claros and other cities
in the North region of Minas Gerais reflects the general trend of
the epidemic internalization, as shown in the country from the
1990’s(1,3).
HIV/Aids collected data in the last 30 years in Brazil and in the
world as well, pointed at a complex and unstable dynamic with significant regional differences and determinants related to individual,
social, cultural and political factors, whose interaction results in a
bigger or lesser vulnerability of the individual in contracting the
HIV virus during his life(4-7).
In this context, the “behavior” factor plays an important role in
the virus transmission chain(8). However, it must be considered that
this factor is strongly influenced by others, such as access to education, health and prevention tools, such as condom. In addition,
power inequalities still existing in the construction of masculine
and feminine genders continue to stand out as an important risk
practice operator in the epidemic HIV/Aids scenery(9).
In general terms, male and female vulnerabilities are built from
a differentiated socialization for both men and women, still traditional for gender relations and to the development of sexuality that
despite encouraging men, in a way, make not only women vulnerable, but men too(7).
Due to gender differences, already considered natural in social
and sexual behavior of general population and of its relation to a
greater vulnerability to HIV infection(5), studies comparing male
and female behaviors are fundamental to a better understanding of
the difference between these behaviors’ patters, as well as to assess
and adopt health prevention and care measures that take into consideration genders issues(4).
Thus this study’s objective is to identify social and behvioural
differences related to the HIV infection risk, as well as the infection prevalence and the rate among genders in users that sought
anti-HIV testing in the Testing and Counseling Center (CTA) of the
city of Montes Claros, Minas Gerais.
DST - J bras Doenças Sex Transm 2013;25(1):16-20 - ISSN: 0103-4065 - ISSN on-line: 2177-8264
DOI: 10.5533/DST-2177-8264-201325104
17
Behavioural Differences between Users Seeking HIV Testing at Testing and Counseling Center in the Montes Claros City, Minas Gerais
METHODS
This is a retrospective cross-sectional study with a quantitative
approach, in which medical records of 1,409 users who sought the
Testing and Counseling Center in STD/Aids (CTA) were analyzed
in the city of Montes Claros, Minas Gerais, for HIV testing, from
December 2006 to March 2009. Pregnant women, due to their specific indication for examination in prenatal service and users under
13 years old, due to their possible diagnosis association with vertical transmission, have had their medical records excluded from
the study.
Secondary data source were obtained from the Testing and
Counseling Centers Information System (SI-CTA) forms, filled in
during the individual counselling and available on the users’ records served by the service.
The variables selected for the study were the folowing: social
and demographic (age, sex, marital status and schooling), behavioral risk related to HIV infection (type of risk exposure to HIV,
use of legal and/or illegal drugs during past year, number of sexual
partners in the past year and use of condoms with fixed and casual
partners during past year) and serologic variable (positive anti-HIV
test result).
Data analysis
Data were organized by Microsoft Excel® 2007 spreadsheets
and analyzed by the Statistical Package for Social Sciences (SPSS)
15.0, being considered a significance level of 5% (p < 0.05). Descriptive analysis was made of the data, showing the absolute and
relative frequencies. To verify if the distribution of several categorical variables was similar between genders, univariate inferential
statistic was used through the Chi-square test (χ2) of Pearson and
Fisher exact. The prevalence of HIV infection was determined by
the percentage of seropositive users for the anti-HIV test in relation to the total users of the goup concerned. The gender ratio was
calculated from the division between the absolute value number of
positive results in individuals of one gender by the absolute value
number of positive results of the opposite gender.
Ethical aspects
The study met the guidelines and standards determined by resolution 466/2012 of the National Health Council (CNS) which
regulates the research conduct involving humans. It was approved
by the ethics and research committees of UNIMONTES (opinion
no 763/07) and of UNIFESP (opinion no 1368/08).
RESULTS
The study’s sample was composed of 1,409 records of users of
the service, composed of 716 (50.8%) men and 693 (49.2%) women. The average age found in men was 30.5 years (DP ± 11.5) and
29.5 years (DP ± 10.3) in women.
Twenty-eight people among this population and period were
infected with HIV, with the prevalence of infection of 2% and the
rate of genders of 1:1, i.e., for each infected man, a woman was
also diagnosed.
Table 1 shows that men and women had similar schooling,
predominantly those who had completed 8 to 11 years of study.
It was observed that the marital status and drug abuse variables
were significantly associated to gender, showing that there is a
higher percentage of singles and people who used drugs (in general), including marijuana, alcohol, snorted cocaine and crack
among male users.
Table 1 – Distribution of social and demographic variables and use
of legal/illegal drugs during last year among CTA users according
to gender, in Montes Claros, MG, 2007-2009.
Male
Variable
n
%
Female
n
p-value
%
Marital status
< 0.001#
Married/concubine
206
29.1
289
42.2
Single
462
65.3
344
50.2
Divorced/widower
39
5.5
52
7.6
Schooling (years of study)
0.304#
None
10
1.5
10
1.5
From 1 to 3
35
5.1
39
5.8
From 4 to 7
181
26.3
210
31.3
From 8 to 11
356
51.8
319
47.5
12 and more
105
15.3
94
14.0
Used legal and/or illegal
drugs
< 0.001#
No
189
26.5
307
44.5
Yes
524
73.5
383
55.5
Used alcohol
< 0.001#
No
212
29.6
318
45.9
Yes
504
70.4
375
54.1
Used marijuana
< 0.001#
No
609
85.1
660
95.2
Yes
107
14.9
33
4.8
Used snorted cocaine
< 0.001#
No
642
89.7
677
97.7
Yes
74
10.3
16
2.3
Used injectable cocaine
0.968#
No
713
99.6
690
99.6
Yes
03
0.4
03
0.4
Used crack
< 0.001#
No
665
92.9
685
98.8
Yes
51
7.1
08
1.2
Used heroine
0.508*
No
Yes
715
99.9
01
0.1
693
100.0
# Chi-square test (χ ).
* Fisher exact test.
p < 0.05 results were considered significant.
2
Regarding the type of HIV exposure, men and women exposed themselves mainly and similarly through sexual intercourse
without protection. Other possible, although more rare forms of
exposure to injury, such as blood/hemoderivatives and transfusion
accidents with biological material, were also identified and occurred more significantly among women (Table 2).
DST - J bras Doenças Sex Transm 2013;25(1):16-20
18
HOLZMANN et al.
Men were more sexually active last year and had a greater number of sexual partners but, on the other hand, used more condoms
during intercourse than women, which is a significant difference
when it is about fixed partnership (Table 2).
DISCUSSION
This study was based on secondary data and therefore is subject
to limitations which may interfere in a greater or lesser degree to
Table 2 – Distribution of exposure forms to HIV and behavior and
sexual practices during last year among CTA users according to
gender, Montes Claros, MG, 2007-2009.
Variable
Male
n
%
Female
n
%
Unprotected sexual intercourse
(in life)
p-value #
0.173
No
50
7.0
62
8.9
Yes
666
93.0
631 91.1
Blood transfusion/
hemoderivatives
0.011
No
710
99.2
675 97.4
Yes
6
0.8
18
No
711
99.3
691 99.7
Yes
9
7.2
2.6
Syringes/needles sharing
0.246
5
3.9
Occupational (exposure to
biological material)
0.027
No
713
99.6 682 98.4
Yes
03
0.4
11
1.6
Had sexual partner last year?
0.005
No
35
4.9
60
Yes
680
95.1
633 91.3
8.7
Number of sexual partners last
year
< 0.001
None
35
4.9
60
8.7
1 partner
226
31.7
451 65.2
2 partners
153
21.5
95
13.7
3 or more partners
298
41.9
86
12.4
Condom use with partner last
year
0.004
Used every time
109
20.1
73
12.4
Did not use
233
43.0
287 48.6
Used less than half of the times
112
20.7
135 22.9
Used more than half of the times
88
16.2
95
16.1
Condom use with casual
partner last year
0.312
Used every time
207
44.4
57
38.0
Did not use
85
18.2
33
22.0
Used less than half of the times
47
10.1
21
14.0
Used more than half of the times
127
27.3
39
26.0
# Chi-square test (χ2).
p < 0.05 results were considered significant.
DST - J bras Doenças Sex Transm 2013;25(1):16-20
the results presented. It is worthy to mention the non-representativeness of the studied population compared to general population. Users of CTA, besides constituting a constrained demand,
tend to riskier behaviors. The occurrence of a “socially acceptable” response is also predictable when it comes to issues related
to sexuality.
Despite its limitations, the results showed the vulnerability of
the population studied in relation to the risk of HIV transmission/
infection and allowed to note a greater prevalence of the virus in
relation to the one estimated for the general population of the country(2). In addition, it was possible to verify that, although women
declare greater predominance of intercourse with fixed and exclusive partners and less involvement with drugs, they were infected
in the same proportion as men, pointing to the trend of feminization
of the epidemic in the region.
In the period delimited for the study, single men were the ones
who most sought the CTA to perform the anti-HIV test. This draws
attention to the fact that, historically, women have a better perception concerning health care. However, this may not apply to services such as the ones of the Testing and Counseling Center (CTA),
once their search involves, in most cases, the perception of STD
risk. The fact of being man and single is most frequently associated
with certain risk behaviour(5,10) and possibly to a greater perception
of these risks also, which may justify the greater presence of single
men in the CTA of Montes Claros.
Users of both genders with more than seven years of study represented more than 50% of the total. This suggests that the CTA of
Montes Claros, as well as others(5,11,12), has predominantly served a
population more favored from a social and cultural point of view,
possibly more educated, but not necessarily more cautious and careful, as the results of this and other research conducted in Brazil
have shown(5,11,12).
Some authors(13-15) have suggested that education seems to have
lost its prominence as an indirect indicator to characterize the differences concerning the practices of risk against HIV, since regardless of educational level and income, population has currently a
considerable degree of basic information about the forms of the
virus transmission, information that is not always translated towards the adoption of safer practices.
Regarding the use of drugs, other studies have also found an association between males and higher consumption of drugs, as well
as lower frequencies of risk behaviors among women(7,10).
In that context, the intoxication caused by drugs, including alcohol, favours the decreased ability to discern the risks associated
with HIV infection, which complicates the negotiation and, consequently, the use of condoms, thereby facilitating the spread of
HIV and other STDs(16-18). Men engage more often in risky sexual behavior while drunk, tending to practice sex without condom,
both with fixed partners as with casual partners, including with sex
professionals(1).
The sexual via, like the national reality, is the main way of exposure of women and men to HIV virus(1). As for the sexual behavior, although the National Survey on Sexual Behavior and Practices, published in 2008, pointed to a declining trend of differences of behaviors
and sexual practices between men and women, signaling to a process
of change in the country(4), significant differences of these behaviors
between genders are still observed in CTA of Montes Claros.
Behavioural Differences between Users Seeking HIV Testing at Testing and Counseling Center in the Montes Claros City, Minas Gerais
Men are more sexually active and had a higher number of sexual
partners than women, but on the other hand reported more frequent
use of condoms. Although men were more protected from a sexual point of view, this has not occurred in more than 50% in both
genders, showing that the use of condoms in these intercourses,
fixed or casual, are still below the expected(5,12). In reproductive
and sexual life, the use of male condom, although meeting the dual
function of protection, both of unwanted pregnancy and STDs, still
finds explicit or veiled resistances described mainly in stable relationships between men and women.
Probably the shortest adherence to a consistent use of condoms
in stable relationships also observed in this study is justified by
the concept embodied by the society that vulnerability is greater
in situations of non-marital intercourse, especially when the other
person involved is not “yet” known in such a way that it can be
considered reliable(19). In this perspective, “meeting and/or relying”
on a partner becomes a risk factor of difficult intervention, which
increases the vulnerability of people to HIV. Thus, many people
are contaminated for trusting stable or casual partners, although
the campaigns emphasize the practice of safe sex as a protection
factor against HIV(12).
Besides the confidence in existing stable relationships supposedly fidelity, other factors also contribute to the unprotected
sex, especially among women, such as the low bargaining power
between them and their partners, lower vulnerability self-perception, as well as prejudice against the use of condoms, especially
regarding the sensitivity and the discomfort caused during sexual
intercourse(5).
Perhaps the most important amongst these factors is the lower
self-perception of the risk, especially in heterosexual, caused by
beliefs and cultural habits that harm the individual risk assessment(11).
A study of Ferreira(14) showed an increase in the proportion of
Brazilians who declared not present risk regarding Aids, in relation
to a survey conducted earlier. It has been shown that the self-perception of risk is smaller in women, especially among those who
have stable relationships(7), which may explain the low adherence
to condom. In this way, ads and campaigns divulging the adoption
of safe practices solely through the use of condoms have little success among women with regular partner, probably because they
consider themselves protected by this kind of relationship, where
manifestations of love and affection don’t match the requirement
of condom use(7).
Similarly, suggesting monogamy as a means of HIV prevention,
especially for the male audience, doesn’t seem to be a compelling
strategy, since the infidelity is something adopted in the construction of men’s sexuality(20,21). Alternatively, authors have suggested
strengthening the need for the association of preventive measures,
at least to extramarital or casual affairs(22), as well as encourage
couples living in fixed partnership to have access to testing and
to communicate about the results, defining the use of condom in
a context considered as “shared prevention, and not assumed”(19).
Regarding the use of protection in casual intercourses, a nationwide study showed an increased condom use among those who
have had only casual partners last year, from 63.5% in 1998 to
78.6% in 2005. Men and singles from 16 to 24 years were the most
protected, especially in casual intercourses(23). In this study, althou-
19
gh it was not found significant differences between genders regarding the use of condom in casual relationships, women are also less
protected in these circumstances.
Similar to fixed intercourses, the reasons that usually justify
this practice are grounded in cultural bases involving power relationship and affection between the genders, as the male immediacy
and the female submission and difficulty in the negotiation(6,20,21,24).
Finally, the condom use during intercourse is not a simple matter of “standardization” of behaviors(20). Although the use of condom is the method proven to be safer to avoid HIV transmission(24),
the prevention speech cannot be crystallized, as even having this
knowledge, people don’t always use it in practice, even in situations recognized as most risky(14,15,24).
CONCLUSION
The results of this study confirm the higher prevalence of HIV
in users of the Testing and Counseling Centers in relation to the
estimated prevalence for the general population of Brazil(2). They
show that although women have engaged less frequently in risky
behaviors, their proportion of infection was the same of men’s, probably due to unprotected sex.
This no condom use practice evidenced mainly among women
involves feelings that cross gender relations, such as submission
and trust by interfering in the risk perception and in the possibility
of rational adoption of protective behaviours against the virus, which
contributes to the feminization of the epidemic.
Due to what was presented, we reiterate the idea that prevention
programs to succeed must consider the social, economic and cultural components that structure the inequalities between men and
women and that are able to settle a distinct epidemic profile for the
genders.
Conflict of interests
Authors declared there was no conflict of interests.
Acknowledgement
To Thiago Luis de Andrade Barbosa, for the critical review of
the manuscript, especially on the methodological aspects.
REFERENCES
1.
2.
3.
4.
5.
6.
Brito AM, Castilho EAC, Szwarcwald CL. Aids infecção pelo HIV
no Brasil: uma epidemia multifacetada. Rev Soc Bras Med Trop.
2001;34(2):207-217.
Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. Departamento de DST/AIDS e Hepatites Virais. Boletim Epidemiológico Aids/
DST. Brasília: Ministério da Saúde; 2011.
Pereira JA, Marques RH, Fonseca LVL, Eleutério AM, Bonfim MLC,
Dias OV. Infecção pelo HIV e aids em município do norte de Minas Gerais. Revista de APS. 2011;14(1):39-49.
Barbosa RM, Koyama MAH. Comportamento e práticas sexuais de homens e mulheres, Brasil 1998 e 2005. Rev Saúde Pública. 2008;42(Supl
1):21-33.
Sousa MCP, Espírito Santo ACG, Motta SKA. Gênero, vulnerabilidade
das mulheres ao HIV/Aids e ações de prevenção em bairro da periferia de
Teresina, Piauí, Brasil. Saúde Soc. 2008;17(2):58-68.
Maia C, Guilhem D, Freitas D. Vulnerabilidade ao HIV/Aids de pessoas heterossexuais casadas ou em união estável. Rev Saúde Pública.
2008;42(2):242-48.
DST - J bras Doenças Sex Transm 2013;25(1):16-20
20
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
HOLZMANN et al.
Silva MS, Vargens OMC. A percepção de mulheres quanto à vulnerabilidade feminina para contrair DST/HIV. Rev Esc Enferm USP.
2009;43(2):401-06.
Deslandes SF, Mendonça EA, Caiaffa WT, Doneda D. As concepções de
risco e de prevenção segundo a ótica dos usuários de drogas injetáveis.
Cad Saúde Pública. 2002;18(1):141-51.
Oliveira RMR. Gênero, direitos humanos e impacto socioeconômico da
Aids no Brasil. Rev Saúde Pública. 2006;40(Supl):80-7.
Colares V, Franca C, Gonzalez E. Condutas de saúde entre universitários:
diferenças entre gêneros. Cad Saúde Pública. 2009;25(3):521-28.
Germano FN, Silva TMG, Mendoza-Sassi R, Martínez AMB. Alta prevalência de usuários que não retornam ao Centro de Testagem e Aconselhamento (CTA) para o conhecimento do seu status sorológico: Rio Grande,
RS, Brasil. Ciênc Saúde Colet. 2008;13(3):1033-40.
Shneider IJC, Ribeiro C, Breda D, Skalinski LM, Orsi Ed’. Perfil epidemiológico dos usuários dos Centros de Testagem e Aconselhamento do
Estado de Santa Catarina. Cad Saúde Pública. 2008;24(7):1675-88.
Brasil. Ministério da Saúde. Coordenação Nacional de DST e Aids. Vigilância do HIV no Brasil: novas diretrizes. Brasília: Ministério da Saúde;
2002.
Ferreira MP. Nível de conhecimento e percepção de risco da população brasileira sobre o HIV/Aids, 1998 e 2005. Rev Saúde Pública.
2008;42(Supl.1):65-71.
Antunes MC, Peres CA, Paiva V, Stall R, Hearst N. Diferenças na prevenção da Aids entre homens e mulheres jovens de escolas públicas em São
Paulo, SP. Rev Saúde Pública. 2002;36(Supl.4): 88-95.
Kalichman SC, Simbayi LC, Vermaak R, Cain D, Jooste S, Peltzer K.
HIV/Aids risk reduction counseling for alcohol using sexually transmitted
infections clinic patients in Cape Town, South Africa. J Acquir Immune
Defic Syndr. 2007;44(5):594-600.
Stoner S, Georde WH, Peter LM, Norris J. Liquid courage: alcohol fosters
risk sexual decision-making in individuals with sexual fears. Aids Behav.
2007;11:227-37.
DST - J bras Doenças Sex Transm 2013;25(1):16-20
18. Maisto SA, Carey MP, Carey KB, Gordon CM, Schum JL, Lynch KG. Relationship between alcohol and participant characteristics on attitudes and
behavioral skills relevant to safer sex among heterosexual young adult
men. Arch Sex Behav. 2004;33:571-84.
19. Cardoso LRD, Malbergier A, Figueiredo TBF. O consumo de álcool como
fator de risco para a transmissão das DSTs/HIV/Aids. Rev Psiquiatr Clín.
2008;35(supl 1):70-5.
20. Madureira VSF, Trentini M. Da utilização do preservativo masculino à
prevenção de DST/aids. Ciênc Saúde Colet. 2008;13(6):1807-16. 21. Guerriero I, Ayres JR, Hearst N. Masculinidade e vulnerabilidade ao
HIV de homens heterossexuais, São Paulo, SP. Rev Saúde Pública.
2002;36(4):50-60.
22. Marin BV, Gomez CA, Tschann JM, Gregorich SE. Condon use in unmarried latino men: a test of cultural constructs. Health Psychology.
1997;16(Suppl 5):458-67.
23. Berquo E, Barbosa RM, Lima LP de. Uso do preservativo: tendências entre 1998 e 2005 na população brasileira. Rev Saúde Pública.
2008;42(Supl.1): 34-44.
24. Santos NJS, Barbosa RM, Pinho AA, Villela WV, Aidar T, Filipe EMV.
Contextos de vulnerabilidade para o HIV entre mulheres brasileiras. Cad
Saúde Pública. 2009;25(Supl 2):321-33.
Address to correspondence:
ANA PAULA F HOLZMANN
Rua Christina Vasconcelos, 257, apto 201
Montes Claros, MG, CEP: 39401-816
Phone: +55 (38) 3221-0486
E-mail: [email protected]
Received in: 07.06.2013
Approved in: 28.07.2013
ARTICLE
Incidence of Congenital Syphilis in a Metropolitan Region
of Rio de Janeiro State: Social Inequalities
Sandra C Fonseca1, Letícia M Oliveira2, Natalia MR Almeida2, Katia S Silva3, Pauline Lorena Kale4
ABSTRACT
Introduction: congenital syphilis remains a public health matter, with no perspective of reaching governmental reduction goals. There are few studies
about social inequalities and its relation with this disease in Brazil. Objective: describe occurrence of congenital syphilis in a reference hospital in a
Metropolitan Region of Rio de Janeiro State, according to socioeconomic and clinical-laboratorial variables as well. Methods: cross-sectional study, based
on interviews, review of medical records and prenatal cards. Population: all women admitted to a maternity ward during a trimester in 2011. Maternal
variables: age, schooling, skin color, income, prenatal visits. Fetus/neonate variables: birth weight, gestational age, clinical and laboratory outcomes.
Incidence of congenital syphilis (Brazilian Ministry of Health criteria) was calculated for all live births and for each social and economical variable.
Results: there were 666 eligible women, comprehending 576 deliveries – 558 live births and 18 stillbirths. We identified 22 CS cases: 18 live births, three
fetal deaths and 1 abortion. One of the neonates died in the third day of life. The incidence of CS was of 39.4/1,000 live births. Socioeconomic variables –
low education, low income and black skin – were related to a greater incidence. Only 13 out of 22 cases were identified in prenatal care. Conclusion: our
results pointed to social inequalities in the congenital syphilis incidence. As prenatal care is also related to socioeconomic variables, investments in quality
of maternal assistance should be directed to more vulnerable women.
Keywords: congenital syphilis; incidence; perinatal mortality; prenatal care; social inequalities.
INTRODUCTION
Congenital syphilis (CS) is the infectious disease that results
from the vertical Treponema pallidum transmission of the non treated or inadequately treated infected mother, to her child(1). CS is
an important cause of perinatal morbidity and mortality, leading
to negative outcomes, such as spontaneous abortion, natimortality,
neonatal mortality, low weight and prematurity, according to the
stage of infection in the woman and the moment of the mother-to-child transmission. Most newborn cases are asymptomatic; when
symptomatic, cases can present low birth weight, prematurity, fetal
hydropsy, vesicular-bullous rash on palms and plants, hepatosplenomegaly and sepsis(2).
Syphilis during pregnancy contributes to 650,000 fetal and neonatal deaths per year in developing countries(3). Based on these
data, World Health Organization (WHO), in 2009, released an initiative aiming at the improvement of maternal and newborn health
by decreasing the number of cases of congenital syphilis for at least
80% in five years(3).
Additionally, Pan American Health Organization (PAHO) has
developed, also in 2009, the “Regional Initiative for the Elimination of mother-to-child transmission of HIV and congenital syphilis in the Latin America and Caribbean”, which was approved in
2010 by the member States of PAHO with the purpose of reducing
the incidence of CS to less than or equal to 0.5 per thousand live
births by 2015(4).
In Brazil, despite advances in the diagnosis and effective treatment of the disease, the vertical transmission rates remain very
1 Public Health Doctor, Assistant Professor of the Epidemiology and
Biostatistics Department at the Comunity Health Institute of Fluminense
Federal University.
2 Graduating in Medical School at Fluminense Federal University.
3 Public Health Doctorate, Post-graduation Coordinator of the Women,
Children and Adolescents Health at the Fernandes Figueira Institute,
FIOCRUZ.
4 Biomedical Engineering Doctorate, Epidemiology Associate Professor at
Medical School and Public Health Study Institute of Rio de Janeiro Federal
University.
Institution: Comunity Health Institute – Fluminense Federal University.
DOI: 10.5533/DST-2177-8264-201325105
high. Between January 1998 and June 2012, 80,041 cases of congenital syphilis in children under 1 year of age were notified. The
Southeast region recorded 45.9% of these cases. The incidence rate
of congenital syphilis, in 2011, was of 3.3 cases per 1,000 live births, while in the Southeast, the value was a little higher – 3.8 per
1,000 live births. The State of Rio de Janeiro was prominent(5), with
the highest rate of 2011 (9.8 per 1,000 live births).
According to SINAN (Information System for Reportable Diseases), most CS cases occur in Rio de Janeiro State capital, followed
by Baixada Fluminense and two cities of the Metropolitan Region
II: Niterói and São Gonçalo(6).
The objective of the present study is to describe the occurrence
of the disease in a reference maternity ward located in the Metropolitan Region II in the State of Rio de Janeiro. The social and the
demographic profiles, and the assistance to recent mothers, as well
as clinical and laboratory characteristics of fetuses and neonates
were taken into consideration.
METHODS
A cross-sectional study was performed with interview, medical
records review and prenatal cards of all mothers and their newborn
babies in the State Hospital Azevedo Lima (HEAL) maternity,
from September to November, 2011. Located in the city of Niterói, Rio de Janeiro State, this is a reference hospital of the Unified
Health System (SUS - Sistema Único de Saúde) for the Metropolitan
Region II, including the cities of Itaboraí, Maricá, Niterói, Rio Bonito, São Gonçalo, Silva Jardim and Tanguá whith an estimated
population around 1,957,936 in 2011 according to DATASUS(7).
This study is a subproject of the “Maternal and perinatal morbidity-mortality in the cities of Rio de Janeiro and Niterói: the
role of race, schooling, and social level in the access to health
services” accomplished in a partnership between the Community Health Institute (ISC-UFF), Collective Health Studies Institute
(IESC-UFRJ), Fernandes Figueira Institute (IFF-FIOCRUZ), and
Public Health School (FSP-USP). The FSP original project, named
“Mother-child Binomial Study: a necessity commanded to meet
the needs of the millenium development”, was adapted to the State
of Rio de Janeiro reality.
DST - J bras Doenças Sex Transm 2013;25(1):21-25 - ISSN: 0103-4065 - ISSN on-line: 2177-8264
22
In order to attend to the multiple outcomes of the research, the
sample size was based on the livebirth number at the maternities
included in the study, foreseen the collecting data for a period of
three months, according to a similar WHO study(8).
A congenital syphilis case definition of the National STD
and Aids Program of the Health Ministry was adopted(1) as
follows: every child, or abortion, or stillbirth of mother with clinical evidence for syphilis serology and/or with non-treponemal
reagent for syphilis with any titration, in the absence of confirmatory test held at treponemal prenatal care or at delivery time or
curettage, which had not been treated or had received inadequate
treatment.”
Total and specific perinatal mortality rates were calculated for
CS per thousand births, and also the incidence rates of total congenital syphilis: new congenital syphilis cases, including miscarriages, stillbirths and live births divided by the total number of live
births in the quarter in question, multiplied by 1,000(5) – and according to socioeconomic characteristics (skin color, average income per capita and schooling). Despite the cross-sectional feature of
the study, the calculation of CS incidence is recommended because
it considers all possible outcomes during pregnancy.
The maternal characteristics assessed for the study population in general, and in particular the cases of CS were: age (19
years, 20-34 years, ≥ 35 years); schooling (low < 8 years of study,
and high ≥ 8 years of study); skin color, as declared by woman; per capita family income; number of prenatal visits and adequacy of prenatal care. The criterion of adequacy considered the
following number of visits: for women with 37 or more weeks,
seven visits or more, for those between 32 and 36 weeks, five
visits; between 28 and 31 weeks, four visits; between 22 and 27
weeks, three visits; and at least two visits for women with less
than 22 weeks(9). The month of the beginning of prenatal care
was also taken into consideration, and considered adequate if the
first consultation occurred until 16 weeks of pregnancy. For CD
cases, non-treponemal tests – VDRL – during prenatal care and
childbirth were analyzed.
Gestational age and birth weight were evaluated for the neonates, as well as changes in blood count and VDRL in the blood
or liquor. An algorithm was used for the calculation of gestational age, in the attempt of the best estimate, prioritizing the date
of last menstruation and/or ultrasonography of the first quarter.
When both were absent, the evaluation of the newborn by Capurro method(10) or Ballard(11) were applied, and registered by the
pediatrician. To assess suitability of the weight to the gestational age, the standards established for Brazilians neonates were
used(12).
The data were processed and analyzed by SPSS® statistical
software, version 17. For continuous variables, average and standard deviation were calculated, where applicable. To verify the
association between categorical variables, the Chi-square (χ2) was
used; T-test was applied for the average difference, considered a
statistical significance level less than 0.05.
The research project was approved by the Research Ethics Committee of IESC-UFRJ (approval no 35/2011). Informed consent was
requested to all eligible pregnant women or to their respective responsible when they were under 18 years of age.
DST - J bras Doenças Sex Transm 2013;25(1):21-25
fonseca et al.
RESULTS
A total of 666 women were eligible for the study, of whom there
were 576 births, 52 miscarriages, and 12 ectopic pregnancies. Only
four refused to participate in the study.
Of the total births, 558 were live births (four twins) and 18 fetal deaths. Perinatal mortality in the period studied was of 50 per
1,000 births.
The user population of HEAL showed unfavorable socioeconomic conditions, with a high percentage of adolescents (30%) and
women with incomplete elementary school (35%). The average per
capita income was of R$ 300.00. About prenatal care, less than half
reported having done seven or more visits (Table 1).
A total of 22 cases of CS was verified, of whom 18 livebirths,
three stillbirths, and one miscarriage. Thirteen cases of women resident in the city of Niterói, seven from São Gonçalo, one from
Maricá, and one from Itaboraí. The incidence found in CS was
of 39.4 per 1,000 live births for the quarter reviewed. Congenital
syphilis was responsible for four of the 29 deaths during the perinatal period with a CS perinatal mortality rate of 6.9 per 1,000 births,
being the fetal component of 5.2 per 1,000 births.
Through the analysis of the 22 women whose fetuses or newborn babies (NB) had a diagnosis of CS, it was observed an age
between 15 and 33 years, with an average of 20.5 years and a percentage of adolescent mothers of 40.9%.
Table 1 – Characteristics of recent mothers and subgroup of women with outcome of congenital syphilis (CS) admitted in the State
Hospital Azevedo Lima (HEAL) maternity ward, Niterói, Rio de
Janeiro, September to November, 2011
Variable
HEALa
women
N = 553
CS
Subgroup
N = 22
Age (%)
0.268
≤ 19 years
29.8
40.9
20-34
62.4
59.1
≥ 35 years
7.8
--
White
27.5
0
Black
24.7
40.9
Mulatto
46.5
54.6
Others
1.3
4.5
2.7
9.1
Color (%)
0.017
Schooling (%)
< 4 years
p-value
< 0.0001
4-7 years
30.4
72.7
8-11 years
63.6
18.2
12 years or more
3.1
0
R$ 401.00
R$ 245.00
≤ 3 visits
16.2
22.7
4-6 visits
36.7
39.9
7 or more
47.1
36.3
Per capita income (R$)
Average
Prenatal visits (%)
a
0.0001
0.562
Total of women whose children have not had congenital syphilis.
23
Incidence of Congenital Syphilis in a Metropolitan Region of Rio de Janeiro State: Social Inequalities
From 2002 to 2004, a study performed in HEAL(13) presented
an incidence of 21.9‰; however, after 10 years it was observed an
incidence of congenital syphilis almost twice greater.
We have observed a high percentage of adolescent mothers,
data presenting similarity in the same hospital between 2002 and
2004(13). Some studies have found links between adolescence and
occurrence of congenital syphilis(16,19); however Lima et al. (2013)
did not demonstrate this association in the city of Belo Horizonte,
State of Minas Gerais.
The user population of the HEAL maternity has unfavorable socioeconomic conditions, and we have observed that the subgroup
of women whose fetuses had CS proved even a greater disadvantage, particularly in relation to income, race and education, and these
data were confirmed in other national studies(14-16,19,22,23).
Another factor probably related to the disease is the race issue,
yet little studied in our country(16,18,19). In our research, the incidence rate of congenital syphilis in black women was very high,
62.5‰, and there were no cases, in that period, among white women. The black population is socially more vulnerable, which may
in part explain this association.
The twenty-two women with an outcome of CS had at least one
prenatal visit, however, more than 60% had insufficient amount of
visits. However, the number of visits is not the only factor contributing to the perpetuation of congenital syphilis; the quality of prenatal care offered by the health services regarding the timely diagnosis and treatment of the disease must also be examined. We have
identified a considerable portion of the population studied (36.3%)
that even performing appropriate prenatal visits failed to prevent
the unwanted outcome. This proves the quality deficiency of prenatal care, which has been one of the main factors for the high rates of
congenital syphilis, confirmed in many national studies(15-20).
In general neonates infected by Treponema are asymptomatic at
birth, a result observed in our study. Nevertheless, complications
such as prematurity, low birth weight, liver and hematological changes are expected in these newborn babies(23-25). Prematurity and low
birth weight due to congenital syphilis are causes that raise the risk
of perinatal mortality(23). Even in the presence of negative VDRL, as
noted in two newborn babies, the thorough investigation of congenital syphilis should be performed, since this finding is not unusual(25).
The perinatal mortality rate for congenital syphilis found in our
study was greater than the one observed in the city of Rio de Janeiro(23) in 2002 (0.89%), the same occurring with the fetal mortality
for syphilis(26), which was twice the mortality found in the same
city in 2004 (2.55%). These studies also used primary data and
were not based on SINAN. The negative impact of the disease on
fetal viability justifies the intensification of preventive measures of
syphilis vertical transmission.
As a limitation of our study, we point out the small number of
cases and the short period of time (a quarter). This was due to the
In relation to socioeconomic characteristics, the percentage
of incomplete elementary education was of 81.8%, and the average per capita income was of R$ 250.00; 21 of them reported
family income less than one minimum wage at the time (Table
1). Twenty-one (95.4%) declared to be black or mulatto, and one
was of Asian origin. There were no cases among white women nor
in those with more than 11 years of education. Table 1 shows the
differences between the subgroup of women with CS and the total
of recent mothers (live births and deaths) without syphilis studied
in the maternity ward of HEAL.
The 22 women had at least one prenatal visit. However, according to the parameters used to assess the adequacy of prenatal,
59.1% received an inadequate prenatal. Only 13 (59.1%) of 22
mothers with syphilis were identified in prenatal care; seven cases (31.8%) of syphilis were diagnosed only at time of delivery,
and two (9.1%) cases were not aware of information about laboratory tests performed during the prenatal period. The VDRL
collected at the maternity ward ranged from 1:1 (a patient HIV+)
to 1:256 (Table 2).
Regarding live births with CS, three of them weighed less than
2,500 g and five had less than 37 weeks. Two babies were small
considering the gestational age, one term newborn and one pre-term
newborn, which evolved into death. Serum VDRL was positive in
16 cases (88.9%), and there were four cases (22.2%) of neurosyphilis. The neonates VDRL ranged from 1:1 to 1:256 (Table 2).
Blood evaluation tests showed anemia in five newborn (27.8%)
and thrombocytopenia in four (22.2%). Two neonates showed hepatic alterations: one of them with hepatic hyperbilirubinemia, and
the other one with hepatomegaly. One newborn presented a serious
blood dyscrasia, leukopenia, sepsis, kidney failure, and pancytopenia, evolving into death. His mother had five prenatal visits and
was identified 1:8 VDRL. She did not receive treatment, as this
serology was erroneously considered a “serological scar”. On admission, the patient presented an upward titration (1:16) and the
final outcome was the newborn death.
The incidence of congenital syphilis was significantly higher in
black women with low schooling and low income (Table 3).
DISCUSSION
Since the 90’s, WHO and other health organizations have been
striving to control the congenital syphilis in the world. In Brazil,
transmission rates remain very high and it seems unlikely to achieve the goal of global elimination of the disease(4). In our study,
it was identified an incidence rate (39.4‰) much higher than the
target set to us and higher than in other national studies(13-20) with
the same CS criteria(21). It is worth noting that there were diverse
methodology studies, with primary data, as well as data from SINAN, population and hospitals.
Table 2 – Number of patients (recent mothers and neonates) with positive VDRL collected at time of delivery, cases of congenital syphilis
(CS), State Hospital Azevedo Lima (HEAL) maternity ward, Niterói, Rio de Janeiro, September to November, 2011
VDRL/ Patients
Women
Live births
Total
1:1 a 1:2
1:4 a 1:8
1:16
1:32
1:64
1:128
1:256
6
3
9
5
9
14
5
1
6
1
2
3
2
0
2
2
0
2
1
1
2
DST - J bras Doenças Sex Transm 2013;25(1):21-25
24
fonseca et al.
Table 3 – Syphilis incidence due to socioeconomic variables – color of skin, income and schooling, State Hospital Azevedo Lima
(HEAL) maternity ward, Niterói, Rio de Janeiro, September to November, 2011
Socioeconomic
variables
Incidence rate
(by 1.000 live births)
p-value
Color of skin
White
–
Black
62.5
Mulatto
45.0
0.012a
Per capita income
< R$ 200.00
67.0
R$ 200 to 749.00
29.7
≥ R$ 750.00
18.0
0.035b
Schooling
a
b
< 8 years
90.5
≥ 8 years
10.8
< 0.0001a
Chi-square.
Chi-square with linear trend.
methodology of the original research, based on the outcomes of
neonatal morbidity. However, a strong point was the daily collection data, using various sources: interview, prenatal card, medical
records and lab tests. In studies using the Information System for
Reportable Diseases (SINAN) as a source, although there is the
advantage of being able to cover longer periods, there is a risk of
underreporting and poor quality of data(27,28).
Syphilis is not a disease of the past, and we should remind health professionals, especially in the mother-child area, of the importance of congenital syphilis among vertical transmitted diseases.
Acknowledgements
Professors Ruy Laurenti and Maria Helena P. de Mello Jorge,
for their partnership in the FSP project.
State Hospital Azevedo Lima (HEAL) Directory and Studies
Center.
The FSP project was supported by FAPESP (Proc. 09/53253-8).
The Rio de Janeiro project was supported by CNPq (edict
20/2010, process no 402426/2010-0).
Letícia Marinho de Oliveira and Natalia Merath Reis Almeida
received scientific initiation scholarship from August 2012 to July
2013 (CNPq e FAPERJ, respectively).
Conflict of interest
There is no interest conflict to be declared.
REFERENCES
1.
2.
3.
4.
CONCLUSION
Despite the simple, effective and affordable technology for
diagnosis and treatment, congenital syphilis remains high in Rio de
Janeiro women users of SUS, its higher incidence being emphasized among those with social vulnerability features.
Our results showed socioeconomic factors – low income, low
education and black/mulatto race – as predictors of the occurrence
of congenital syphilis, which may reflect inequalities in self-care,
access and continuity of health services. We believe that a differentiated attention to these most vulnerable groups would be an important strategy to be considered for the disease control guidelines.
It should also be noted that the risk of congenital syphilis is
directly related to the health service provided. The lack or precariousness of prenatal care is a risk factor for vertical transmission
of syphilis. Despite protocols are clear as to the appropriate diagnostic and treatment guidelines on pregnancy, it seems this is not
being fully followed by health professionals. The bankruptcy of
prenatal care, either due to the difficulty of access of users, or by
the caregiver inadequacy or assistance processes, is therefore the
critical point for the elimination of congenital syphilis(29,30).
We can’t generalize our data, as this is a study in just one health
unit, but it suggests that a better care quality of pregnant women,
combined with the reduction of social inequalities, would have an
impact on the incidence of congenital syphilis. As mentioned by
Saraceni et al. (2007), “it is in that portion of the population, using
the public service, where the syphilis hides and multiplies”(26).
DST - J bras Doenças Sex Transm 2013;25(1):21-25
5.
6.
7.
8.
9.
10.
11.
12.
13.
Ministério da Saúde. Secretaria de Vigilância em Saúde. Programa Nacional de DST e AIDS. Diretrizes para o Controle da Sífilis Congênita:
manual de bolso. 2ª ed. Brasília: Ministério da Saúde; 2006.
Rodríguez-Cerdeira C, Silami-Lopes VG. Sífilis congénita en el siglo
XXI. Actas Dermosifiliogr. 2012;103(8):679-93.
The global elimination of congenital syphilis: rationale and strategy for
action. Geneva, World Health Organization, 2007. Available at: http://
whqlibdoc.who.int/publications/2007/9789241595858_eng.pdf . Accessed in: 10 dez 2012.
PAHO. Iniciativa regional para la eliminación de la transmisión maternoinfantil del VIH y de la sífilis congénita em América Latina y el Caribe: documento conceptual. Montevideo: CLAP/ SMR;2009. Available
at: http://new.paho.org/hq/dmdocuments/2009/Documento%20Conceptual%20-%20Eliminación%20de%20la%20transmisión%20maternoinfantil%20del%20VIH%20y%20de%20la%20sífilis%20congénita.pdf.
Accessed in: 15 dez 2012.
Ministério da Saúde. Boletim Epidemiológico – Sífilis. 2012. Secretaria
de Vigilância em Saúde. Departamento de DST, AIDS e Hepatites Virais.
Available at: http://www.aids.gov.br/publicacao/2012/boletim-epidemiologico-de-sifilis-2012. Accessed in: 04 jan 2013.
Sistema de Informações de Agravos de Notificação – SINAN. Available
at: http://dtr2004.saude.gov.br/sinanweb/tabnet/dh?sinannet/sifilisc/bases/sifilisbrnet.def Accessed in: 11 jan 2013.
IBGE/DATASUS. Available at: < http://tabnet.datasus.gov.br >. Accessed
in: 05 jun 2012.
Souza JP, Gülmezoglu AM, Carroli G, Lumbiganon P, Qureshi Z,
WHOMCS Research Group. The world health organization multicountry survey on maternal and newborn health: study protocol. BMC Health Serv Res. 2011;11:286. Available at: http://www.biomedcentral.
com/1472-6963/11/286. Accessed in: 31 out 2011.
Bassani DG, Surkan PJ, Olinto MT. Inadequate use of prenatal services
among Brazilian women: the role of maternal characteristics. Int Perspect
Sex Reprod Health. 2009;35(1):15-20.
Capurro H, Konichezky S, Fonseca D, Caldeyro-Barcia R. A simplified
method for diagnosis of gestational age in the newborn infant. J Pediatr.
1978;93(1):120-2.
Ballard JL, Khoury JC, Wedig K, Wang L, Eilers-Walsman BL, Lipp R.
New Ballard score, expanded to include extremely premature infants. J
Pediatr. 1991;119 (3):417-23.
Pedreira CE, Pinto FA, Pereira SP, Costa ES. Birth weight patterns by
gestational age in Brazil. An Acad Bras Cienc. 2011;83(2):619-625.
Schetini J, Ferreira DC, Passos MRL, Salles EB, Santos DDG, Rapozo DCM. Estudo da Prevalência de Sífilis Congênita em um Hospi-
25
Incidence of Congenital Syphilis in a Metropolitan Region of Rio de Janeiro State: Social Inequalities
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
tal da Rede SUS de Niterói - RJ. DST – J bras Doenças Sex Transm.
2005;17(1):18-23.
Fernandes RCSC, Fernandes PGCC, Nakata TY. Análise de casos de sífilis congênita na Maternidade do Hospital da Sociedade Portuguesa de Beneficência de Campos, RJ. DST – J bras Doenças Sex Transm. 2007;19(34):157-161.
Holanda MTCG, Barreto MA, Machado KMM, Pereira RC. Perfil epidemiológico da sífilis congênita no Município do Natal, Rio Grande do
Norte – 2004 a 2007. Epidemiol Serv Saúde. 2011;20(2):203-212.
Melo NGDO, Melo Filho DA, Ferreira LCO. Diferenciais intraurbanos de
sífilis congênita no Recife, Pernambuco, Brasil (2004-2006). Epidemiol
Serv Saúde. 2011;20(2):213-222.
Kupek E, Oliveira JF. Transmissão vertical do HIV, da sífilis e da hepatite B no município de maior incidência de AIDS no Brasil: um estudo populacional no período de 2002 a 2007. Rev Bras Epidemiol.
2012;15(3):478-87.
Araújo CL, Shimizu HE, Sousa AIA, Hamann EM. Incidência da sífilis
congênita no Brasil e sua relação com a Estratégia Saúde da Família. Rev
Saúde Pública. 2012;46(3):479-86.
Lima MG, Santos RF, Barbosa GJ, Ribeiro GS. Incidência e fatores de
risco para sífilis congênita em Belo Horizonte, Minas Gerais, 2001-2008.
Cien saúde colet. 2013;18(2):499-506.
Costa CC, Freitas LV, Sousa DMM, Oliveira LL, Chagas ACMA, Lopes
MVO et al. Sífilis congênita no Ceará: análise epidemiológica de uma
década. Rev Esc Enferm USP. 2013;47(1):152-9.
Tayra A, Matida LH, Saraceni V, Paz LC, Ramos Jr NA. Duas décadas
de vigilância epidemiológica da sífilis congênita no Brasil: a propósito
das definições de caso. DST – J bras Doenças Sex Transm. 2007;19(34):111-119.
Lago EG, Rodrigues LC, Fiori RM, Stein AT. Congenital syphilis: identification of two distinct profiles of maternal characteristics associated with
risk. Sex Transm Dis. 2004;31(1):33-37.
Saraceni V, Guimarães MHFS, Theme Filha MM, Leal MC. Mortalidade
perinatal por sífilis congênita: indicador de qualidade da atenção à mulher
e à criança. Cad Saúde Pública. 2005;21(4):1244-1250.
24. Araújo EC, Moura EFA, Ramos FLP, Holanda VGDA. Sífilis congênita:
incidência em recém-nascidos. J pediatr. (Rio de J) 1999;75(2):119-125.
25. Lago EG, Vaccari A, Fiori RM. Clinical features and follow-up of congenital syphilis. Sex Transm Dis. 2013;40(2):85-94.
26. Saraceni V, Domingues RMSM, Lauria SM, Vellozo V, Dias MAB, Ratto KMN et al. Vigilância da sífilis na gravidez. Epidemiol Serv Saúde.
2007;16(2):103-111.
27. Secretaria do Estado de Saúde. Coordenadoria de Controle de Doenças
CCD. Coordenação do Programa Estadual DST/AIDS. Serviço de Vigilância Epidemiológica. Sífilis congênita e sífilis na gestação. Rev Saúde
Pública. 2008;42(4):768-772.
28. Saraceni V, Vellozo VI, Leal MC, Hartz ZMA. Estudo de confiabilidade
do SINAN a partir das Campanhas para a Eliminação da Sífilis Congênita
no Município do Rio de Janeiro. Rev bras epidemiol. 2005;8(4):419-424.
29. Domingues RMSM, Hartz ZMA, Leal MC. Avaliação das ações de controle da sífilis e do HIV na assistência pré-natal da rede pública do município do Rio de Janeiro, Brasil. Rev Bras Saúde Mater Infant. 2012;12
(3):269-280.
30. Ferreira C, Ribeiro D, Oliveira EC, Barbosa MJ, Simão MBG, Pinto VM.
O desafio da redução da transmissão vertical do HIV e da Sífilis no Brasil.
DST – J Bras Doenças Sex Transm. 2007;19(3-4):184-186.
Address to correspondence:
SANDRA COSTA FONSECA
Rua Paulo César, 179 apto. 501. Niterói, RJ
CEP: 24240-000
Tel: +55 (21) 9994-1544
E-mail: [email protected]
Received in: 15.05.2013
Approved in: 16.07.2013
DST - J bras Doenças Sex Transm 2013;25(1):21-25
ARTICLE
HIV Pregnant Women with More than One Pregnancy and
the Use of Antiretroviral During
Pre-natal Care and Childbirth
Dai Chengyao1 & Lucia YI Nichiata2
ABSTRACT
Introduction: the increasing numbers of women infected by HIV resulted in the risk of a vertical transmission of the virus, and prevention has been
conducted by means of prophylaxis and antiretroviral (ARV) interventions. Although medication in Brazil has been available since 1996, only 69% of
HIV positive pregnant women used ARV methods properly during pre-natal care. Objective: to describe the socio-demographic and reproductive health
profile of women who had more than one HIV positive pregnancy and identify the use of antiretroviral during pre-natal care and childbirth. Methods: we
accessed 2.106 registers of HIV pregnant women at the SINAN, residing in São Paulo, from January 2007 to March 2011, and we selected 284 notifications
of women with more than one pregnancy. Dependent variable: use of ARV; independent variables: age, race/color, education, occupation, pre-natal care,
type of delivery, use of ARV in childbirth, pregnancy outcome, use of ARV prophylaxis in children. We conducted a Pearson Chi-square test, considering a
confidence interval (CI) p < 0.05. Results: of the 284 pregnant women, 254 were HIV positive in their second childbirth and 30 in their third. The women
were predominantly young, white, had a high school degree, and were housewives and workers in industries and services. 84.9% of them had pre-natal
care, and of these, 82.6% used ARV during their term. During childbirth 77.3% received intravenous AZT. Over the course of the first 24 hours after birth,
91.5% of the infants received prophylaxis treatment. There was a significant statistical relation between the use of ARV during pre-natal care. Conclusion:
the study revealed that, although these women were HIV positive in their second or third pregnancy, there is a lower percentage of HAART use than what
is shown in present publications.
Keywords: anti-retroviral agents, pregnancy, HIV, pre-natal care, prevention & control
INTRODUCTION
The heterosexual transmission of HIV resulted in a larger
number of infected women, and consequently, the vertical transmission of HIV became an important issue for collective health
policies(1-3).
It has been demonstrated that, during pregnancy, the risk of
infecting the child, when there is no prophylaxis intervention, is
estimated at 25 to 30%. During childbirth the risk increases to 65
to 70%, and during the lactating period the rate is of 7 to 39%(4).
With the introduction of the ACTG Protocol 076, in 1996, and
in 2001 of Highly Active Antiretroviral Therapy (HAART) for
pregnant women, it has been possible to reduce this rate to less
than 1%(5). It is estimated that in Brazil, following the recommendation for vertical transmission prophylaxis, with the use of
HAART, the risk of HIV infection for infants is 3%(6).
The country’s prophylaxis recommendations, for preventing
the vertical transmission of HIV, are as follows: provide anti-HIV testing, with pre and post-test counseling for all pregnant
women in pre-natal care services; testing should be voluntary
and confidential; administer Zidovudine (AZT) oral medication
in HIV positive pregnant women, starting on the 14th week of
pregnancy, intravenous AZT during labor and childbirth, un-
HIV Pregnant Women with More than one Pregnancy and the Use of
Antiretroviral During Pre-natal Care and Childbirth is a Scientific Initiation
Project funded by the CNPq/PIBIC 2011/2012.
1 Undergraduate of the Nursing School of the University of São Paulo, São
Paulo, SP, Brazil.
2 Professor and Doctor of the Department of Collective Health Nursing at
the Nursing School of the University of São Paulo, São Paulo, SP, Brazil.
til the umbilical cord is clamped and oral AZT for the infant
over the course of 6 weeks, according to the 076 Protocol of the
ACTG. Preferably the delivery method should be a c-section, to
avoid contact of the baby with the virus, but vaginal delivery is
recommended when the viral load test is less than 1,000 copies/
mL or undetectable and the gestational age is over 34 weeks.
Pregnant or postpartum women are advised to replace breastfeeding with artificial milk and other foods, according to the child’s
age, as long as it does not hinder the infant’s proper growth and
development(7).
In Brazil there has been a progressive increase in the number of
women diagnosed prior to their pregnancy, consequently the percentage of HIV positive pregnant women with antiretroviral (ARV)
treatment during pre-natal care has increased(8).
However, despite of all the investments made by public policies in the country to expand the access of HIV positive pregnant
women to HAART, there is still a significant percentage of women
who have not received the medication, either during their pregnancy or during childbirth.
In a study conducted by Nichiata(9), it was possible to identify
women who had more than one pregnancy, and were aware of the
HIV positive diagnosis, where more than one child from the same
mother was born with HIV. The study questioned if women in these
conditions used ARV prophylaxis.
OBJECTIVE
To describe the demographic and reproductive health profile
of women who had more than one HIV positive pregnancy and
identify the use of antiretroviral during pre-natal care and childbirth.
DST - J bras Doenças Sex Transm 2013;25(1):26-30 - ISSN: 0103-4065 - ISSN on-line: 2177-8264
DOI: 10.5533/DST-2177-8264-201325106
27
HIV Pregnant Women with More than One Pregnancy and the Use of Antiretroviral During Pre-natal Care and Childbirth
METHODS
It is an exploratory, descriptive, cross-sectional and quantitative
study, using a secondary database.
Data collection was made by means of the Sistema de Informação de Agravos de Notificação (SINAN), where we accessed the
registrations of HIV positive pregnant women in the city of São
Paulo, over the course of January 2007 and March 2011. Of a total
of 2,106 registrations in the original database, we elaborated a
specific spreadsheet containing the total of HIV positive pregnant
women who had more than one pregnancy, and we identified 284
registrations.
Dependent variables were: the use of ARV interventions during
pre-natal care, during delivery and by the child. Independent variables were: age, race/color, education, pre-natal care, and evolution
of the pregnancy.
The results underwent a Pearson Chi-square test, in order to
verify the connection between the study’s variables, with a confidence interval of 95%, or in other words, there is a 5% acceptable
probability of error for the connection, p < 0.05. Over the course
of the test, for the use of ARV interventions during delivery and
evolution of the delivery, we used as criteria the factor of women
who had their pregnancy outcome during the notification period of
the SINAN.
The research was approved by the Comitê de Ética em Pesquisa
da Secretária Municipal da Saúde (Ethics Research Committee of
the Municipal Secretariat of Health) of the city of São Paulo, with the
protocol no 255.0.162.000-10.
Table 1 – Socio-demographic profile of HIV positive pregnant women in the city of São Paulo, São Paulo, from 2007 to 2011*
Socio-demographic variables
N
%
≤ 19 years old
13
4.6
20- 29
122
43.0
30- 39
125
44.0
40- 49
23
8.0
No information
1
0.4
284
100.00
White
123
43.3
Black
50
17.6
Yellow
4
1.6
Brown
91
32.0
Indian
2
0.7
No information
14
4.8
Total
284
100.00
None
4
1.4
RESULTS
1-3 years
13
4.6
Of the 284 pregnant women identified as being HIV positive,
254 (89.4%) were in their second pregnancy and 30 (10.6%) were
in their third pregnancy. They were mainly young, white, had a
high school degree, and were housewives and workers in industries
and services.
Their age ranged from 20 to 39 years old (87.0%), 13 were teenagers, with ages ranging from 17 to 19, and one of them was HIV
positive and was in her third pregnancy. (Table 1).
The majority of women, 136 (47.9%) had 8 or more years of
education. As for their jobs(10), they were mainly classified as “undefined” (48.2%), and this category includes housewives, unemployed and students (Table 1).
The majority of women 241(84.9%) had pre-natal care. And 107
of them (37.7%) were in the first quarter of their pregnancy when
they started pre-natal care (Table 2).
Of the 241 women who had pre-natal care, 30 (12.4%) did not
use ARV treatment during this period. Of the women that gave
birth, (216), 41 (19%) of them did not receive prophylactic ARV
treatment during pre-natal care. The majority of the women, 119
(55.0%) gave birth with a c-section (Table 2).
The use of ARV during pre-natal care was associated to the
pregnant women’s education (p < 0.05), and it showed that the women that used ARV during pre-natal care were, for the most part,
the ones with 5 to 8 years of education (Table 3).
4-7 years
100
35.2
8 or more years
136
47.9
No information
31
10.0
284
100.00
Public servants. managers in public organizations
or private companies. managers
2
0.7
Sciences and arts
2
0.7
Mid level technicians
17
6.0
Management services
15
5.3
Services. sales and supermarkets
38
13.4
Goods production and industry workers
7
2.5
137
48.2
No information
66
23.2
Total
284
100.00
Age
Total
Race/Color
Education
Total
Ocupation (CBO, 2002)
10
Other occupations. undefined
students. housewives. others
–
unemployed.
*Data from March 2011.
Source: SINAN.
DST - J bras Doenças Sex Transm 2013;25(1):26-30
28
CHENGYAO & NICHIATA
Table 2 – Reproductive profile of HIV positive women in São Paulo. São Paulo, 2007 to 2011*
Pregnancy Characteristics
N
%
Pregnancy stage when pre-natal care
began
Table 3 – Number and percentage, according to the use of ARV
during pre-natal care and education, from 2007 to 2011*
Variable
Use of ARV
Non use of ARV
n
%
n
%
3
75,0
1
25,0
1st trimester
107
37.7
Education
2nd trimester
89
31.3
0
3rd trimester
62
21.8
1 to 4 years
114
83,8
22
16,2
5 to 8 years
69
95,8
03
4,2
Sem informação
26
9.2
Total
284
100.00
Yes
241
84.9
No
14
4.9
No information
29
10.2
Total
284
100.00
Yes
199
82.6
No
30
12.4
No information
12
5.0
Total
241
100.00
Yes
167
77.3
No
41
19.0
No information
8
3.7
216
100.00
Vaginal
86
39.8
Elective c-section
102
47.2
Urgent c-section
17
7.9
No information
11
5.1
216
100.00
Pre-natal care
ARV use during pre-natal care (N = 241)
ARV use during delivery** (N = 216)
Total
Type of delivery (N = 216)
Total
Evolution of the pregnancy (N = 216)
As for the use of ARV during delivery there was a significant
connection between the variables: pre-natal care, type and evolution of the delivery (p < 0.05). The use of ARV during delivery was
higher among women who attended pre-natal care and opted for a
c-section (Table 4).
Table 4 – Number and percentage, according to the use of ARV
during delivery, type and evolution of the delivery with pre-natal
care, form 2007 to 2011*
Variable
Use of ARV
Non use of ARV
n
%
n
%
Yes
162
84.4
30
15.6
No
2
18.2
9
81.8
Vaginal
55
67.1
27
32.9
Elective c-section
96
98.0
2
2.0
Urgent c-section
12
80.0
32
16.4
Live birth
162
84.4
30
15.6
p < 0.0001
Evolution of delivery
Stillborn
1
50.0
1
50.0
Stillborn
4
1.8
Abortion
2
16.7
10
83.3
Abortion
12
5.6
Total
216
100.00
First 24 h of birth
183
91.5
After 24 h of birth
3
1.5
None
10
5.0
No information
4
2.0
200
100.00
DST - J bras Doenças Sex Transm 2013;25(1):26-30
p < 0.0001
Type of delivery
92.6
* Data from March 2011.
** The cases considered were the ones that resulted in delivery.
Source: SINAN.
Valor of p**
Pre-natal care
200
Total
p < 0,05
* Data from March 2011.
**Cases with no information were excluded.
Source: SINAN.
Live birth
Start of prophylaxis in the child (N = 200)
Value of p**
p < 0.0001
* Data from March 2011.
**Cases with no information were excluded.
Source: SINAN.
DEBATE
It is known that pre-natal care during the pregnancy is a crucial
factor for the health of the mother and the child, especially for HIV
positive pregnant women, and that the sooner it begins it increases
the chances of intervening in the transmission of the virus from
mother to child(6).
The women in the study were notified as pregnant and HIV positive for the second and third time and had, therefore, knowledge
about their condition since their first pregnancy.
HIV Pregnant Women with More than One Pregnancy and the Use of Antiretroviral During Pre-natal Care and Childbirth
Although the majority of women in the study had pre-natal care,
we expected a higher percentage of antiretroviral use during pre-natal care and during delivery, given that they knew about their
HIV positive condition. According to reports from HIV positive
women who had seronegative children, we found that they were
encouraged to seek assistance during their pregnancy(11).
The study found a percentage of approximately 85% compliance
with pre-natal care, lower than what is found in Brazil(12,13) and in
the world, with a variation of 90 to 100%(14,15). As for compliance
with pre-natal care and childbirth ARV treatment, 82.6% and 77.3%
pregnant women had prophylaxis treatment, respectively.
In a study conducted in Porto Alegre, without taking into account the number of pregnancies, a higher percentage was found
of women who had pre-natal care (97.7%), with the use of ARV
for 86.6% of them and a 92.8% use of prophylaxis during delivery.
At the same time there were a percentage of women who were
previously diagnosed as HIV positive who didn’t use ARV during
their pregnancy(16).
There are doubts about why women who are seropositive, and
know about their condition and about the risk of vertical transmission, do not have pre-natal care or use ARV during their second and
third pregnancies.
In this instance, the determinant factor to be considered is the
quality of pre-natal care. According to reports from seropositive
women, the challenges they face for this kind of health service are
numerous: too much bureaucracy for pre-natal care, high turnaround of professionals, lack of educational practices and laboratorial resources within the health units, lack of communication and
clarity by the professionals(17,18). Even though Brazil has 97.1%
coverage of pre-natal care for pregnant women in general, only
26.5% of pre-natal care is considered adequate, according to the
PHPN (Programa de Humanização do Pré-natal e Nascimento)
parameters(19).
Being HIV positive makes it even more difficult to access treatment, given the complexity of HAART, side effects, forgetfulness,
and the incompatibility between the treatment and the routines of
life and self-esteem(20).
Prevention during the intra-delivery period is another crucial
factor in reducing vertical transmission of the virus, given the increased risk of transmission during this period. In the study, 19.0%
of women did not have prophylaxis during delivery. National
studies showed variations between 10 and 23%(21,22), and a lower
value when the women knew about their condition during the pregnancy(22,23). Analyzing the quality of pre-natal assistance and the
deliveries in public maternities provided for pregnant women, we
identified a reality that is far from what is recommended by the
Ministry of Health, showing how fragile the Programa Brasileiro
de Redução da TV do HIV (Brazilian Program to Reduce the Transmission of HIV), regarding its organization, management and health service assessment(24).
There were a higher percentage of women who had a normal
delivery (39.80%) than in other studies (20.5% to 27.3%)(15,25). The
definition of normal delivery is based on the results of the maternal viral load (less than 1.000 copies/mL), conducted after the 34th
week of pregnancy, and in association with an obstetric evaluation(6). It is possible that women who had more than one pregnancy
are in this condition, ensuring a safe vaginal delivery. There was
29
a connection between the use of ARV during delivery and pre-natal care and a c-section delivery. We expected that, knowing
about their HIV positive condition, there would be a greater probability that these women would seek pre-natal care, use HAART
prophylaxis and opt for a c-section, in order to prevent the vertical
transmission of HIV.
Of the 200 live born, 5% did not receive prophylaxis during the
first 24 hours after birth. A higher value than what has been found
in some studies (2.1 to 2.2%)(25,26).
In this study, despite the norms and measures to prevent the
vertical transmission of HIV, a part of the country’s health policy,
with a clear definition of the commitment to these actions by health
organizations, the institutionalization process of these recommendations in practice is limited.
Missed opportunities to perform preventive interventions, in
pre-natal care, during delivery or for the newborn, show the vulnerability of women and children in the program to HIV, regarding
the prevention of vertical transmission.
One of the study’s limitations was the incorrect filling of reports, the inconsistence of some data and incomplete information
that were important for the analysis. Our suggestion is that the database can be improved by adding information related to the reasons why women do not attend pre-natal care and do not go through HAART intervention.
CONCLUSION
The study showed that, although they were notified as second or
third pregnancies with a previous HIV+ diagnosis since their first
pregnancy, there weren’t a higher percentage of pregnant women
in the program than what other studies showed. It is necessary to
verify the reasons for the non-adherence to prophylactic treatment
and the type of health care provided to these women, since they
are HIV positive since their first pregnancy, particularly as to the
quality and accountability of these services.
REFERENCES
1.
2.
3.
4.
5.
6.
7.
Brito AM, Castilho EA, Szwarcwald CL. AIDS e infecção pelo HIV
no Brasil: uma epidemia multifacetada. Rev Soc Bras Med Trop.
2001;34(2).
Brito AM, Sousa JL, Luna CF, Dourado I. Tendência da transmissão vertical de AIDS após terapia anti-retroviral no Brasil. Rev Saúde Pública.
2006;40:18-22.
Trindade MP, Schiavo MR. Comportamento sexual das mulheres em relação ao HIV/ AIDS. DST - J bras Doenças Sex Transm. 2001;13(5):17-22.
Souza-Júnior PRB, Szwarcwald CL, Barbosa Júnior A, Carvalho MF,
Castilho EA. Infecção pelo HIV durante a gestação: Estudo-Sentinela
Parturiente, Brasil, 2002. Rev Saúde Pública. 2004;38(6).
Vasconcelos ALR, Hamann EM. Por que o Brasil ainda registra elevados
coeficientes de transmissão vertical do HIV? Uma avaliação da qualidade
da assistência prestada a gestantes/parturientes infectadas pelo HIV e seus
recém-nascidos. Rev Bras Saúde Mater Infant. 2005;5(4).
Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. Programa
Nacional de DST e AIDS. Recomendações para profilaxia da transmissão
vertical do HIV e terapia antirretroviral em gestantes: manual de bolso/
Ministério da Saúde, Secretaria de Vigilância em Saúde, Programa Nacional de DST e Aids. Brasília: Ministry of Health, 2010.
Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. Recomendações para profilaxia da transmissão vertical do HIV e terapia antiDST - J bras Doenças Sex Transm 2013;25(1):26-30
30
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
CHENGYAO & NICHIATA
retroviral em gestantes/ Ministério da Saúde, Secretaria de Vigilância em
Saúde. Brasília: Ministry of Health, 2006.
São Paulo. Secretaria Estadual de Saúde. Centro de Vigilância Epidemiológica. Centro de Referência DST-AIDS. Boletim Epidemiológico DST/
AIDS. 2009.
Nichiata LYI. A epidemia da Aids infantil & os sistemas de informação:
limites e possibilidades da intervenção em saúde coletiva na Cidade de
São Paulo [tese]. São Paulo (SP): Nursing School of the USP; 2001.
Brasília. Ministério do Tralho e Emprego [Internet] Classificação Brasileira de Ocupações. CBO 2002. Available in: http://www.mtecbo.gov.br/
cbosite/pages/pesquisas/BuscaPorTitulo.jsf;jsessionid=967A67FB54482
A258C201B2FB5A9F6E9.lbroute813 Accessed in: Sep 18, 2011.
Moura EL, Praça NS. Transmissão vertical do HIV: expectativas e
ações da gestante soropositiva. Rev Latino-Am Enfermagem [online].
2006;14(3):405-413.
João EC, Cruz ML, Menezes JA, Matos HJ, Calvet GA, d’Ippolito MM
et al. Vertical transmission of HIV in Rio de Janeiro, Brazil. AIDS.
2003;364(9441):1236-43.
Nogueira AS, Abreu T, Oliveira R, Costa R, Andrade M et al. Successful
prevention of HIV transmission from mother to infant in Brazil using a
multidisciplinary team approach. Braz J Infec Dis. 2001;5(2):1853-6.
European Collaborative study. Exposure to antiretroviral therapy in uteri
or early life: the health of uninfected children born to HIV-infected women. J Acquir Immune Devic syndr. 2003;32(4):380-7.
Toumala RE, Shapiro DE, Monfenson LM, Bryson Y, Culnane M, Hughes
MD et al. Antiretroviral therapy during pregnancy and the risk of an adverse outcome. N Engl J Med. 2002;364(24):1863-70.
Torres RS, Luz AMH. Gestante HIV+ e crianças expostas: estudo epidemiológico da notificação compulsória. Rev Gaúcha Enferm.
2007;28(4):505-11.
Darmont MQR, Martins HS, Calvet GA, Deslandes SF, Menezes JA. Adesão ao pré-natal de mulheres HIV+ que não fizeram profilaxia da transmissão vertical: um estudo sócio-comportamental e de acesso ao sistema
de saúde. Cad Saúde Pública [online]. 2010;26(9):1788-1796.
Seild EMF, Melchiades A, Farias V, Brito A. Pessoas vivendo com HIV/
AIDS: variáveis associadas à adesão ao tratamento anti-retroviral. Cad.
Saúde Pública [online]. 2007, 21Torres SR, Luz AMH. Gestante HIV+
e crianças expostas: estudo epidemiológico da notificação compulsória.
Rev Gaúcha Enferm. 2001;28(4):505-11.
Gonçalves CV, Cesar JA, Mendoza-Sassi RA. Qualidade e equidade na
assistência à gestante: um estudo de base populacional no Sul do Brasil.
Cad Saúde Pública. [online]. 2009;25(11):2507-2516.
DST - J bras Doenças Sex Transm 2013;25(1):26-30
20. Nemes MIB, Castanheira ERL, Santa Helena ET, Melchior R, Caraciolo
JM, Basso CR et al. Adesão ao tratamento, acesso e qualidade da assistência em Aids no Brasil. Rev Assoc Med Bras [online]. 2009;55(2):207-212.
21. Cavalcante MS, Ramos Junior NA, Silva TMJ, Pontes LRSK. Transmissão vertical do HIV em Fortaleza: revelando a situação epidemiológica em uma capital do nordeste. Rev Bras Ginecol Obstet [online].
2004;26(2):131-138.
22. Lima CTD, Oliveira DR, Rocha EG, Pereira MLD. Manejo clínico da
gestante com HIV positivo nas maternidades de referência da região do
Cariri. Esc Anna Nery. [online]. 2010;14(3):468-476.
23. Turchi MD, Duarte LS, Martelli CMT. Mother-to-child transmission of
HIV: risk factors and missed opportunities for prevention among pregnant
women attending health services in Goiânia, Goiás State, Brazil. Cad Saúde Pública [online]. 2007;23(suppl.3).
24. Vasconcelos ALR, Hamann EM. Por que o Brasil ainda registra elevados
coeficientes de transmissão vertical do HIV? Uma avaliação da qualidade
da assistência prestada a gestantes / parturientes infectadas pelo HIV e
seus recém-nascidos. Rev Bras Saúde Mater Infant. 2005;5(4).
25. Melo VH, Aguiar RALP, Lobato ACL, Cavallo IKD, Kakehasi FM, Romanelli RMC, et al. Resultados maternos e perinatais de dez anos de assistência obstétrica a portadoras do vírus da imunodeficiência humana.
Rev Bras Ginecol Obstet [online]. 2005;27(11):683-690. ISSN 01007203. (22) 23(10):2305-2316. ISSN 0102-311X.
26. São Paulo. Secretaria Estadual de Saúde. Centro de Vigilância Epidemiológica. Centro de Referência DST-AIDS. Boletim Epidemiológico DST/
AIDS. 2010.
Address to correspondence:
Dai Chengyao
Rua Cardeal Arcoverde, no 230, apt. 11
Pinheiros – São Paulo/SP
ZIP Code: 05408-000
Tel: +55 (11) 98783-7347
E-mail: [email protected]
Received in: 14.03.2013
Approved in: 24.06.2013
ARTICLE
Antimicrobial Resistance in Neisseria gonorrhoeae Isolates
from Ribeirão Preto, São Paulo, Brazil
Marta Inês C Medeiros1*, Jaqueline O Silva1, Ana Maria M Carneiro2, Silvia Helena C Reche3,
Luiz Sérgio D´Oliveira Rocha4, Paulo da Silva5
ABSTRACT
Introduction: gonorrhea is sexually transmitted, with a high incidence worldwide. Occurrence of resistance and difficulties in treatment is often reported.
Penicillin is not used anymore, and quinolones or cephalosporins are the remaining therapeutic options. However, there are resistance reports to these
drugs as well. Objective: to evaluate the occurrence of resistance to penicillin, tetracycline, ofloxacin, ciprofloxacin, azithromycin and ceftriaxone in
Neisseria gonorrhoeae (gonococcus). Methods: ninety-three endocervical and urethral secretion samples, suspected of gonorrhea, were cultured from
September 2008 to May 2012. Samples were collected at the STD/Aids Reference Center and processed at Instituto Adolfo Lutz in Ribeirão Preto, SP,
Brazil. Antimicrobial susceptibility tests were performed by the E-test (Oxoid). Beta-lactamase was determined by the cefinase disk method (BD BBL).
The susceptibility study included a gonococcus isolated from a case of conjunctivitis. Results: gonococcus was isolated in 41.9% (35) of the cases in the
study. Male patients were predominant in 92.3% of samples, with ages ranging from 14 to 62 years, and the conjunctivitis isolate was recuperated from
a 1 month old patient. Isolates were resistant to penicillin (44.4%); tetracycline (55.5%); ofloxacin (36.1%) and ciprofloxacin (36.1%). All isolates were
susceptible to ceftriaxone, and 80.6% were susceptible to azithromycin. The beta-lactamase test was positive for 31.0% of isolates. Conclusion: in vitro
results showed that tetracycline was less effective, and ceftriaxone the most effective antibiotic against gonococcus. The resistance to different drugs limits
the options of gonococcus effective treatment.
Keywords: Neisseria gonorrhoeae, resistance, antimicrobials, gonorrhea, STD
INTRODUCTION
Gonorrhea, which etiologic agent is the bacterium Neisseria gonorrhoeae (gonococcus), is one of the oldest sexually transmitted
diseases (STD), with worldwide high incidence. Transmission occurs by direct contact with secretions of infected mucosal surface,
and the incubation period can range from 1 to 10 days(1). The most
common clinical manifestations of the infection are urethritis and
cervicitis, although it can affect the anal mucosa, oropharynx, conjunctiva, among others(2).
About 30 to 80% women and 5 to 85% men can remain asymptomatic carriers of gonococcus, making it difficult to break the
transmission chain of the disease. Therefore, along with the assessment of sexual partners and health education, the detection of
carriers are among the main control strategies of gonorrhea(3). In
Brazil, the absence of a notification system of STD cases makes
information scarce. In 2003, the Ministry of Health National STD/
Aids Program estimated the occurrence of 1.5 million cases of gonorrheae(4).
The high demand for medical care, the cost of treatment and
the socioeconomic impact of STDs represent an economic loss of
17%, mostly in developing countries(5).
Master’s degree in Microbiology and Scientific researcher of Instituto Adolfo
Lutz de Ribeirão Preto, São Paulo State, Brazil.
2 Support for Scientific and Technological Research Technician of Instituto
Adolfo Lutz de Ribeirão Preto, São Paulo State, Brazil.
3 Scientific and Technological Research Technical Assistant to Instituto Adolfo
Lutz de Ribeirão Preto, São Paulo State, Brazil.
4 Physician in Infection Diseases of the Centro de Referência “Dr. José Roberto
Campi” de Ribeirão Preto, São Paulo State, Brazil.
5 Master’s degree in Microbiology, PhD in Biociences and Biotechnology
applied to Pharmacy Scientific and researcher of Instituto Adolfo Lutz de
Ribeirão Preto, São Paulo State, Brazil.
Institution: Centro de Laboratório Regional - Instituto Adolfo Lutz de Ribeirão
Preto VI, São Paulo State, Brazil.
Financial support: Programa Nacional de DST/AIDS, Ministério da Saúde Brazil.
1
DOI: 10.5533/DST-2177-8264-201325107
Gonorrhea, as well as any other STD, can work as a gateway to
the HIV and other microorganisms. According to Wasserhel(6) and
Cohen(7), STDs increase the risk of acquiring HIV infection from
three to five times.
Direct bacterioscopy of secretions stained by Gram and culture
are the traditional methods used for diagnosis of gonococcal infections(7). Bacterioscopy has 90% sensitivity and 98% specificity
in the detection of purulent gonococcal infections, although this
sensitivity becomes reduced in asymptomatic patients. In this context, culture is an indispensable method for the diagnosis, allowing
the isolation of gonococcus and the subsequent determination of
antimicrobial sensitivity profile(2).
Molecular techniques have been made available through commercial kits for the diagnosis of gonococcus, using nucleic acid
amplification tests, which show high sensitivity and specificity.
Gonococcus intolerance in the transportation of the sample and
the rapidity of the result are advantages of these techniques on the
culture(8).
The gonococcus is a highly fastidious bacterium, which success in isolation and identification depends on the adequate collection and transportation of the sample, in addition to the quality
of inputs used and trained personnel(9). Few laboratories carry out
this methodology routinely due to the specificity concerning the
cultivation of gonococcus. The difficulty in the infection diagnosis, coupled with inadequate use of antimicrobials, promotes the
development of resistance to available drugs, which is the biggest
obstacle to the control of the disease, by limiting the therapeutic
options for effective treatment. When not carried out correctly, especially in women, treatment can cause serious sequelae, such as
infertility, miscarriage and ectopic pregnancy(10).
The production of enzymes, the acquisition of plasmids, and
genetic mutations are among the various resistance mechanisms
of antimicrobial gonococcus(10). The β-lactamase enzyme gives
the gonococcus the ability to inactivate β-lactam antibiotics. The
isolates of gonococcus should be investigated concerning the proDST - J bras Doenças Sex Transm 2013;25(1):31-35 - ISSN: 0103-4065 - ISSN on-line: 2177-826
32
medeiros et al.
duction of this enzyme, which can be detected by iodometric and
acidmetric methods, and also through chromogenic cephalosporin
(nitrocefin)(11).
Due to the acquisition of resistance to antimicrobials, the treatment of gonococcus has evolved through time. The sulfonamide
was the first indication for the treatment of gonorrhea, and subsequently penicillin followed by tetracycline. The fluoroquinolones
(ciprofloxacin, ofloxacin and levofloxacin) were introduced more
recently, but there are already reports of emergence of resistance to
this class of antibiotics in many countries(12).
Because the constant changes of antimicrobial sensitivity profile of the gonococcus, the monitoring of circulating strains is essential to detect the emergence and spread of drug-resistant strains,
helping the institution of effective measures in the control of gonococcal infections(13).
For the treatment of urethritis, specialized clinics in the city of
Ribeirão Preto, use penicillin, azithromycin, ciprofloxacin and ceftriaxone. However, clinicians have noted some cases of treatment
failure with the use of such antibiotics.
sence of Gram-negative intracellular diplococcic characteristic of
gonococcus.
Antimicrobial sensitivity was evaluated by Minimum Inhibitory Concentration (MIC), using the episolometric test or E-test
(Oxoid). The interpretation of results and reference values used
for penicillin, tetracycline, ciprofloxacin, ofloxacin and ceftriaxone was based on the recommendations of the Clinical Laboratory
Standards International (CLSI, 2009)(16). For azithromycine the
values considered were described in literature(17,18). The Neisseria gonorrhoeae ATCC 49226 strain reference was used for the
quality control of culture media and the CIM, as recommended
by CLSI(16).
The research of beta-lactamase enzyme was determined by the
cefinase disk method (Becton Dickinson), described by Swenson
et al.(19). In contact with cefinase disk beta-lactamase enzymes producing strains break the beta-lactam ring and produce a red color
pigment.
The following control strains were used: Staphylococcus aureus
(ATCC 29213): positive, and S. aureus (ATCC 25923): negative.
OBJECTIVE
RESULTS
Evaluate the occurrence of isolates of gonococcus and its in
vitro susceptibility to antibiotics: penicillin, tetracycline, ofloxacin, ciprofloxacin and ceftriaxone, and determine its production of
β-lactamase.
METHODS
This is a retrospective study of 93 patients of both genders,
clinically suspected urethritis and/or gonococcal cervicitis, which
appeared spontaneously in STD/AIDS Reference Center in the city
of Ribeirão Preto, São Paulo State, Brazil, from September 2008 to
May 2012. These patients signed an informed consent, agreeing
to participate in the study, which was reviewed and approved by
the opinion of CONEP number 5.071/2008.
A gonococcus isolate was included in the evaluation of antimicrobial susceptibility, in a culture recovered eye secretion of a
newborn from a hospital in the city of Ribeirão Preto, which was
sent to the Instituto Adolfo Lutz-RP (IAL-RP) for identification.
The culture method for the isolation and identification of Neisseria gonorrhoeae were according to the Brazilian Ministry of
Health Manual recommendations(14). The urethral secretion or
endocervical swabs were collected from the patients and immediately spread in Thayer-Martin (selective) and chocolate agar
(non-selective) culture media, and incubated in 5-10% of CO2
atmosphere. Part of secretion was collected with bacteriological
loop for direct bacterioscopy. Samples were forwarded to the
IAL-RP, where plates were incubated at 35-37oC for at least 48
hours, and then observed the growth of colonies suspected of gonococcus. The phenotypic identification has taken into consideration the colony morphology, the cell morphology (Gram-negative
diplococci), the oxidase proof (positive), and the carbohydrates
utilization in the Cystine Tryptic Agar - CTA medium: dextrose (positive), lactose (negative), sucrose (negative) and maltose
(negative)(15).
Direct bacterioscopy were realized by Gram stain and observed
in immersion (1,000 x), in common optical microscope for the preDST - J bras Doenças Sex Transm 2013;25(1):31-35
Of the 93 suspected cases of gonorrhea, 52 were men and 41
women, ranging from 14 to 62 years of age. Among the suspected
cases 43% (n = 40) were diagnosed as positive for gonorrhea, and
in two of them there was no growth in culture, and the diagnosis
was made only by bacterioscopy. In three cases it was not possible
to carry out the sensitivity test, due to the loss of viability of strains
for the achievement of the MIC.
Among the suspected cases of gonorrhea 90% (n = 31) were
male. The predominant age group (55%) was 21 to 30 years (Figure 1). The gonococcus isolated from conjunctival secretion was of
a 1 month of age child, whose sex was not reported.
MIC was held in 36 samples of gonococcus, being 31 urethral
secretions, four endocervical secretions and one conjunctival secretion (Table 1). Resistance to at least two classes of antimicrobials was observed in 44.4% (n = 16) of these samples, 25% (n =
9) were only sensitive to ceftriaxone. A total of 29 isolates (80.6%)
was sensitive to azithromycin, and seven (19.4%) showed decreased sensitivity to this antibiotic.
The beta-lactamase test was positive for 34.4% of cases.
Among the 40 patients with suspicion of gonorrhea, 15% (n = 6)
were already in use of antibiotics and 17.5% (n = 7) showed some
sort of associated pathology (Table 2).
DISCUSSION
In developing countries, STDs are among the five major diseases for which medical attention is sought(10,20). STDs’ control has
been a concern for health authorities, mainly due to their increase
in the young and adolescents(21,22). In this study, it was observed that
the 14 to 20 years age group was the second most incident among
cases of gonorrhea.
Blocking of the transmission chain is among the main ways
of control and prevention of STDs, as well as the appropriate treatment of infections and the proper management of partners(9).
Gonorrhea’s control is hampered by the large number of asymp-
33
Antimicrobial Resistance in Neisseria gonorrhoeae Isolates from Ribeirão Preto, São Paulo, Brazil
Table 1 – Antimicrobial sensitivity of 36 N. gonorrhoeae isolates from endocervical, urethral and conjunctival secretion
Antimicrobials (breakpoint = µg/L)
Sensible no (%)
Intermediary no (%)
Resistat no (%)
Penicilin
(S ≤ 0.06 I = 0.5-1 R ≥ 2)
7 (19.4)
13 (36.1)
16 (44.4)
Tetracyclin
(S ≤ 0.25 I = 0.5-1 R ≥ 2)
14 (38.9)
2 (5.6)
20 (55.5)
Ofloxacin
(S ≤ 0.25 I = 0.5-1 R ≥ 2)
22 (61.1)
1 (2.8)
13 (36.1)
Ciprofloxacin
(S ≤ 0.06 I = 0.12-0.5 R ≥ 1)
20 (55.5)
3 (8.3)
13 (36.1)
Ceftriaxone
S ≤ 0.25
36 (100)
–
–
tomatic carriers, in addition to the difficulty of laboratory diagnosis(22).
Culture is the main method for the diagnosis of gonorrhea, however it may present limitations, as gonococcus can be fastidious
and easily lose the viability(22), justifying the fact that in two cases
it has only been diagnosed by bacterioscopy, and in three of them it
has not been possible to perform the test sensitivity. In this context,
molecular techniques offer advantages when compared to culture(8).
Another concern that should be considered is the occurrence of
gonococcal conjunctivitis in newborn babies, which together with
the risk of miscarriage and premature birth is one of the consequences of gonorrhea during pregnancy(10). According to Duarte(23), the
inclusion of the partner on prenatal care of pregnant woman is fundamental to the reduction of mother-to-child STDs transmission.
This study demonstrates that gonococcal infectious may be associated with other STDs (Table 2), corroborating with reports that
show that one STD works as a gateway for other STDs, including
AIDS(10).
The positivity of 43% found for gonorrhea in this study is equivalent to the one reported in Venezuela, in 2007 (43.85%), and in
both studies the largest number of cases occurred in males. However, studies differ as to be more sensitivity to ciprofloxacin (92%)(24)
in relation to this study (34.4%).
Similar to what was reported in New Zealand(25), all evaluated
gonococcus isolates were susceptible to ceftriaxone (Table 1), but
the constant monitoring of the sensitivity profile is critical, because the resistance to cephalosporins has already been described
in Japan(26,27), Sweden(28), Australia(29) and Greece(30).
High resistance to tetracycline (55.5%) had already been observed in São Paulo, where researchers have detected a resistance of
40.3%, advising against the use of this antibiotic to treat gonorrhea
since 2005(31). However, tetracycline is still effective in the treatment for other STDs, such as the infections caused by Chlamydia
trachomatis(32).
The knowledge of circulating gonococcal isolates is critical,
because of the rapid change in the profile of their sensitivity to
antibiotics used for the treatment of gonococcal infections(33).
This study showed a profile of 55.5% sensitivity to ciprofloxacin,
while in the city of Manaus 90.3% of gonococcal isolates were
sensitive to this antimicrobial(34).
We can also compare the results of this study with the resistance
profile of isolated gonococcus studied in India(35). The results were
quite similar to the resistance levels found for penicillin (44.4%
and 46.6%) and tetracycline (55.5% and 51%) in Brazil and India,
respectively, considering also that isolated resistant to ceftriaxone
in both studies were not detected. However, the work diverged regarding resistance to ciprofloxacin, which in India reached 77.7%,
while in this study it was equal to 36.1%.
Since 1993, the use of oral fluoroquinolones was recommended
by the Centers for Disease Control and Prevention (CDC) for the
treatment of infections caused by gonococcus(36), but the resistance
to this antimicrobial spread quickly (13.37%). The spread of gonoTable 2 – Associated pathologies and previous use of antibiotics in
40 suspected cases of gonorrhea
Characteristics
Cases %
Associated pathologies
HPV/condyloma
5% (n = 2)
HIV/AIDS
5% (n = 2)
HCV
2.5% (n = 1)
Ulcerated lesion
5% (n = 2)
Previous antibiotic therapy
14-20 years 21-30 years 31-40 years 41-50 years > 50 years
Figure 1 – Distribution of 40 gonorrhea cases by age group.
Benzetacil
5% (n = 2)
Norfloxacin
5% (n = 2)
Azitromycin
2.5% (n = 1)
Ciprofloxacin + benzetacil
2.5% (n = 1)
HPV: human papilomavirus, HCV: hepatitis C virus.
DST - J bras Doenças Sex Transm 2013;25(1):31-35
34
medeiros et al.
coccus resistance to quinolone antibiotics occurs probably due to
the use of inadequate dosage, in addition to the widespread use of
these antibiotics for other infections(38).
The gonococcus isolates of this study were different from
those studied in the city of Manaus. The results found in both
locations were, respectively, related to the production of beta-lactamase enzyme (34.4% and 14.5%), resistance to penicillin
(44.4% and 21.8%) and ciprofloxacin (36.1% and no fully resistant strain)(39).
Barreto et al. (2004), in Rio de Janeiro, alert to the use of
penicillin, tetracycline and azithromycin in the treatment of gonorrhea because found that 8.7% of gonococcal strains were βlactamase producing, to penicillin, 76.5% had intermediary resistance, 20.0% with reduced susceptibility to azithromycin and
only 33.9% were fully sensitive to tetracycline(40).
For azithromycin, appropriate results in vitro have been recommended by Mehaffeey et al.(27), considering the MIC with ≤ 2 μg/
mL breakpoint. In this study it was observed that sensitivity decreased 19.4% to this antibiotic, following the recommendations
of Dillon et al.(18), who have established the MIC with breakpoint
= 0.25 to 1 μg/mL. Studies of Ferreira et al.(34) in 2004, found a
resistance of 21.9%.
Azithromycin has been employed in the treatment of gonorrhea
as well as in the standardized treatment urethritis and cervicitis of
uncertain cause or chlamydial infection. However, for treatment
of chlamydial infection is recommended regimen azithromycin 1 g
orally in a single dose, inadequate in cases of gonococcus infection, which may be favoring the emergence of resistance(34).
Due to the resistance of Neisseria gonorrhoeae to penicillin,
tetracycline and quinolones (ofloxacin and ciprofloxacin) found in
the present study, is not advised the use of these antimicrobials
as first choice drugs for the treatment of gonorrhea. The CDC(13)
and the World Health Organization(22) not recommend use of drugs
whose strains exceed 5% resistance.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
Acknowledgements
This work was supported by Programa Nacional de DST/AIDS,
Ministério da Saúde - Brazil.
Conflict of interest
Authors declared there is no conflict of interest.
References
1.
2.
3.
4.
5.
Sarwal S, Wong T, Sevigny C, Lai-King NG. Increasing incidence of ciprofloxacin-resistant Neisseria gonorrhoeae infection in Canada. Can Med
Assoc. 2003;168(7):872-873.
Hunter H, Sparling F. Neisseria gonorrhoeae. In: Mandell, Douglas and
Bennett’s. Principles and Practice of Infectious Diseases. 6a ed. 2005. p.
2514-2529. Available in: http://www.criasaude.com.br/N5390/doencas/
estatisticas-gonorreia.html. Accessed in: 09 sep 2012.
Brasil. Ministério da Saúde. Secretaria de Vigilância em Saúde. Programa
Nacional de DST e AIDS. Manual de Bolso das Doenças Sexualmente
Transmissíveis/Ministério de Saúde. 4a ed. 2006.
Brasil. Ministério da Saúde. Programa Nacional de DST/Aids. Estatística
Gonorreia. Available in: http://www.criasaude.com.br/N5390/doencas/estatisticas-gonorreia.html. 2003. Accessed in: 25 nov 2012.
Mayaud P, Mabey D. Approaches to the control of sexually transmitted
infections in developing countries: old problems and modem challenges.
Sex Transm Infec. 2004;80(3):174-182.
DST - J bras Doenças Sex Transm 2013;25(1):31-35
19.
20.
21.
22.
23.
24.
25.
Wasserhel TJN. Epidemiological synergy. Interrelationships between human immunodeficiency vírus infection and other sexually transmitted diseases. Sex Transm Dis. 1992;19(2):61-77.
Cohen MS, Hoffman IF, Royce RA, Kazembe P, Dyer JR, Dally CC
et al. Reduction of concentration of HIV-1 in semen after treatment of
urethritis: implications for prevention of transmission of HIV-1. Lancet.
1997;349:1848-1873. Health Protection Agency. Detection of Neisseria gonorrhoae using molecular methods. National Standard methods QSOP 62 Issue 1. 2010
Available in: http://www.hpa-tandardmethods. Org.uk/pdf soaps.asp. Accessed in: 06 ago 2012.
World Health Organization. Global prevalence and incidence of selected
curable sexually transmitted infections: Overviews and estimates. WHO/
HIV_AIDS/2001-02. Geneva: WHO; 2001.
Penna GO, Hajjar LA, Braz TM. Gonorreia. Rev Soc Bras Med Trop.
2000;33(5):451-464.
Lianes R, Gonzalez M, Martinez I, Sosa J, Guzmán D, Gutiérrez O et
al. Evaluation of four methods for detecting the beta-lactamase activity
in Neisseria gonorrhoeae isolated in Cuba. Mem Inst Oswaldo Cruz.
2003;98(8):1089-1091.
World Health Organization. Surveillance of antibiotic resistance in Neisseria gonorrhoeae in the WHO Western Pacific Region, 2004. Commun
Dis Intell. 2006;30(1):29-132.
Centers for Disease Control and Prevention. Increases in fluoroquinolone
resistant Neisseria gonorrhoeae among men who have sex with men –
United States, 2003 and revised recomendations for gonorrhea treatment,
2004. MMWR. 2004;53(16):335-338.
Brasil. Ministério da Saúde. Programa Nacional de DST/Aids. Cultura,
isolamento e identificação de Neisseria gonorrhoeae. Brasília: M.S.,
1997. (Série Telelab) p. 9-44.
Shtibel R, Toma S. Neisseria gonorrhoeae: evaluation of some methods
used for carbohydrate utilization. Can J Microbiol. 1978;24:177-181. Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing. 19th Informational Supplement. M100-S. 19ª ed. 2009.
Mehaffey PC, Putnam SD, Barret MS, Jones RN. Evaluation of in vitro spectra of activity of azithromycin, claritromycin, and erythromycin
tested agains of Neisseria gonorrhoeae by reference agar diluition, disk
diffusion, and E-test methods. J Clin Microbiol. 1996;36(2):479481.
Dillon JR, Rubabaza JP, Benzaken AS, Sardinha JCG, Li H, Bandeira
MGC. Reduced susceptibility to azitromycin and high percentages of
penicillin and tetracycline resistence in Neisseria gonorrhoeae isolates
from Manaus, Brasil, 1998. Sex transm Dis. 2001;28(9):521-525.
Swenson JM, Hindler JA, Peterson LR. Special phenotypic methods for
detecting antibacterial resistance. In: Murray PR, Baron EJ, Pfaller MA,
Tenover FC, Yolken RH, eds. Manual of Clinical Microbiology. 7a ed.
Washington, D.C.: ASM Press; 1999. p. 1563-1577.
World Health Organization. Global Program on AIDS: Global prevalences and incidences of select curable sexually transmitted diseases: overview and estimates: WHO/GPA/STD. 2000. p.1-26.
Bogaski N T, Schirmer J, Barbieri MA. Prevenção das Dst/Aids Entre
Adolescentes. Acta Paul Enfermagem. 2000;13(18-26).
Tapsala J. Antimicrobial resistance in Neisseria gonorrhoeae. Geneva:
World Health Organization 2001. Available in: http://www.who.int/drugresistance/Antimicrobial_resistance_in_Neisseria_gonorrhoeae.pdf. Accessed in: 23 nov 2012.
Duarte G. Extensão da assistência pré-natal ao parceiro como estratégia
de aumento da adesão ao pré-natal e redução da transmissão vertical de
infecções Rev Bras Ginecol Obstet. 2007;29(4):171-174.
Sandoval M, Guevara A, Ward L, Ramos R, Suarez Y, Salomón M. Susceptibilidade de Neisseria gonorrhoeae a los antibioticos β lactamicos,
tetraciclinas y quinolonas. Kasmera. 2007;35(2):118-126.
Hefferman H, Brokenshire M, Woodhouse R, MacCarthy A, Blackmores
T. Antimicrobial susceptibility among Neisseria gonorrhoeae in New
Zealand in 2002. J New Zealand Med Assoc. 2004;117(1191):U817 Available in: http://www.nzma.org.nz/journal/117-1191/817/ 2004. Accessed
in: 16 nov 2012.
35
Antimicrobial Resistance in Neisseria gonorrhoeae Isolates from Ribeirão Preto, São Paulo, Brazil
26. Ito M, Deguchi T, Mizutani KS, Yasuda M, Yokoi S, Ito S. Emergence
and spread of Neisseria gonorrhoeae clinical isolates harboring mosaiclike structure of penicillin-binding protein 2 in Central Japan. Antimicrob
Agents Chemother. 2005;49(1):137-143.
27. Yoko S, Deguchi T, Ozawa T, Yasuda M, Ito S, Kubota Y. Threat to cefixime treatment for gonorrhea. Emerg Infect Dis. 2007;13(8):1275-1277.
28. Lindberg R, Fredlund H, Nicholas R, Unemo M. Neisseria gonorrhoeae
isolates with reduced susceptibility to cefixime and ceftriaxone: association with genetic polymorphisms in penA, mtrR, porB1b, and ponA. Antimicrob Agents Chemother. 2007;51(6):2117-2122.
29. Whiley D M, Limios E A, Ray S, Sloots TP, Tapsall JW. Diversity of pen
A alterations and subtypes in Neisseria gonorrhoeae strains from Sydney,
Australia, that are less susceptible to ceftriaxone. Antimicrob Agents Chemother. 2007;51(9):3111-3116.
30. Tzelepi E, Daniilidou M, Miriagou V, Siatravani E, Pavilidou E, Flemetakis A. Cluster of multidrug-resistant Neisseria gonorrhoeae with reduced
susceptibility to the newer cephalosporins in Northern Greece. J Antimicrob Chemother. 2008;62(3):637-639.
31. Bala M, Sood S. Cephalosporin resistance in Neisseria gonorrhoeae. J.
Global Infect Dis. 2010;2:284-90.
32. Belda Jr W, Fagundes LJ, Siqueira LFG. Neisseria gonorrhoeae: resistência cromossômica à tetraciclina em São Paulo, Brasil. An Bras
Dermatol. 2005;80(1). Available in: http://dx.doi.org/10.1590/S036505962005000100005. 2005. Accessed in: 23 nov 2012.
33. World Health Organization. Surveillance of antibiotic resistance in Neisseria gonorrhoeae in the WHO Western Pacific Region, 2003. Commun
Dis Intell. 2005;29:62-64.
34. Ferreira WA, Ferreira C M, Schettini APM, Sardinha JCG, Benzaken AS,
Garcia MA. Neisseria gonorrhoeae produtoras de betalactamase resistentes a azitromocina em Manaus, Amazonas. DST – J Bras Doenças Sex.
Transm. 2004;16(2):28-32.
35. Sethi S, Sharma D, Mehta SD, Singh B, Smriti M, Kumar B et al. Emergence of ciprofloxacin resistant Neisseria gonorrhoeae in north India. Indian J Med Res. 2006;123:707-710.
36. Centers for Disease Control and Prevention. 1993 sexually transmitted
diseases treatment guidelines. MMWR Recom Rep. 1993;42:1-102.
37. Wang B, Xu JS, Wang CX, Mi ZH, Pu YP, Huin M. Antimicrobial susceptibility of Neisseria gonorrhoeae isolated in Jiangsu Province, China, with
a focus on fluoroquinolone resistance. J Med Microbiol. 2006;55:12511255.
38. Bhalla P, Vidhani S, Reddy BS, Chowdhry S, Mathur MD. Rising quinolone resistance in Neisseria gonorrhoeae isolates from New Delhi. Indian
J Med Res. 2002;115:113-117.
39. Ferreira WA, Vasconcelos WS, Silva MFP, Gomes JS, Ferreira CM,
Benzaken AS. Resistência da Neisseria gonorrhoeae a antimicrobianos
em Manaus: Período 2005-2006. DST – J bras Doenças Sex Transm.
2007;19(2):65-69.
40. Barreto MA, Sant`Anna RRP, Silva LBG, Uehara AA, Guimarães RC,
Duarte IM, Asensi MD. Caracterização fenotípica e molecular de Neisseria gorrhoeae isoladas no Rio de Janeiro, 2002-2003. DST – J Bras Doenças Sex Transm 2004; 16(3): 32-42.
Address to correspondence:
MARTA INÊS CAZENTINI MEDEIROS
Rua Minas, 877 – Campos Elíseos, Ribeirão Preto,
São Paulo, Brasil
CEP: 14085-410
E-mail: [email protected]
Tel: +55 (16) 3625-5046 ramal 205
Received in: 05.04.2013
Approved in: 16.08.2013
DST - J bras Doenças Sex Transm 2013;25(1):31-35
SISTEMATIC REVIEW
Vulvovaginitis and the Treatment of Asymptomatic
Partners: A Systematic Review and Metanalisis
Paulo César Giraldo1, Hugo Marcus Rodrigues2, Amanda G Melo2, Rose Luce do Amaral3,
Mauro Romero L Passos4, José Eleutério Junior5, Ana Katherine Gonçalves6
ABSTRACT
Introduction: treating sexual partners of women with vaginal candidiasis and bacterial vaginosis is an issue in debate. Despite the present recommendations
of the international guidelines to not to treat the asymptomatic sexual partners, this is a frequent practice between gynecologists. Objective: evaluate the
influence of treating asymptomatic sexual partner of women with recurrent vulvovaginitis. Methods: databases searched: PubMed, Embase, Scielo and
CINAHAL. Selection criteria: randomized clinical trials published from 1982 to 2012 were included. Studies involving pregnant women were excluded.
Methodological quality was assessed using the Jadad scale. Data collection and analysis: Review Manager 5.1 was used for statistical analysis. Results:
eight randomized clinical trials were included based on the chosen criteria: 1,088 women were enrolled. For bacterial vaginosis, the RR for cure was 1.00
(95%CI: 0.95–1.05) (p = 0.13), and for recurrence 0.84 (95%CI: 0.62–1.14) (p = 0.34). Vaginal candidiasis had a RR of 1.03 (95%CI: 0.94–1.14) (p = 0.48)
for cure, and 1.02 (95%CI: 0.77–1.33 p = 0.91) for recurrence. Conclusion: treatment of asymptomatic sexual partners of women with vaginal candidiasis
or bacterial vaginosis does not affect the cure or recurrence rates and may increase the risk of side effects and unnecessary financial costs.
Keywords: vulvovaginitis, bacterial vaginosis, candidiasis, partner, treatment
INTRODUCTION
Vulvovaginitis (VV) is a common complaint and one of the
most frequent reasons patients seek gynecologists(1). Annually, approximately 10 million consultations are attributed to symptoms
and signs of vaginal discharge(2).
Despite VV being a very relevant condition to women due to the
high personal and financial costs ensued, it is often minimized by women and the medical community. This repeatedly results in incorrect
diagnosis and treatment by both women and doctors(1), resulting in
exaggerated use of antibiotics and antifungals.
The main causes of VV are well established: bacterial vaginosis
(BV), vaginal candidiasis (VVC) and trichomoniasis (VT). However several questions are debatable, such as best drug to be used,
treatment regiment and most appropriate route of administration.
Since VT has been confirmed as a sexually transmitted disease
(STD), the treatment of an asymptomatic partner is uncontested(3-5).
Some studies suggest that treatment of sexual partners of women
with BV could reduce recurrence rates from 5% to 20%. However,
data evaluating the efficacy of this practice is controversial(6-8). In
a well-designed clinical trial, Mengel et al. (1989) found a reduction in recurrence rates in patients with BV whose partners were
simultaneously treated(9). Nontheless, three other studies found no
relationship between oral therapy of the partner and the recurrence
rates of women(10-12).
VVC cannot be established as a STD since the transmission of
the agent does not necessarily cause VV. It is known that the inci1 Titled
Professor of Gynecology and Obstetrics Department of Campinas
State University (UNICAMP).
2 Graduate Medicine student of Rio Grande do Norte Federal University.
3 Gynecologist doctor, Gynecology and Obstetrics Department, Campinas
State University (UNICAMP).
4 associate Professor and Chief of the Division of Sexually Transmitted
Diseases of Fluminense Federal University.
5 Assistant Professor, Maternal and Child Health Department of Ceará
Federal University (UFC).
6 Associate Professor, Gynecology and Obstetrics Department of Rio
Grande do Norte Federal University (UFRN).
dence of VVC increases dramatically in the second decade of life,
corresponding to the onset of sexual activity, when several factors
(tissue trauma, deposition of semen in the vaginal cavity, exaggerated use of soaps and chemicals, hormonal changes) influence the
vulvovaginal ecosystem(13). The sexual transmission of Candida
can occur during intercourse, but the frequency and timing of intercourse could influence the development of an acute crisis(14). The
practice of oral sex has also emerged as one of the risk factors(15).
Current studies have associated homosexual practices with an increase in the prevalence of Candida in the female genitals(16). On
the other hand, some studies suggest that the role of sexual practice
in the establishment of VVC has been amplified(17,18).
A recent study which proposed to evaluate the transmission of
genital candidiasis among heterosexual couples could not prove sexual acquisition(19). This study evaluated the Candida species found
in couples and found that only 25% of men and women had the
same species of Candida, contradicting previous studies(15). In other
studies which have treated sexual partners of women with VVC, no
increase in cure rates, decline or recurrence was observed(17).
Currently, despite the existing technology for diagnosis and treatment of VV, the role of sexual transmission has yet to be defined. The clarification of this controversy could avoid unnecessary
treatment of sexual partners, thus reducing costs, side effects and
conflict within the couple.
OBJECTIVE
This study proposes to systematically evaluate the influence of
asymptomatic partner treatment in the cure and recurrence of VV.
METHODS
This study adhered to PRISMA guidelines(20).
Inclusion criteria
Randomized controlled trials published in the last 30 years to
assess the effectiveness of partner treatment in the cure and recurrence of VV.
DST - J bras Doenças Sex Transm 2013;25(1):36-40 - ISSN: 0103-4065 - ISSN on-line: 2177-8264
DOI: 10.5533/DST-2177-8264-201325108
Vulvovaginitis and the Treatment of Asymptomatic Partners: A Systematic Review and Metanalisis
Exclusion criteria
Women under 16 years of age, HIV+, pregnant, asymptomatic,
and sex workers were excluded. These groups represent populations
at increased or decreased risk for STDs, wherein the prevalence of
disease differs from the general population. This could interfere with
the sensitivity and/or specificity of the analysis in this review.
Search and selection of literature
Eligible studies were identified by searching the following databases: PubMed, Embase, Scielo, CINAHAL, and Google scholar. The
studies were identified by a literature search of databases following
medical subject heading terms and/or text words (Mesh Terms): (Treatment) AND (Vulvovaginitis) OR (Candidiasis) OR (Moniliasis) OR
(Vaginitis, Monilia) OR (Vaginosis) OR (Vaginitis) OR (Trichomonas) AND (Partners) AND (randomized controlled trial) OR (clinical
trial) OR (follow-up) OR (prospective) NOT (Pregnant Woman).
The bibliographies of the identified publications were reviewed for
additional pertinent studies. No language restrictions were applied.
Two researchers (AKG and HMR) searched for articles published up to May 2012. After searching the databases, 513
potentially relevant papers were identified, 102 of which were
excluded after review of titles. Next the abstracts of the 411 remaining titles were read, removing a further 313 titles. Of the
98 remaining articles, 8 were duplicated among the databases,
which left 90 articles for final reading and qualitative assessment
by the Jadad scale(21). The Jadad scale considered studies to be
methodologically adequate when they obtained a score of 3 or
more(21). Thus, studies obtaining 3 or more points (8 studies) were
classified as high methodological quality and remained in the systematic review (Figure 1).
Data extraction
Several characteristics of the original articles were extracted and
included in the systematic review. The data included the last name of
the first author, the year of publication, country, number of subjects,
type of VV studied as well as type of intervention and results.
Analysis
Statistical analysis was done using Review Manager (RevMan)
5.1 to provide a group analysis of the results of the selected clinical
trials. The pooled analysis was obtained by analyzing the combined results of the chosen studies using the random effect model,
and then testing for heterogeneity using the Chi-square test. The
homogeneity of the selected studies was realized.
37
RESULTS
Bacterial vaginosis
Four randomized controlled trials were selected:
Verjtorp et al. (1988)(10) conducted a major randomized double
blind clinical trial with 117 women using 500 mg of metronidazole
2 x day for 7 days. Half of the partners were randomly treated with
the same treatment regimen or a placebo. Cure and recurrence rates
were similar among women with treated partners (cure: 51/54 and
recurrence: 13/54) or placebo partners (cure: 44/53 and recurrence:
14/53) (Table 1).
Moi et al. (1989)(4) in another double-blind randomized controlled trial with 241 women who were treated with 2 g of metronidazole, and repeated 2 days later. The partners were randomly treated
with the same dose of metronidazole. Cure and recurrence rates
were similar among women with treated partners (cure: 115/119
and recurrence: 19/112) or placebo partners (cure: 111/113 and recurrence: 14/106) (Table 1).
Vutyavanich et al. (1993)(11) conducted a randomized clinical
trial of 250 Thai women treated with 2 g of tinidazole and a partner
randomly treated to placebo or tinidazole. Cure and recurrence rates were similar among women with treated partners (cure: 111/122
and recurrence: 43/117) or placebo partners (cure: 113/119 and recurrence: 33/126) (Table 1).
Colli et al. (1997)(5) carried out a randomized double-blind study with 131 Italian women who were treated with 2% clindamycin
in the form of vaginal cream for 7 days. The partners were randomly treated with oral clindamycin or a placebo. Cure and recurrence rates were similar among women with treated partners (cure:
66/69 and recurrence: 5/38) or placebo partners (cure: 65/69 and
recurrence: 9/32) (Table 1).
The total RR for cure and recurrence were similar among women
whose partners were treated or not for BV: cure RR 1.00 (95% CI:
0.95-1.05) (p = 0.13) Recurrence RR 0.84 (95% CI: 0.62-1.14) (p
= 0.34) (Figure 2).
Vaginal candidiasis
Bishop et al. (1986)(22) conducted a double blind randomized
clinical trial in Belgium with 117 women treated with 200 mg of
ketoconazole 2 x daily for 3 days whose partners were randomly
treated with ketoconazole or placebo. Cure and recurrence rates
were similar among women with treated partners (cure: 48/57 and
recurrence: 13/48) or placebo partners (cure: 53/60 and recurrence:
19/53) (Table 1).
Cure
Figure 1 – Study selection cure.
DST - J bras Doenças Sex Transm 2013;25(1):36-40
38
giraldo et al.
Table 1 – Characteristics of selected randomized clinical trials for BV and VVC
Study
Country
Subjects
Randomized Intervention
Results
Denmark
107 non-pregnant
women with BV
Women: 500 mg of metronidazol 2 x day/7days
Partners: 50% = same treatment, 50% = placebo
Treated cure: 51/54
Recurrence: 13/54Placebo cure: 44/53
Recurrence: 14/53
Moi
(1989)
Denmark
241 non-pregnant
women with BV
Vutyavanich
(1993)
Thailand
250 non-pregnant
women with BV
Verjtorp (1988)
Colli
(1997)
Bishop (1986)
Calderon-Marquez
(1987)
Fong
(1992)
Shihadeh
(2000)
Women: 2 g of metronidazol 2 x day
Partners: same treatment randomized
Women: 2 g of tinidazol
Partners: randomized tinidazol or placebo
Treated cure: 115/119
Recurrence: 19/112
Placebo cure: 111/113
Recurrence: 14/106
Treated cure: 111/122
Recurrence: 43/117
Placebo cure: 113/119
Recurrence: 33/126
131 non-pregnant
women with BV
Women: clindamycin 2% vaginal cream/ 7 days
Partners: randomized oral clindamycin or placebo
Treated cure: 66/69
Recurrence: 5/38
Placebo: cure: 65/69
Recurrence: 9/32
Belgium
117 non-pregnant
women with VVC
Women: 200 mg 2 x day ketoconazole for 3 days
Partners: randomized ketoconazole or placebo
Treated cure: 48/57
Recurrence: 13/48
Placebo cure: 53/60
Recurrence: 19/53
Mexico
44 non-pregnant
women with VVC
Women: 200 mg 2 x day ketoconazole for 3 days
Partners: randomized ketoconazole or placebo
Treated cure: 17/20
Recurrence: 0/16
Placebo cure: 15/19:
Recurrence: 2/15
Canada
54 non-pregnant
women with VVC
Women: 400 mg 2 x day ketoconazole for 7 days
Partners: randomized 200 mg ketoconazole for 5 days
Treated cure: 26/28
Recurrence: 8/26
Placebo cure: 15/19
Recurrence: 9/28
Women: 400 mg 2 x day ketoconazole for 7 days
Partners: half received randomized ketoconazole
Treated cure: 26/28
Recurrence: 8/26
Placebo cure: 15/19
Recurrence: 9/28
Italy
Jordan
144 non-pregnant
women with VVC
Calderon-Marquez (1987)(23) carried out a randomized double-blind study which included 44 women who used 50 mg itraconazole 2 x day for 5 days and their randomly treated partners. Cure
and recurrence rates were similar among women with treated partners (cure: 17/20 and recurrence: 0/16) or placebo partners (cure:
15/19 and recurrence: 2/15) (Table 1).
Fong et al. (1992)(24) conducted a randomized clinical trial with
54 Canadian women who received 400 mg of ketoconazole for 7
days. The partner received 200 mg of ketoconazole for 5 days, or
a placebo. Cure rates and recurrence were similar among women
with treated partners (cure: 26/28 and recurrence: 8/26) or placebo
partners (cure: 15/19 and recurrence: 9/28) (Table 1).
Shihadeh et al. (2000)(25) carried on a randomized clinical trial
in Jordan with 144 women who received 400 mg of ketoconazole
for 7 days. Half the partners received 400 mg ketoconazole for 7
days. Cure and recurrence rates were similar among women with
treated partners (cure: 57/72 and recurrence: 35/57) or placebo partners (cure: 53/72 and recurrence: 28/53) (Table 1).
The total RR for cure and recurrence was similar among women
whose partners were treated or not for VVC: cure RR 1.03 (95%
DST - J bras Doenças Sex Transm 2013;25(1):36-40
CI: 0.94-1.14) (p = 0.48), recurrence RR 1.02 (95% CI: 0.77-1.33)
(Figure 3).
Vaginal trichomoniasis
Interestingly, in the last 30 years no trials have been performed
evaluating the indication of treatment of partners of women with
VT. The only randomized clinical trial was conducted over 30
years ago; it was not possible to include it in this study. In 1981
Lyng & Christensen(26) conducted a randomized clinical trial with
118 women, which found that the persistence of the infection was
significantly higher in the group which had no partner treatment
(14/59) compared to the group which did (3/59) (RR: 0.21, 95%
CI: 0.06-0.71). This difference persisted in the subgroup who
resumed sex with untreated partners. More recently, in a study
testing the efficacy of intravaginal nonoxynol 9 for VT, Antonelli
et al. (2000)(27). observed that women whose partners were treated with metronidazole showed better cure rates compared those
whose partners went untreated. This study cannot be considered
for this meta-analysis since the randomization, tracking was not
described.
Vulvovaginitis and the Treatment of Asymptomatic Partners: A Systematic Review and Metanalisis
39
Recurrence
Figure 2 – Pooled analysis of selected BV studies.
Cure
Recurrence
Figure 3 – Pooled analysis of selected VVC studies.
DISCUSSION
The medical literature and most researchers suggest that sexual partners of women with VV should not be treated(27). However,
some national health programs, including Brazilian health services, treat VV erroneously as a STD and leave treatment to the discretion of gynecologists. Unfortunately this results in over treatment which increases costs and causes unnecessary physical side
effects. There are also serious social and emotional implications
which cause conflict within the couple due to having transmitted a
STD. Very few studies consider the latter or more importantly, the
microbial resistance resulting from this practice.
Proponents of partner treatment argue that this practice could
reduce recurrences in women as well as new transmissions. However our findings do not confirm these VT assertions. VT seems
to be the only infectious VV wherein treating the partner increases
the chances of cure and reduces recurrence. This being said, the
only study that confirms this hypothesis, by Lyng & Christensen(26),
was conducted in 1981. Besides this, it is accepted that VT is a
protozoan and cannot be found in the vaginal cavity under normal
conditions and is not part of the vaginal flora. It follows that VT
must be treated in both parties.
We believe that the ban on placebo use in clinical trials in recent
years has impeded randomized trials(28). Since VT is considered a
STD the consequence of prescribing a placebo instead of the treatment is not ethically accepted. In vivo studies in animal models
are a solution, even though they are difficult to perform. Even so,
it is fundamental to encourage both studies in vitro and in animal
models, which are already well known for VVC, but not yet established for BV.
Contrary to VT, BV and VVC are caused by microorganisms
part of the normal microflora composition which sometimes assume the role of pathogens.
The pooled analysis suggested a slightly lowered risk of recurrence was from the group of women with partners treated for BV-RR 0.84 (95% CI: 0.62-1.14), however no statistically significant
values were found for cure rates. There was no difference between the group of men who received a placebo and those who were
treated-RR: 1.00 (95% CI: 0.95–1.05).
The pooled analysis of studies on VVC suggests that the evidence pointing to asymptomatic partner treatment is much weaker than
for VB. The total RR for cure was 1.03 (95% CI: 0.94-1.14), and for
recurrence 1.02 (95% CI: 0.77-1.33).
DST - J bras Doenças Sex Transm 2013;25(1):36-40
40
giraldo et al.
Therefore, it is evident from these results that partner treatment
does not significantly influence the outcome of cure and/or recurrence rates of BV and VVC.
This evidence can help the General Practitioner to treat patients
and their partners more adequately, thus avoiding the side effects
of overtreatment.
Conflict of interest
No conflict of interest to declare.
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Lipsky MS, Waters T, Sharp LK. Impact of vaginal antifungal products
on utilization ofhealth care services: evidence from physician visits. J Am
Board Fam Pract. 2000;13(3):178-82.
Wilson C. Recurrent vulvovaginitis candidiasis: an overview of traditional and alternative therapies. Adv Nurse Pract. 2005;13(5):24-9.
Mashburn J. Etiology, Diagnosis, and Management of Vaginitis. J Midwifery Womens Health. 2006;51(6):423-30.
Moi H, Erkkola R, Jerve F, Nelleman G, Bymose B, Alaksen K et al.
Should male consorts of women with bacterial vaginosis be treated? Genitourin Med. 1989;65(4):263-8.
Colli E, Landoni M, Parazzini F. Treatment of male partners and recurrence of bacterial vaginosis: a randomised trial. Genitourin Med.
1997;73(4):267-70.
Lugo-Miro VI, Green M, Mazur L. Comparison of different metronidazole therapeutic regimens for bacterial vaginosis: a meta-analysis. JAMA.
1992;268(1):92-5.
Hillier S, Krohn MA, Watts H, Wolner-Hanssen P, Eschenbach D. Microbiologic efficacy of intravaginal clindamycin cream for the treatment of
bacterial vaginosis. Obstet Gynecol. 1990;76(3 Pt 1):407-13.
Thomason JL, Gelbart SM, Scaglione NJ. Bacterial vaginosis: current review with indications for asymptomatic therapy. Am J Obstet Gynecol.
1991;165(4 Pt 2):1210-7.
Mengel MB, Berg AO, Weaver CH, Herman DJ, Herman SJ, Hughes VL
et al. The effectiveness of single dose metronidazole therapy for patients
and their partners with bacterial vaginosis. J Fam Pract. 1989;28(2):163-71.
Vejtorp M, Bollerup AC, Vejtorp L, Favoe E, Nathan E, Reite A et al. Bacterial vaginosis: a double-blind randomized trial of the effect of treatment
of the sexual partner. Br J Obstet Gynaecol. 1988;95(9):920-6.
Vutyavanich T, Pongsuthirak P, Vannareumol P, Ruangsri R-A, Luangsook P. A randomized double-blind trial of tinidazole treatment of the
sexual partners of females with bacterial vaginosis. Obstet Gynecol.
1993;82(4 Pt 1):550-4.
Swedberg L, Steiner JF, Deiss F, Steiner S, Driggers DA. Comparison of
single dose versus one-week course of metronidazole for symptomatic
bacterial vaginosis. JAMA. 1985;254(8):1046-9.
Foxman B, Marsh JV, Gillespie B, Sobel JD. Frequency and response to vaginal symptoms among white and African American women: results of a random
digit dialing survey. J Womens Health. 1998;7(9):1167-74.
Reed BD, Zazove P, Pierson CL, Gorenflo DW, Horrocks J. Candida transmission and sexual behaviors as risks for a repeat episode of Candida vulvovaginitis. J Womens Health (Larchmt). 2003;12(10):979-89.
DST - J bras Doenças Sex Transm 2013;25(1):36-40
15. Bradshaw CS, Morton AN, Garland SM, Morris MB, Moss LM, Fairley CK.
Higher-risk behavioral practices associated with bacterial vaginosis compared
with vaginal candidiasis. Obstet Gynecol. 2005;106(1):105-14.
16. Bailey JV, Benato R, Owen C, Kavanagh J. Vulvovaginal Candidiasis in
Vulvovaginal candidiasis in women who have sex with women. Sex Transm
Dis. 2008;35(6):533-6.
17. Sobel JD. Vulvovaginal candidosis. Lancet. 2007;369(9577):1961-71.
18. Sobel JD. Genital candidiasis. Medicine 2010;38:386-90.
19. Lisboa C, Costa AR, Ricardo E, Santos A, Azevedo F, Pina-Vaz C et al.
Genital candidosis in heterosexual couples. J Eur Acad Dermatol Venereol. 2011;25(2):145-51.
20. Moher D, Liberati A, Tetzlaff J, Altman DG, The PRISMA Group (2009).
Preferred Reporting Items for Systematic Reviews and Meta-Analyses:
The PRISMA Statement. PLoS Med 6(7):e1000097.
21. Jadad AR, Moore RA, Carroll D, Jenkinson C, Reynolds DJ, Gavaghan
DJ et al. Assessing the quality of reports of randomized clinical trials: is
blinding necessary? Control Clin Trials. 1996;17(1):1-12.
22. Bishop MPJM, Merkus MWM. Co-treatment of the male partner in vaginal candidosis: a double-blind randomized control study. Br J Obstet
Gynaecol. 1986;93(1):79-81.
23. Calderon-Marquez JJ. Itraconazole in the Treatment of Vaginal Candidosis and the Effect of Treatment of the Sexual Partner. Rev Infect Dis.
1987;9(Suppl 1):S143-5.
24. Fong IW. The value of treating the sexual partners of women with recurrent vaginal candidiasis with ketoconazole. Genitourin Med.
1992;68(3):174-6.
25. Shihadeh AS. The value of treating the male partner in vaginal candidiasis. Saudi Medical Journal. 2000;21(11):1065-1067.
26. Lyng J, Christensen J. A double-blind study of the value of treatment with
a single dose tinidazole of partners to females with trichomoniasis. Acta
Obstet Gynecol Scand. 1981;60(2):199-201.
27. Antonelli ND,. Diehl SJ, Wright, JW. A randomized trial of intravaginal
nonoxynol 9 versus oral metronidazole in the treatment of vaginal trichomoniasis. Am J Obstet Gynecol. 200;182(5):1008-10.
28. Watson C, Calabretto H. Comprehensive review of conventional and non-conventional methods of management of recurrent vulvovaginal candidiasis. Aust N Z J Obstet Gynaecol. 2007;47(4):262-72.
Address to correspondence:
PAULO CÉSAR GIRALDO
Department of Gynecology and Obstetrics, University of
Campinas, São Paulo, Brazil. Cidade Universitária “Zeferino Vaz”
Rua Alexander Fleming, 101, Campinas, São Paulo
CEP: 13083-881
Telephone/Fax: +55 (19) 3521-9306
E-mail: [email protected]
Received in: 10.05.2013
Approved in: 24.07.2013
REVIEW
Virological and Epidemiological Aspects of Anal
Carcinoma: Current and Future Challenges
Elisabete Dobao1 & Silvia Maria B Cavalcanti2
ABSTRACT
Human papillomavirus infection, a sexually transmitted disease studied mainly in women due to its link to uterine cervical carcinoma, has become a health
problem in men also, mainly by the significant increase of the prevalence and incidence of anal intraepithelial neoplasia and anal carcinoma in specific
groups, such as men who have sex with men, HIV- seropositive and immunocompromised. The anal carcinoma, as cervical cancer, is associated with highrisk oncogenic HPV in 90% of cases, with HPV 16 as the predominant, followed by HPV 18. This fact occurs in a moment when there are no management
protocols for HPV infection in the anal area, either preventive, diagnostic or therapeutic, and without an unique specialty that embraces the problem of HPV
anogenital infection in men as does the gynecology for women, causing a dispersion of expertise. Added to this, there are still many doubts in the medical
and general population about prophylactic vaccination for HPV in boys, and the absence of its distribution in a public health scale in most countries that
still wait for statistical calculations to justify its use.
Keywords: HPV, anal carcinoma, HIV, STD, intraepithelial neoplasia
INTRODUCTION
The infection by the human papillomavirus (HPV) results of
one of the main sexually transmitted diseases (STDs) at present
time. In recent years, the male infection has increasingly become
a research object(1) after the awareness that sexual transmission is
the main way of dissemination to women and that men also take the
consequences of anogenital HPV infection in the form of anogenital warts (AGW), penile intraepithelial neoplasia (PIN) and anal intraepithelial neoplasia (AIN) and carcinoma invader, added to the
development of prophylactic vaccination for both genders.
Although benign, AGWs take on the psycho-social stigma character, often leading to depression and loss of quality of life, with
a high social cost(2).
Penile carcinoma often occurs in men in their 60’s, with incidence ranging from 0.3 to 4.2/100,000, depending upon socioeconomic differences and religious conditions, reason why this
pathology studies have low priority(3). However, anal carcinoma,
which until recently were thought to arise as a result of chronic
inflammatory intestine disease, has today on HPV infection its
primary etiologic agent, being the high-risk types associated with
approximately 90 cases of anal squamous cell carcinoma, and most
of these associated with HPV 16, followed by HPV 18(4,5). Its incidence has been increasing in the general population around 2% per
year(2), however, in some specific groups, such as men who have
sex with men (MSM), HIV-seropositive men for the human immunodeficiency virus (HIV) and immunosuppressed, rates are more
alarming – a recent study in San Diego shows the incidence of 224
per 100,000 individuals/year(6). To better understand this figure, we
should mention that the incidence of UCC before the introduction
of routine Pap smear examination was around 37/100.000 individuals/year(7).
Sorting through cytology, similar to Pap smear, has been proposed for anal carcinoma, however there is still no consensus on the
1
Medical Doctor (MD) at the Hansen’s Disease Department of the Professor
Rubem David Azulay Dermatology Institute, Santa Casa de Misericórdia
do Rio de Janeiro, Rio de Janeiro State.
2
Associate Professor Head of the Virological Diagnostic Laboratory, UFF
(Fluminense Federal University) Biomedical Institute, Niterói, Rio de
Janeiro State.
reliability of the method(6). Physical examination with biopsy and
histopathologic study is still considered a good option, although
the visualization of sub-clinical lesions (annal intraepithelial neoplasias) most time is only possible with a set up view by a high
resolution videocolposcope(8), a kind of examination not yet well
known by other experts than Gynecologists(2).
The tests for the detection of viral nucleic acid have high sensitivity and specificity − like the polymerase chain reaction (PCR)
and the capture of the hybrid (not available in all health services,
mainly in public health) − and require knowledge about the viral
behavior and the pathology in question, so that the interpretation
of the results have a practical significance and not be just another
inconvenience, with a waste of time and money.
ANAL INFECTION BY HPV
Transmission and epidemiology
HPV transmission occurs by direct contact of two surfaces, i.e.,
through the skin or mucous membrane microtrauma, exposing the
epithelial basal layer. The main route of transmission is the sexual
contact without the exclusive need for penetration, followed by episodes in which microtraumas may also occur. As the HPV are quite
resistant to heat and drying, it is still possible a reduced transmission via contaminated fomite(9). HPV transmission does not occur
through blood, since it doesn’t make viremia, or through ejaculate,
except in the presence of urethral injury by HPV. Although it has
already been detected in sperm, it has not been possible to prove its
infectious potential in this circumstance(10). The potential transmission of HPV through seminal fluid raises the question of what might
be possible for the transmission of HPV via sperm donation(11).
There is still no accurate HPV acquisition and elimination rates
data, nor the incidence and duration of infection nor the production
of antibodies in response to HPV infection in man. In Giuliano et
al. study(12), the prevalence among men and women in the same age
group would be between 52.8% and 53.8%, respectively. Also Giuliano et al.(13) in a recent prospective study, with heterosexual men
aged between 18 and 44 years, points to the probability of 0.29%
HPV infection per year.
According to Burd(9) and Frisch et al.(13), following are the main
factors predispoing individuals to a greater risk of infection: pri-
DST - J bras Doenças Sex Transm 2013;25(1):41-45 - ISSN: 0103-4065 - ISSN on-line: 2177-8264
DOI: 10.5533/DST-2177-8264-201325109
42
marily sexual activity at an early age, poor hygienic conditions,
history of other STDs and multiple partners. It is estimated that
the use of condom can prevent from 70% to 80% of transmissions
and its effectiveness is not greater because condom does not cover
all the anogenital area and it is very rarely used throughout time(9).
Male circumcision is associated with a reduced risk of penile HPV
infection, and a reduced risk of UCC on latest partners is observed
on men with a history of multiple sexual partners(14).
According to Joseph et al.(15), the incidence of anal carcinoma has been growing in the United States population, contrasting
with the incidence of UCC, which has declined over the past 40
years. Among the risk factors for anal carcinoma are the history
of AGW and the large number of partners, reflecting exposure
to HPV and its various types, respectively(8). It is not surprising,
therefore, that men who have history of receptive anal sex with
men have a major risk for anal carcinoma. Before the epidemic of
the Acquired Immunodeficiency Syndrome (Aids), in 1982, the
incidence of anal carcinoma among MSM was estimated between
12.5 and 36.9/100.000 individuals/year, values almost as high as
the incidence of UCC in the female general population before the
introduction of citology screening. But in a database study related
to anal carcinoma and Aids, the relative risk of developing anal
carcinoma among HIV-seropositive MSM was 37 times greater
than in the general population(16). Comparing with the prevalence of uterine cervical infection by HPV, which decreases after
the age of 30 years(17), the rate of anal HPV infection in MSM
HIV-seronegative remains high (50% to 60%) and it is constant
throughout life(18). This fact may be a reflection of the differences between the biology of the anal canal and uterine cervix, and
probably the acquisition of new types of HPV may occur from a
greater number of new sexual partners over time among MSM
compared with women.
Prevalence studies have been made by some groups. After
anal swabs analysis, more than 96% of MSM HIV-seropositives
showed HPV DNA and this index drops to 60% in MSM HIV-seronegatives. Of HIV-seropositives patients, 81% had anal intraepithelial lesion, 52% of which of high-grade(18). In Bochum’s
cross-sectional study, in Germany, 59.3% of the MSM HIV-seropositives presented intraepithelial lesions, 31.2% of which of
high-grade(8, 20).
Although anti-retroviral therapy (HAART) has decreased the
mortality and the incidence of opportunistic infections in patients,
studies show none or only a modest effect on the anal carcinoma,
and point out that men and women with Aids have an increased risk
of developing invasive anal carcinoma(21,22).
The site of infection
There is a similarity between the uterine cervical and the anal
epithelium: the epithelial transformation area. In the cervix, this is
the HPV’s target, where occurs the transition between two types
of epithelium, the ectocervix squamous and the endocervical columnar. In the anus, this transition occurs when the anal squamous
epithelium meets the rectum glandular epithelium. In these regions
of active metaplasia there is a replacement of the glandular epithelium by the squamous. The metaplastic immature squamous epithelium is at greater danger of high-risk HPV infection, probably
by the easiness of the virus to reach the basal cell bed(23).
DST - J bras Doenças Sex Transm 2013;25(1):41-45
dobao & CAVALCANTI
The high-risk HPVs, particularly HPV 16, are etiologically associated with virtually all cervical carcinomas, and types 16 and
18, alone or in association, are present in 78% of all anal carcinomas(24,25). HPV 16 is present in 65% to 75% of anal carcinoma samples analyzed, followed by HPV 18(26). The populations considered
high-risk for anal carcinoma are HIV-serpositive women and men,
MSM, women with uterine cervical or vulvar carcinoma history
and immunosuppressed. Anal cytology, like the annual or biannual
Pap smear, is being studied as an alternative for the prevention of
anal carcinoma in high-risk groups(27).
Chin-Hong et al.(28) demonstrated that anal HPV infection in
MSM may probably be associated with HIV acquisition. The mechanisms are not yet clear, however an important factor would be
that the HPV-induced lesions are often brittle and susceptible to
breakage of mucosal integrity during intercourse, with blood loss.
Anal carcinoma screening aims to identify and treat high-grade AIN and invasive squamous carcinoma. Following the cervical model, anal cytology can be used to detect precursor lesions,
and in case of detection of atypical cells, be followed by a high-resolution videoanuscopy with directed biopsy. However, most
clinicians and cytopathologists still have little experience of collecting and reading anal specimens respectively. Anal cytology
should cover the entire anal canal, including mainly the transformation zone. The cells sample should be collected through a long
swab of synthetic fiber, in circular motion, inserted into the anal
canal and taken up after the dentate line and the distal rectal wall,
always with firm pressure to touch all the anal wall. Conventional
smears may be used, but the liquid-based preparation increases
the efficiency of the sample, reducing fecal contamination and
desiccation by air, which cause common artifacts in this type of
examination.
Data published by the College of American Pathologists (CAP),
in its annual disclosure of 2009, indicate that the categorization
of anal HSIL cytology specimens is still problematic. In a recent
study, only 61% of the blades showing anal HSIL were recognized
by the specialists and compared with cervical cytology more than
85% of HSIL blades were correctly classified. It is worth mentioning that for the anal cytology reading, cytomorphology of gynecological lesions associated with HPV is used, and the employed
terminology is that of Bethesda’s(27).
A retrospective Australian study examined the presence of AIN
in all excised condylomatous lesions of most of HIV-seronegatives
male patients during a period of 9 years in a clinic. HSIL lesions
were present in the anal canal in 44% of 27 HIV-seropositive men
(of these, 26 MSM), and 18% of 88 HIV-seronegative men (half
supposedly heterosexual). The authors concluded that most HIV-seropositive men with untreated anal warts can develop anal carcinoma, a view that seems alarmist, but completely supported by
epidemiological data available. This study clearly underlines the
importance of anal warts treatment(29,6).
Anal carcinoma screening routine is still a quite controversial
topic. There is no randomized clinical trials to validate the effectiveness of any kind of selection, the target groups are limited, the
effectiveness and the methodology have yet to be clearly determined and the long-term effects are not yet possible to be perceived.
However, without any doubt, it is possible to observe that sorting is
important and should be established in higher-risk groups.
43
Virological and Epidemiological Aspects of Anal Carcinoma: Current and Future Challenges
HIV infection in HIV-seropositive men
The prevalence of HPV infection with higher viral load and the
presence of multiple types are greater in HIV-seropositive patiens,
resulting in a higher incidence of pathological conditions of worse
prognosis. These patients also have lower resolution rate of latent
infections by HPV or increased reactivation, with higher risk for
all kinds of low and high intraepithelial neoplasia grades and carcinomas(30).
HIV-associated immunosuppression seems to play an important
role in the pathogenesis of HPV in HIV-seropositive men, as the organic defense against HPV infection requires a competent cellular
immunity, which is reduced during HIV infection(31). Other interaction mechanisms between HIV and HPV have been postulated,
such as: the increased expression of cytokines (e.g., interleukin-6)
known to modulate the expression of HPV genes that would allow
its reactivation in keratinocytes when there is a latent infection; the
increase of growth factors; the effect of HIV-1 Tat protein, which
would intensify the E6 and E7 expression(32), and the activity of
lymphocytes CD4+ T, also in E6 and E7, similar to that observed in
other immunosuppressive conditions, leading to a decreased ability
to detain HPV, which consequently will have its replication increased, keeping intact its epithelial proliferation(32,31). Low CD4+ T-lymphocyte count is associated with a statistically significant risk
to increased incidence of invasive carcinoma, by infection with
HPV among HIV-seropositive women and men(21).
Although there are no well-controlled studies demonstrating
the latent infections reactivation, this seems to occur when immunocompetent patients move to conditions of immunosuppression,
occurring during the use of steroids for long periods or in chronic
diseases. It was observed that in celibate HIV-seropositive women,
the count of lymphocytes CD4+ T was strongly associated with
the detection of new types of HPV, presumably by reactivation of
latent infection previously acquired(33). Herdman et al.(34) postulate
the hypothesis that, during the latent HPV infection phase, some
infected cells can contain both the integrated viral form and the
episomal. However the factors of this possible reactivation are
mostly unknown.
According to Meys et al.(35), inflammatory syndrome of immune
reconstruction (ISIR) could also be seen as a cause of the persistence of HPV infection in HIV-seropositive individuals due to the
change in the modulation of the cutaneous inflammatory response
from the introduction of anti-retroviral therapy (HAART), when
the improvement of cellular immunity occurs, producing reactions
similar to those reverse reactions for leprosy, through mechanisms
still misunderstood.
Several studies in recent years have shown that the incidence of
induced carcinomas in HIV-seropositive population by infection
with HPV has not diminished, despite the institution of HAART
since 1996. The first indicator was the observation that the development of cervical and anal carcinoma is not directly related to the
development of Aids, unlike other malignant diseases associated
with HIV, such as Kaposi’s sarcoma and non-Hodgkin’s lymphoma(2,16). In recent analysis, anal carcinoma is the only one which
incidense is increasing among HIV-seropositives individuals in
the United States of America (USA), from 19/100.000 individuals/
year in the pre-HAART era to 78.2/100.000 individuals/year from
2000 to 2003(36), and 224/100.000 in a cohort study in San Diego(7).
Corroborating these findings, it was observed that the anal HPV
infection and its consequent lesions have also high prevalence in
HIV-seropositive women, observed by a cross-sectional prospective study with 167 women in the USA, where the prevalence of
HPV infection was shown to be similar in the anus (38%) and uterine cervix (33%)(37). According to De Vuyst et al.(38), most cross-sectional studies shows that prevalence of HPV in the uterine cervix is
higher in HIV-seropositive patients than in seronegatives, even after the elimination of bias factors, such as age and sexual behavior.
Treatment of anal lesion associated with HPV
Smaller lesions and perianal warts are usually easier to treat
than larger lesions or anal canal. For the anal region, the common
and well known therapies, such as the use of trichloroacetic acid
70%, electrocauterization, imiquimod or podophyllotoxin gel can
be used for all injuries smaller than 1cm2 at the base. Larger lesions, especially in HIV-seropositive men have a higher rate of recurrence feature and evolution with high-grade lesions, and a study
is usually necessary with an additional biopsy so the type of injury
can be known(39).
All patients with perianal lesions and obligatorily HIV-seropositive immunosuppressed patients should always be referred for
an evaluation by the coloproctologist. If injuries to anal canal are
detected, they must be treated by this expert(39). Due to the local
anatomical challenges, such as the presence of hemorrhoids and
crypts, it can be much more difficult to treat AIN, compared to
CIN. As occurs in the cervical disease, the histology, the size of the
lesion and its location are the determining factors that influence
the type of treatment to be chosen. The AIN I, which probably does
not advance directly to the invasive carcinoma, aims to reduce the
risk of progression or increase of the injury in its early treatment,
which would prevent the use of topical agents and would require a
wider resection with greater morbidity.
Recent guidelines have been published for the treatment of AIN
in the presence of HIV co-infection, which can always be treated in
any grade. And in all patients, AIN II and III should be treated for
prevention of invasive carcinoma(1,18).
In 2007, the New York State Department of Public Health AIDS
Institute recommended the digital anorectal touch and cytological
examination during first appointment of HIV-seropositive MSM,
and also of any patients with a history of AGW and in women with
abnormal histopathological result in cervix and vulva too. Most
early stage anal invaders carcinomas are easily palpable to the touch, even when asymptomatic, and are marked by the presence of
hardening or thickening in the anal canal. Despite the low cost and
the unecessary technology, digital anal touch is unfortynately underused. Suspicion and search for anal carcinoma must be adopted
by professionals as part of the routine clinical care in MSM and in
people with AGW(40).
The self-examination without prior guidance can lead to an excessive fear due to patient’s non-acquaintance of prominences that
can be part of his/her anatomy, as plicomas and hemorrhoids. Therefore, first examination shoud be performed by a doctor, so that a
parameter can be established by them both. Those who are unable
or reluctant to self-examination should delegate the task to their
doctors routinely. Proctoscopy, although desirable, is not strictly
necessary, unless a nodule is detected(41).
DST - J bras Doenças Sex Transm 2013;25(1):41-45
44
Prophilactic vaccination
Sexual abstinence, mutual long-term fidelity and use of condoms were the only possible actions in the primary prevention
of anogenital HPV infections until recently. Currently, the more
effective weapon in primary prevention of HPV infection is the
vaccination aimed at viral types most frequently responsible for
anogenital lesions. Today there are two safe and effective vaccines
for infections and diseases caused by HPV types contained in the
products. Both of these use vectors that express the L1 gene of
the virus, used successfully to generate VLP, that induce high titers
of specific antibodies(33).
The quadrivalent vaccine approved by ANVISA (Brazilian Health Surveillance Agency) has four VLPs: 6, 11, 16 and 18 – viral
types associated with AGW and carcinomas. In Brazil, it is released for use in women and men from 9 to 26 years of age(10).
The vaccine induced protection mechanism seems to be mediated mainly, if not entirely, by high concentrations of neutralizing
antibodies (or ten times higher than the concentrations after natural
infection). Prophylactic vaccination with L1 VLP has shown to be
very effective in the prevention of primary infection, latent infection and associated diseases. However, serum concentrations of
antibodies necessary to grant protection against this infection are
unknown, therefore the period of protection given by vaccines continues to be indeterminate(33). In the Australian study to evaluate the
quadrivalent vaccine, from a randomized double-blind trial with
1,781 males and females aged 9-15 years, 99.5% or more patients
had high rate of antibodies in the serum in the seventh month after
applying the third dose, a rate also above the natural infection(42).
So far the effectiveness of prophylactic vaccination against
HPV infection in men is still unknown and results from various
studies are expected to occur in a near future(43). Farley et al. study
in Australia, in 2009(44), observed a sharp reduction of AGW among
women in the target age group in the year following the implementation of a national programme of vaccination against HPV,
a decrease that clearly differed from previous trends in clinical
diagnostics. Another subgroup which showed a modest decrease
of AGW presented by this same study was the heterosexual men
group, and remarkably there was no difference in the AGW diagnosis in the studied period between gay men or women outside the
age range eligible for free vaccination. The quadrivalent vaccine
has also shown efficacy against infection in heterosexual men and
MSM between 16 and 26 years of age. In a randomized trial with
4,065 people, the quadrivalent vaccine efficacy against AGW was
of 89.4%. Further analysis of effectiveness of the vaccine in MSM
(n = 602; age: 16-26 years) confirms the benefits of HPV vaccination in reducing the burden of anogenital HPV infection and incidence of AGW (79.0%). However, the most anticipated data are
about the impact both of the vaccine on AIN and the inclusion of
male in vaccination programs.
The potential impact of vaccination programs is estimated via
mathematical modeling. This model predicts that a vaccination
programme for children of 12 years of age, male and female, would
prevent 90 cases of UCC until 2055, compared with 71 cases with
the vaccination programme solely aimed at girls up to 15 years of
age(45). No model predicted the impact of a vaccination programme
for all about the rates of penile carcinoma, anal, male and female,
or of any impact on oropharyngeal carcinoma.
DST - J bras Doenças Sex Transm 2013;25(1):41-45
dobao & CAVALCANTI
It is obvious thinking that the incorporation of men in a routine
vaccination against HPV will probably reduce the burden of the
disease not only in men, but also in women, and would help eliminate the stigma that focuses on the disease in women. However,
considering public health, we recognize that the cost-benefit analysis is necessary to determine the effectiveness of these programs
for the general population. Such analyses shall be fundamental in
guiding the conception, acceptance and implementation of those
programmes in clinical practice(42).
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
Palefsky JM. HPV Infection in men. Disease markers. 2007;23:261-272.
Palefsky JM. Human Papillomavirus-Related disease in Men: Not Just a
Women’s Issue. Journal of Adolescent Health. 2010;46:12-19.
Afonso LA, Moyses N, Alves G, Ornellas AA, Passos MRL, Oliveira
LHS et al. Prevalence of human papillomavirus and Epstein-Barr virus
DNA in penile cancer cases from Brazil. Mem Inst Oswaldo Cruz, Rio de
Janeiro. 2012;107(1):18-23.
Uronis HE, Bendell JC. Anal cancer: an overview. Oncologist.
2007;12:524-534.
Jin F, Stein AN, Conway EL, Regan DG, Law M, Brotherton JML et al.
Trends in anal cancer in Australia. Vaccine. 2011;29:2322-2337.
Fox P. Anal cancer screening in men who have sex with men. Current
Opinion in HIV and AIDS. 2009;4:64-67.
Chiao EY, Krown SE, Stier EA, Schrag D. A population-based analysis of
temporal trends in the incidence of squamous anal canal cancer in relation
to the HIV epidemic. Journal of Acquired Immune Deficiency Syndrome.
2005;40:451-5.
Kreuter A, Brockmeyer NH, Weissnborn SJ, Gambichler T, Stucker M,
Altmeyer P et al. Penile Intraepithelial Neoplasia Is Frequent in HIV-Positive Men with Anal Dysplasia. Journal of Investigative Dermatology.
2008;53:252-261.
Burd EM. Human Papillomavirus and Cervical Cancer. Clinical Microbiology Reviews. Jan. 2003;1-17.
Passos MRL, Almeida G, Giraldo PC, Cavalcanti SMB, Côrtes Junior JC,
Bravo RS et al. Papilomavirose humana em genital, parte I. J bras Doenças Sex Transm. 2008;20(2):108-124.
Partridge JM, Hughes JP, Feng Q et al. Genital human papillomavirus
infection in men. Lancet Inf Dis. 2006;6(1):21-31.
Giuliano AR, Harris R, Sedjo RL, Baldwin S, Roe D, Papenfuss MR et
al. Incidence, prevalence and clearance of type-specific human papillomavirus infections: The Young Women’s Health Study. J Infect Dis.
2002;186(4):462-9.
Giuliano AR, Lu B, Nielson C et al. Age specific prevalence, incidence
and duration of human papillomavirus infection among a cohort of 290
US men. J Infect Dis. 2008b;198:827-835.
Castellsagué X, Bosch XF, Munõz, Meijer CJLM, Shah KV, Franceschi S et al. Male circumcision, penile human papillomavirus infection,
and cervical cancer in female partners. Engl J Med. 2002;346(15):11051112.
Joseph D, Miller J, WU X et al. Understanding the burden of human papilloma-virus-associated anal cancers in the US. Cancer.
2008;113:2892-2900. Available at: http://seer.cancer.gov/statfacts/html/
anus.html#references Acessed in: 25 ago 2012.
Frisch M, Glimelius B, Adrian JC, Van Den Brule A, Wohlfahrt J, Meijer
CJLM et al. Sexually transmitted infection as a cause of anal cancer. New
England Journal of Medicine. 1997;337:1350-1358.
Schiffman M, Castle PE. Human papillomavirus: epidemiology and public
health. Archives of pathology & laboratory medicine. 2003;127(8):930934.
Chin-Hong PV, Palefsky JM. Human papillomavirus anogenital disease in
HIV-infected individuals. Dermatologic Therapy. 2005;18:67-76.
Palefsky JM, Holly EA, Ralston ML et al. Prevalence and risk factors for
human papillomavirus infection of the anal canal in human immunodeficiency virus (HIV)-positive and HIV-negative homosexual men. J Infect
Dis. 1998;177:361-7.
45
Virological and Epidemiological Aspects of Anal Carcinoma: Current and Future Challenges
20. Palefsky JM, Holly EA, Efirdc JT, Da Costa M, Jay N, Berry JM et al.
Anal intraepithelial neoplasia in the highly active antiretroviral therapy era
among HIV-positive men who have sex with men. AIDS. 2005;19:14071414.
21. Palefsky JM. Human papillomavirus-related disease in people with HIV.
Curr Opin HIV AIDS. 2009a;4(1):52-56.
22. Palefsky JM. Anal cancer prevention in HIV-positive men and women.
Curr Opin Oncol. 2009b;21:433-438.
23. Bower M, Powles T, Newsom-Davis T, Thirlwell C, Stebbing J, Mandalia
S et al. HIV-associated anal cancer: has highly active antiretroviral therapy reduced the incidence or improved the outcome? J Acquir Immune
Defic Syndr. 2004;37:1563-5.
24. Clifford GM, Polesel J, Rickenbach M et al. Cancer risk in the Swiss HIV
Cohort Study: associations with immunodeficiency, smoking, and highly
active antiretroviral therapy. J Natl Cancer Inst. 2005;97:425-32.
25. Petruckevitch A, Del Amo J, Philips AN, Stephenson JM, Johnson AM,
De Cock KM. Risk of cancer in patients with HIV disease. London African HIV/AIDS Study Group. Int J STD AIDS. 1999;10:38-42.
26. Abbas A, Yang G, Fakih M. Management of Anal Cancer in 2010 - Part 1:
Overview, Screening, and Diagnosis. Oncology. 2010;24:4.
27. Darragh TM, Winkler B. Cancer and cervical cancer screening: key differences. Cancer Cytopathology. 2011;119(1):5-19.
28. Chin-Hong PV, Husnick M, Cranston RD et al. Anal human papillomavirus infection is associated with HIV acquisition in men who have sex with
men. AIDS. 2009;23:1135-42.
29. McCloskey JC, Metcalf C, French MA et al. The frequency of high grade
intraepithelial neoplasia in anal/perianal warts is higher than previously
recognized. Int J STD AIDS. 2007;18:538-542.
30. Gormley RH, Kovarik C. Dermatologic Manifestations of HPV in HIV-Infected Individuals. Current HIV/AIDS Reports. 2009;6:130-138.
31. Frisch M, Biggar RJ, Goedert JJ. Human papillomavirus-associated cancers in patients with human immunodeficiency virus infection and acquired immunodeficiency syndrome. J Natl Cancer Inst. 2000;92:1500-10.
32. Kreuter A, Pottohoff A, Brockmeyer NH, Gambichler T, Swoboda J, Stucker M et al. Anal carcinoma in human immunodeficiency virus-positive
men: results of a prospective study from Germany. British Journal of Dermatology. 2010;162(6):1269.
33. Einstein MH, Schiller JT, Viscidi RP, Strickler HD, Coursaget P, Tan T et
al. Clinician’s guide to human papillomavirus immunology: knowns and
unknowns. Available in: www.thelancet.com/infection. Vol 9, June 2009.
Accessed in: 30 set 2012.
34. Herdman MT, Pett MR, Roberts I et al. Interferon-beta treatment of cervical keratinocytes naturally infected with human Papillomavirus 16 episomes promotes rapid reduction in episome numbers and emergence of
latent integrants. Carcinogenesis. 2006;27:2341-53.
35. Meys R, Gotch FM, Bunker CB. Human papillomavirus in the era of highly active antiretroviral therapy for human immunodeficiency virus: an
immune reconstitution-associated disease? British Journal of Dermatology. 2010;162:6-11.
36. Patel P, Hanson DL, Sullivan PS, Novak RM, Moorman AC, Tong TC et
al. Incidence of types of cancer among HIV-infected persons compared
with the general population in the United States, 1992-2003. Ann Intern
Med. 2008;148(10):728-36.
37. Kojic EM, Cu-Uvin S, Conley L et al. Human papillomavirus infection and cytologic abnormalities of the anus and cervix among HIV-infected women in the study to understand the natural history of HIV/
AIDS in the era of effective therapy (The SUN Study). Sex Transm Dis.
2011;38:253-259.
38. De Vuyst H, Lillo F, Broutet N, Smith JS. Human papillomavirus, and
cervical neoplasia and cancer in the era of highly active antiretroviral therapy. European Journal of Cancer Prevention. 2008;17:545-554.
39. Centers for Disease Control and Prevention (CDC). MMWR-Recomendations and Reports, 59, N.RR-12 Dez.2010. Available at: www.cdc.gov/
mmwr/pdf/rr/rr5912.pdf. Accessed in: 02 nov 2012.
40. Chiao EY, Giordano TP, Palefsky JM, Tyring S, El Serag H. Screening
HIV-infected individuals for anal cancer precursor lesions: a systematic
review. HIV/AIDS. 2006;43, July.
41. Pitts MK, Fox C, Willis J, Anderson J. What do gay men know about
human papilloma virus? Australian gay men’s knowledge and experience
of anal cancer screening and the human papilloma virus. Sex Trans Dis.
2007;34:170-173.
42. Garland SM. Strategies against human papillomavirus in males. Gynecologic Oncology. 2010;117:20-25.
43. Palefsky JM, Giuliano AR, Goldstone S, Moreira ED, Aranda C, Jessen
H et al. HPV Vaccine against Anal HPV Infection and Anal Intraepithelial
Neoplasia. The New England Journal of Medicine. 2011;365:1576-85.
44. Fairley CK, Hocking JS, Gurrin LC, Chen MY, Donovan B, Bradshaw C.
Rapid decline in presentations for genital warts after the implementation
of a national quadrivalent human papillomavirus vaccination program for
young women. Sex Transm Infect. 2009;85(7):499-502.
45. French M, Barnabas RB, Lehtinen M, Kontula O, Pukkala E, Dillner J et
al. Strategies for the introduction of human papillomavirus vaccination:
modeling the optimum age and sex specific pattern of vaccination in Finland. Br J Cancer. 2007;96:514-8.
Address to correspondence:
Elisabete Aida RODRIGUES Dobao
Av. Américas, 4.200, Bl.8-B, sala 116 - Barra da Tijuca
CEP: 22640-102
E-mail: [email protected]
Received in: 21.03.2013
Approved in: 24.05.2013
DST - J bras Doenças Sex Transm 2013;25(1):41-45
SHORT COMMUNICATION
Genital Ulcer Signaling Recent Syphilis in an HIV
Infected Patient: the Diagnosis Challenge
Úlcera Genital Sinalizando Sífilis Recente em um Paciente Infectado pelo HIV: o Desafio do
Diagnóstico
Eliane de Dios Abad1, Ana Beatriz A Queiroz2, Aline DT Oliveira3, Fernanda S Cavalcante4,
Hercília Regina A Montenegro5, Márcia Ribeiro6, Dennis C Ferreira7
CASE REPORT
A 38 years old male patient, infected by human immunodeficiency virus (HIV) for six years and six months, without adhering
to antiretroviral therapy since diagnosis he presented the main
complaint as “the presence of a wound on his penis” for 30 days.
Initially it was diagnosed as “candidiasis” in a service, and was treated with ketoconazole 200 mg/day and nystatin 100.000 IU (units
per gram) cream for 10 days without clinical improvement.
Then in another service it was requested VDRL(1) (Venereal Disease Research Laboratory) and FTA-Abs (fluorescent treponemal
antibody absorption) with negative results, diagnosed with HSV
(Herpes simplex virus) infection he used acyclovir 200 mg, 5 x/
day, PO, for 7 days, with no difference to the same lesion. In another appointment with a dermatologist, after anamnesis the patient
stated that he did not have an exclusive steady partner, he had a
sporadic use of condoms and his last sexual intercourse had occurred 20 days before the onset of the lesion. His CD4 (CD4 lymphocytes) count was 250 mm3 and HIV viral load 90,000 copies/
mm3 of and he was under use of Highly Active Antiretroviral Therapy (tenofovir, lamivudine and efavirenz).
Clinical examination showed a lesion in the glans of the penis involving the urethral meatus, with raised edges, well defined, measuring about 3.0 cm in diameter and clean background,
odorless, with right inguinal lymphadenopathy, suggestive of
“syphilitic hard chancre” (Figure 1 – A and B). VDRL titling was
conducted with 1/8 and value of 1/16 after 10 days. Benzathine
penicillin was prescribed and the patient refused the treatment.
However, the patient was seen by another professional who
prescribed after diagnosis doxycycline 100 mg PO 12/12 h for
1 MD, Doctoral student of Clinical Medicine of Federal University of Rio
de Janeiro – UFRJ.
2 RN, Associate Professor of Department of Maternal-Child Nursing – Anna
Nery School of Nursing – EEAN-UFRJ. Coordinator of Multidisciplinary
Residency in Women’s Health HESFA/UFRJ. Professor of Post-graduate
stricto sensu EEAN/UFRJ.
3 DDS, Master Student of Dentistry of School of Dentistry, Veiga de
Almeida University – UVA, Rio de Janeiro, Brazil.
4 PhD Student of Microbiology of Institute of Microbiology Paulo de Goes
– IMPPG-UFRJ.
5 Professor of Nursing Graduation – UNIABEU.
6 Professor of Medical Genetics of Instituto de Puericultura e Pediatria
Martagão Gesteira – IPPMG-UFRJ.
7 Professor of School of Dentistry of Veiga de Almeida University – UVA.
Professor of Pharmacy, Nursing and Physiotherapy Graduate Courses –
UNIABEU.
DST - J bras Doenças Sex Transm 2013;25(1):46 - ISSN: 0103-4065 - ISSN on-line: 2177-8264
A
b
Figure 1 – Images A and B – regular plaque with erythema and scales
in the edge, around the urethral meatus.
14 days(2), which was followed showing complete regression of
the lesion in 3 weeks. Even without making use of penicillin and
azithromycin, he performed control of cure with no treponemal
serology quantitative test for 3 in 3 months during the first year
and then was discharged(3).
REFERENCES
1.
2.
3.
Meyer MP, Baughn RE. Whole-blood hemagglutination inhibition test for
venereal disease research laboratory (VDRL) antibodies. J Clin Microbiol. 2000;38(9):3413-4.
Centers for Disease Control and prevention (CDC). Sexually transmitted disease. Treatment guideline 2010. MMWR Morb Mortal Wkly Rep.
2010;59 RR-12.
Passoni LFC, Menezes JA, Ribeiro SR, Sampaio ECO. Lues maligna in
an HIV-infected patient. Rev Soc Bras Med Trop. 2005;38(2):181-184.
Address to correspondence:
DENNIS DE CARVALHO FERREIRA
Avenida Carlos Chagas Filho, 373 CCS, Bloco I, Sala 12-010
Cidade Universitária, Rio de Janeiro, RJ, Brazil
CEP: 21941-902
E-mail: [email protected]
Phone: +55 (21) 2560-8344
Fax: +55(21) 2560-8028
Received in: 16.06.2013
Approved in: 28.08.2013
DOI: 10.5533/DST-2177-8264-201325110